ID: 1122914540

View in Genome Browser
Species Human (GRCh38)
Location 14:104852051-104852073
Sequence CTCCTGAGTGAGGCCTGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122914540_1122914545 -4 Left 1122914540 14:104852051-104852073 CCGCAGCAGGCCTCACTCAGGAG No data
Right 1122914545 14:104852070-104852092 GGAGAGGCTGAGGGAAGAGATGG No data
1122914540_1122914549 25 Left 1122914540 14:104852051-104852073 CCGCAGCAGGCCTCACTCAGGAG No data
Right 1122914549 14:104852099-104852121 CCACCAGAGGCCCCTCTGAGAGG No data
1122914540_1122914546 -3 Left 1122914540 14:104852051-104852073 CCGCAGCAGGCCTCACTCAGGAG No data
Right 1122914546 14:104852071-104852093 GAGAGGCTGAGGGAAGAGATGGG No data
1122914540_1122914547 12 Left 1122914540 14:104852051-104852073 CCGCAGCAGGCCTCACTCAGGAG No data
Right 1122914547 14:104852086-104852108 GAGATGGGCAGTGCCACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122914540 Original CRISPR CTCCTGAGTGAGGCCTGCTG CGG (reversed) Intergenic
No off target data available for this crispr