ID: 1122914813

View in Genome Browser
Species Human (GRCh38)
Location 14:104853950-104853972
Sequence CTGCGGTTCATCAGGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122914813_1122914818 5 Left 1122914813 14:104853950-104853972 CCATTTTCCCTGATGAACCGCAG No data
Right 1122914818 14:104853978-104854000 GGATTCCCGCTGAAGTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122914813 Original CRISPR CTGCGGTTCATCAGGGAAAA TGG (reversed) Intergenic
No off target data available for this crispr