ID: 1122913715

View in Genome Browser
Species Human (GRCh38)
Location 14:104846165-104846187
Sequence GGCTAAATCCTGGGAAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122913715_1122913722 3 Left 1122913715 14:104846165-104846187 CCTTCCCTTCCCAGGATTTAGCC No data
Right 1122913722 14:104846191-104846213 AGGTGATGAGATGTCGCTGCTGG No data
1122913715_1122913727 28 Left 1122913715 14:104846165-104846187 CCTTCCCTTCCCAGGATTTAGCC No data
Right 1122913727 14:104846216-104846238 GGTGACAGGCAGGACAGCTGAGG No data
1122913715_1122913726 18 Left 1122913715 14:104846165-104846187 CCTTCCCTTCCCAGGATTTAGCC No data
Right 1122913726 14:104846206-104846228 GCTGCTGGTGGGTGACAGGCAGG No data
1122913715_1122913728 29 Left 1122913715 14:104846165-104846187 CCTTCCCTTCCCAGGATTTAGCC No data
Right 1122913728 14:104846217-104846239 GTGACAGGCAGGACAGCTGAGGG No data
1122913715_1122913725 14 Left 1122913715 14:104846165-104846187 CCTTCCCTTCCCAGGATTTAGCC No data
Right 1122913725 14:104846202-104846224 TGTCGCTGCTGGTGGGTGACAGG No data
1122913715_1122913723 6 Left 1122913715 14:104846165-104846187 CCTTCCCTTCCCAGGATTTAGCC No data
Right 1122913723 14:104846194-104846216 TGATGAGATGTCGCTGCTGGTGG No data
1122913715_1122913724 7 Left 1122913715 14:104846165-104846187 CCTTCCCTTCCCAGGATTTAGCC No data
Right 1122913724 14:104846195-104846217 GATGAGATGTCGCTGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122913715 Original CRISPR GGCTAAATCCTGGGAAGGGA AGG (reversed) Intergenic
No off target data available for this crispr