ID: 1122913721

View in Genome Browser
Species Human (GRCh38)
Location 14:104846186-104846208
Sequence AGCGACATCTCATCACCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122913721_1122913731 20 Left 1122913721 14:104846186-104846208 CCTCTAGGTGATGAGATGTCGCT No data
Right 1122913731 14:104846229-104846251 ACAGCTGAGGGAAGGGCCCCAGG No data
1122913721_1122913728 8 Left 1122913721 14:104846186-104846208 CCTCTAGGTGATGAGATGTCGCT No data
Right 1122913728 14:104846217-104846239 GTGACAGGCAGGACAGCTGAGGG No data
1122913721_1122913729 12 Left 1122913721 14:104846186-104846208 CCTCTAGGTGATGAGATGTCGCT No data
Right 1122913729 14:104846221-104846243 CAGGCAGGACAGCTGAGGGAAGG No data
1122913721_1122913726 -3 Left 1122913721 14:104846186-104846208 CCTCTAGGTGATGAGATGTCGCT No data
Right 1122913726 14:104846206-104846228 GCTGCTGGTGGGTGACAGGCAGG No data
1122913721_1122913727 7 Left 1122913721 14:104846186-104846208 CCTCTAGGTGATGAGATGTCGCT No data
Right 1122913727 14:104846216-104846238 GGTGACAGGCAGGACAGCTGAGG No data
1122913721_1122913730 13 Left 1122913721 14:104846186-104846208 CCTCTAGGTGATGAGATGTCGCT No data
Right 1122913730 14:104846222-104846244 AGGCAGGACAGCTGAGGGAAGGG No data
1122913721_1122913732 27 Left 1122913721 14:104846186-104846208 CCTCTAGGTGATGAGATGTCGCT No data
Right 1122913732 14:104846236-104846258 AGGGAAGGGCCCCAGGAATCTGG No data
1122913721_1122913725 -7 Left 1122913721 14:104846186-104846208 CCTCTAGGTGATGAGATGTCGCT No data
Right 1122913725 14:104846202-104846224 TGTCGCTGCTGGTGGGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122913721 Original CRISPR AGCGACATCTCATCACCTAG AGG (reversed) Intergenic
No off target data available for this crispr