ID: 1122913726

View in Genome Browser
Species Human (GRCh38)
Location 14:104846206-104846228
Sequence GCTGCTGGTGGGTGACAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122913715_1122913726 18 Left 1122913715 14:104846165-104846187 CCTTCCCTTCCCAGGATTTAGCC No data
Right 1122913726 14:104846206-104846228 GCTGCTGGTGGGTGACAGGCAGG No data
1122913720_1122913726 8 Left 1122913720 14:104846175-104846197 CCAGGATTTAGCCTCTAGGTGAT No data
Right 1122913726 14:104846206-104846228 GCTGCTGGTGGGTGACAGGCAGG No data
1122913719_1122913726 9 Left 1122913719 14:104846174-104846196 CCCAGGATTTAGCCTCTAGGTGA No data
Right 1122913726 14:104846206-104846228 GCTGCTGGTGGGTGACAGGCAGG No data
1122913713_1122913726 27 Left 1122913713 14:104846156-104846178 CCAGAGGGACCTTCCCTTCCCAG No data
Right 1122913726 14:104846206-104846228 GCTGCTGGTGGGTGACAGGCAGG No data
1122913717_1122913726 13 Left 1122913717 14:104846170-104846192 CCTTCCCAGGATTTAGCCTCTAG No data
Right 1122913726 14:104846206-104846228 GCTGCTGGTGGGTGACAGGCAGG No data
1122913716_1122913726 14 Left 1122913716 14:104846169-104846191 CCCTTCCCAGGATTTAGCCTCTA No data
Right 1122913726 14:104846206-104846228 GCTGCTGGTGGGTGACAGGCAGG No data
1122913721_1122913726 -3 Left 1122913721 14:104846186-104846208 CCTCTAGGTGATGAGATGTCGCT No data
Right 1122913726 14:104846206-104846228 GCTGCTGGTGGGTGACAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122913726 Original CRISPR GCTGCTGGTGGGTGACAGGC AGG Intergenic
No off target data available for this crispr