ID: 1122915529

View in Genome Browser
Species Human (GRCh38)
Location 14:104856647-104856669
Sequence TCCACAGCGAGCAAAGACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122915529_1122915534 -10 Left 1122915529 14:104856647-104856669 CCACGGTCTTTGCTCGCTGTGGA No data
Right 1122915534 14:104856660-104856682 TCGCTGTGGAAAGCGGGGACGGG No data
1122915529_1122915535 2 Left 1122915529 14:104856647-104856669 CCACGGTCTTTGCTCGCTGTGGA No data
Right 1122915535 14:104856672-104856694 GCGGGGACGGGCGCTGACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122915529 Original CRISPR TCCACAGCGAGCAAAGACCG TGG (reversed) Intergenic
No off target data available for this crispr