ID: 1122913716

View in Genome Browser
Species Human (GRCh38)
Location 14:104846169-104846191
Sequence TAGAGGCTAAATCCTGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122913716_1122913730 30 Left 1122913716 14:104846169-104846191 CCCTTCCCAGGATTTAGCCTCTA No data
Right 1122913730 14:104846222-104846244 AGGCAGGACAGCTGAGGGAAGGG No data
1122913716_1122913724 3 Left 1122913716 14:104846169-104846191 CCCTTCCCAGGATTTAGCCTCTA No data
Right 1122913724 14:104846195-104846217 GATGAGATGTCGCTGCTGGTGGG No data
1122913716_1122913723 2 Left 1122913716 14:104846169-104846191 CCCTTCCCAGGATTTAGCCTCTA No data
Right 1122913723 14:104846194-104846216 TGATGAGATGTCGCTGCTGGTGG No data
1122913716_1122913727 24 Left 1122913716 14:104846169-104846191 CCCTTCCCAGGATTTAGCCTCTA No data
Right 1122913727 14:104846216-104846238 GGTGACAGGCAGGACAGCTGAGG No data
1122913716_1122913729 29 Left 1122913716 14:104846169-104846191 CCCTTCCCAGGATTTAGCCTCTA No data
Right 1122913729 14:104846221-104846243 CAGGCAGGACAGCTGAGGGAAGG No data
1122913716_1122913722 -1 Left 1122913716 14:104846169-104846191 CCCTTCCCAGGATTTAGCCTCTA No data
Right 1122913722 14:104846191-104846213 AGGTGATGAGATGTCGCTGCTGG No data
1122913716_1122913725 10 Left 1122913716 14:104846169-104846191 CCCTTCCCAGGATTTAGCCTCTA No data
Right 1122913725 14:104846202-104846224 TGTCGCTGCTGGTGGGTGACAGG No data
1122913716_1122913726 14 Left 1122913716 14:104846169-104846191 CCCTTCCCAGGATTTAGCCTCTA No data
Right 1122913726 14:104846206-104846228 GCTGCTGGTGGGTGACAGGCAGG No data
1122913716_1122913728 25 Left 1122913716 14:104846169-104846191 CCCTTCCCAGGATTTAGCCTCTA No data
Right 1122913728 14:104846217-104846239 GTGACAGGCAGGACAGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122913716 Original CRISPR TAGAGGCTAAATCCTGGGAA GGG (reversed) Intergenic
No off target data available for this crispr