ID: 1122919530

View in Genome Browser
Species Human (GRCh38)
Location 14:104874335-104874357
Sequence GAATTTGAACAGGGTGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122919522_1122919530 16 Left 1122919522 14:104874296-104874318 CCAGGAGCCACGTAGCTGTGGGT 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1122919530 14:104874335-104874357 GAATTTGAACAGGGTGGACCTGG 0: 1
1: 0
2: 0
3: 9
4: 132
1122919523_1122919530 9 Left 1122919523 14:104874303-104874325 CCACGTAGCTGTGGGTGCCAGCT 0: 1
1: 0
2: 1
3: 8
4: 119
Right 1122919530 14:104874335-104874357 GAATTTGAACAGGGTGGACCTGG 0: 1
1: 0
2: 0
3: 9
4: 132
1122919519_1122919530 28 Left 1122919519 14:104874284-104874306 CCACTGGGGTGGCCAGGAGCCAC 0: 1
1: 1
2: 3
3: 36
4: 345
Right 1122919530 14:104874335-104874357 GAATTTGAACAGGGTGGACCTGG 0: 1
1: 0
2: 0
3: 9
4: 132
1122919526_1122919530 -8 Left 1122919526 14:104874320-104874342 CCAGCTTCGGAGAAGGAATTTGA 0: 1
1: 0
2: 0
3: 8
4: 159
Right 1122919530 14:104874335-104874357 GAATTTGAACAGGGTGGACCTGG 0: 1
1: 0
2: 0
3: 9
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122919530 Original CRISPR GAATTTGAACAGGGTGGACC TGG Intronic
902067341 1:13699598-13699620 GAAGATGAACTGGGTGGAACTGG - Intergenic
904129878 1:28267797-28267819 GAATCTGAGCAGGGTGTACAAGG - Intronic
905289944 1:36914365-36914387 GAAGTTGAACAAGGTTGAGCAGG + Intronic
905701501 1:40019207-40019229 TAATTTGAACAGGAAGGGCCGGG - Intergenic
906322526 1:44826134-44826156 GAATTTGGGCTGGGTGGACGTGG - Intronic
906936142 1:50215449-50215471 GAATTTAAACAGGGTAGAAAGGG - Intergenic
908810100 1:67973267-67973289 GAATTTGAACAATGTGGTGCTGG - Intergenic
910206799 1:84756279-84756301 AAATGTGAACAGGCTGCACCAGG - Intergenic
911417340 1:97591188-97591210 CATTTTAAACAGGGTGGCCCTGG - Intronic
912210726 1:107554139-107554161 GAATTTTTTCAGGGTGGCCCAGG + Intergenic
913062356 1:115220117-115220139 AAATATGTACAGGGTGGACTGGG + Intergenic
916574794 1:166057846-166057868 GAAATTGAACAGGGTGGGGTGGG + Intronic
917778072 1:178360219-178360241 GAAGTTGAAGAGGGTAGAGCAGG - Intronic
919532705 1:198744599-198744621 GAAGTTGAACTGGCTGGAGCTGG + Intronic
920242436 1:204562757-204562779 GAGTTTGAAGAGAGTGGAGCAGG + Intergenic
1063853180 10:10216446-10216468 GATTTGTAACAAGGTGGACCTGG - Intergenic
1064066471 10:12186483-12186505 AAATGTGAACAGGGAGGCCCGGG + Intronic
1070083657 10:73213135-73213157 GAATATGAACAGGCTGGGCATGG - Intronic
1074417290 10:113278295-113278317 GAGTTTGCAAAGGGTGGTCCTGG - Intergenic
1081762529 11:45586409-45586431 GAAGCTGAATAGGCTGGACCCGG - Intergenic
1084125869 11:67098664-67098686 GAATTTGACCCGGCTGCACCCGG + Intergenic
1084214425 11:67639831-67639853 GAACTTGAAGAGGGAGGACAAGG - Intergenic
1086044016 11:82511353-82511375 GAGTTTTAACAGGATGGAGCAGG + Intergenic
1086342767 11:85863820-85863842 GAATTTGAAGAAGCTTGACCTGG + Intronic
1087791164 11:102407466-102407488 GAATTTGGGCAGGGTGGAGAGGG - Intronic
1088966558 11:114728067-114728089 GATTTTGAACATGGAGGACGGGG - Intergenic
1090052666 11:123393755-123393777 CACATTGAAGAGGGTGGACCTGG - Intergenic
1090853019 11:130587168-130587190 GAATTTGGACAGGGTACATCTGG + Intergenic
1092136906 12:6155753-6155775 GTATTTCTACAGGGTGAACCTGG - Intergenic
1092486144 12:8903541-8903563 GAATTTTAACAGAGTGGTCAGGG - Intergenic
1097137050 12:56865679-56865701 CAATTTGAACAGCCTGGGCCAGG + Intergenic
1097797267 12:63876926-63876948 GAAGTTGAAAATGGTGGGCCAGG + Intronic
1099359268 12:81678889-81678911 GCATTTGAACAGGATGGAGAGGG - Intronic
1100889953 12:99114459-99114481 GAATTTAAACAGGGTGGGCATGG + Intronic
1101610736 12:106289228-106289250 GAATTTGAACAGGATTCAGCAGG - Intronic
1103270622 12:119670045-119670067 GAATTTAAACAGGCTGCAGCAGG - Intronic
1105292019 13:19059273-19059295 GATTTGGTACAGGGTGGCCCAGG - Intergenic
1110238648 13:73242805-73242827 GAATTTGGAAAGGGTGCAGCAGG - Intergenic
1113047868 13:106175104-106175126 GTATTTAAACAGGGTGGCCAGGG - Intergenic
1113851339 13:113420377-113420399 GCATTCAAACAGGGTGGACTCGG - Intergenic
1114431777 14:22667501-22667523 AAATATGAACAGTGTAGACCAGG - Intergenic
1115627290 14:35206479-35206501 GGGTTTGAACAGAGTAGACCTGG - Intronic
1122098631 14:99389495-99389517 GGTTTTGACCAGGGTGGACAGGG + Intergenic
1122642155 14:103166225-103166247 GAAGCTGAAGAGGGAGGACCGGG - Intergenic
1122919530 14:104874335-104874357 GAATTTGAACAGGGTGGACCTGG + Intronic
1124268786 15:28262008-28262030 GTATTTGAAGTAGGTGGACCTGG - Intronic
1125419744 15:39492718-39492740 GAATATGAACTTGGTGGACAGGG + Intergenic
1128690455 15:69720886-69720908 GAATTTGAACAGAGGGGAAAAGG - Intergenic
1130839264 15:87682457-87682479 GAATGTGCATAGGGAGGACCTGG + Intergenic
1131443134 15:92473847-92473869 GCATTTCCACTGGGTGGACCCGG - Intronic
1132191402 15:99865414-99865436 AAATTTGAACAGGCTGGGCACGG + Intergenic
1132325828 15:100969128-100969150 GAAAATGAGCAGGCTGGACCTGG - Intronic
1137026579 16:35482127-35482149 GCCTTAGAAGAGGGTGGACCTGG - Intergenic
1137485015 16:48883364-48883386 GAACTTGAAAAGGATGGACAGGG + Intergenic
1141870553 16:86782612-86782634 GAATTTGAACAGCATAGACCAGG - Intergenic
1147816785 17:43216226-43216248 GAAGCTGTACAGGATGGACCTGG + Intronic
1149354490 17:55826096-55826118 GAATTTGAACCCAGTGTACCTGG + Intronic
1151350907 17:73531666-73531688 GAATTTGAACAGGAAGCACATGG - Intronic
1154123423 18:11669889-11669911 GAGGGTGAACAGGGTGGACTGGG + Intergenic
1155418908 18:25632770-25632792 GAAATTGAAGAGGGTGGGTCAGG - Intergenic
1155639616 18:27998099-27998121 GAATTTGAACAGAGTTGGCCAGG - Intronic
1156398233 18:36718124-36718146 GAAATTCAACAGTGGGGACCTGG + Exonic
1157758916 18:50244590-50244612 GAAACTGAACAGGATGAACCTGG + Intronic
1158111359 18:53944016-53944038 GATTTTGGCCAGGGTTGACCAGG - Intergenic
1158389706 18:57035051-57035073 GGCTTTGAACAGGGAGGAGCTGG - Exonic
1158407313 18:57171588-57171610 GAATTAGAAAAGGGAGAACCTGG + Intergenic
1161098789 19:2409936-2409958 GAATTTGAGGACTGTGGACCTGG + Intronic
1161495089 19:4581985-4582007 GAGTTTGAACAGAGGGGACCAGG - Intergenic
1163674760 19:18650038-18650060 GGAATTGAACAGGCTGGGCCTGG + Intronic
1165079164 19:33297962-33297984 GAGTGTGAACAGGGTCCACCAGG - Intergenic
1165709486 19:37999877-37999899 GGTCTTGAACAGTGTGGACCAGG + Intronic
926323149 2:11762936-11762958 GAATGGGAGCAGTGTGGACCAGG + Intronic
926497018 2:13603184-13603206 GAAATTGAGCAGAGTGGACTTGG + Intergenic
932735363 2:74250615-74250637 GAACTTGACCAGGGTGGATGGGG + Intronic
937069325 2:119050660-119050682 CAACTTGAACAGGGTGAACAGGG - Intergenic
938750077 2:134320087-134320109 GAATCTGAATAGGGTGGCTCTGG - Intronic
939780548 2:146441399-146441421 GAATTTGAAATAGGAGGACCTGG - Intergenic
941900681 2:170675380-170675402 CAATTTTAACAGGGTGGTCCAGG + Intergenic
946382026 2:219355255-219355277 GAATATGAAGAGGGTGGCCAGGG - Intergenic
946767864 2:223056821-223056843 TAATTAGAACAGTGTGGAGCAGG - Intronic
948487046 2:238287963-238287985 GAATTAATACAGGGTGGTCCAGG + Intronic
1169092229 20:2867951-2867973 GAATTTGGACAGGTTGTAACAGG + Intronic
1175063222 20:56262867-56262889 AAATTTGCACAGGGTGGACGTGG - Intergenic
1175766724 20:61597571-61597593 GCATCTGCACAGGATGGACCGGG + Intronic
1176249837 20:64115335-64115357 GGATGGGGACAGGGTGGACCCGG - Intergenic
1177146240 21:17410280-17410302 GAATTTGAACAGCCTAGAGCAGG + Intergenic
1178661945 21:34514254-34514276 GAATTTGAACAGGGGTGAGCAGG + Intronic
1183799154 22:40146964-40146986 GATTTTCAAAAGGGTGGACATGG + Intronic
1184124189 22:42475453-42475475 TACTTTGAACAGGGTGGTCAGGG - Intergenic
949095994 3:86418-86440 GAATTTCAACAAGTTAGACCAGG - Intergenic
952626778 3:35415387-35415409 GCATGTGCACAGCGTGGACCGGG - Intergenic
953208710 3:40855200-40855222 GAATGTGAGCAGAGTGGACAGGG + Intergenic
956639141 3:71398488-71398510 GAATTTAAACAGGGTGAAAAGGG - Intronic
956908158 3:73788542-73788564 CAATTTAAATAGGGTGGACAGGG + Intergenic
959588055 3:108044336-108044358 GGATTTAAACAGAATGGACCTGG + Intronic
960209401 3:114941763-114941785 AAACTTGAACAGTGTGGACCTGG - Intronic
961505400 3:127367762-127367784 GAATCAGATCAGGGTGGCCCGGG + Intergenic
966888093 3:184387637-184387659 GAAAATGAACAGGGCTGACCTGG + Intronic
970263215 4:14251754-14251776 GAATTTGACCAGGGTAGCCCAGG + Intergenic
971219006 4:24687899-24687921 CAGTTTAAGCAGGGTGGACCAGG + Intergenic
971346518 4:25816573-25816595 GAATTAGAAGCGGGTGGAGCTGG - Intronic
972674463 4:41246072-41246094 TAATTTTACCAGGGTGGAGCTGG + Intergenic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
979537120 4:121835435-121835457 GAATTGGAACAGAGTGGGACAGG - Intronic
979919708 4:126480849-126480871 GAAGCTGAACAGGGAGGACGGGG - Intergenic
981872027 4:149498085-149498107 CTGTTTAAACAGGGTGGACCTGG - Intergenic
984491636 4:180440972-180440994 GAAATAGCACAGGCTGGACCCGG - Intergenic
986377582 5:7148253-7148275 CCGTTTGAACAGGGTGGACTTGG - Intergenic
986971327 5:13340426-13340448 GAATTTGGACAGGGTTCAACTGG - Intergenic
994648286 5:102497194-102497216 GAATTTGAACACTTTAGACCTGG - Intronic
997166105 5:131661352-131661374 GAAGTTCAACAGGTTTGACCTGG + Intronic
1001090869 5:168739740-168739762 GTATTTGAAAAGGGAGGAGCCGG - Intronic
1001853792 5:174993100-174993122 AAATGTCAACAGGGTGGCCCAGG - Intergenic
1005504173 6:26455735-26455757 GAATTTGAACAGGGCAGAGTAGG + Intergenic
1005939983 6:30553470-30553492 GGTTTTGAACAAGGTGGATCTGG - Exonic
1011837872 6:91456493-91456515 GAATTTGAACAGAGAAGAACTGG - Intergenic
1012759866 6:103285683-103285705 CAATCTGAACAGGGTGGAATGGG + Intergenic
1014161776 6:118178121-118178143 GAATTTGAACAGAAGGGACATGG - Intronic
1014661194 6:124174579-124174601 GAATTAGAAAAGGGTGGAGTTGG - Intronic
1016734158 6:147458014-147458036 GAACTTGAACACAGTGGACTTGG + Intergenic
1019138790 6:169929884-169929906 GAATGTCAACAGGGAGGACAGGG + Intergenic
1019314760 7:379342-379364 GACTTTGAGCAGGGAGGACGTGG - Intergenic
1020681782 7:11245800-11245822 GGAGTTGAAGAGGGTTGACCAGG + Intergenic
1021860332 7:24899782-24899804 GACTTTGAAGAAGGTGGATCTGG - Intronic
1023132410 7:37015820-37015842 AAATGTGAACAGGCTGGACTAGG - Intronic
1023515465 7:40997130-40997152 GAGTTTGAAATGGGTGGAGCAGG - Intergenic
1030196347 7:106857373-106857395 TAAATTGAACAGGGTGGAAGTGG - Intergenic
1034407890 7:150917399-150917421 GCATTTGAAGATGGAGGACCAGG + Intergenic
1043477099 8:80615768-80615790 GCATATGGACAGGGAGGACCAGG + Intergenic
1045324523 8:101108532-101108554 GCATCTGAACAGGGGAGACCTGG + Intergenic
1053552619 9:39100079-39100101 GCAGTTGAACGGGGTGGCCCTGG - Exonic
1053816735 9:41920238-41920260 GCAGTTGAACGGGGTGGCCCTGG - Exonic
1054106996 9:61063920-61063942 GCAGTTGAACGGGGTGGCCCTGG - Intergenic
1054613861 9:67267205-67267227 GCAGTTGAACGGGGTGGCCCTGG + Intergenic
1055486620 9:76762581-76762603 GAGTTTGAAAAGGATGGTCCAGG - Intronic
1062084010 9:134639321-134639343 GAATCTGGGCAGGGTGGTCCTGG + Intergenic
1062367625 9:136218783-136218805 GAAGCTGTACACGGTGGACCTGG - Exonic
1187367599 X:18677333-18677355 GAATTTGAGCTGGGTGGGGCCGG - Intronic
1190878914 X:54478973-54478995 GAATTTGAATGGGGAGGACAGGG - Intronic
1195451636 X:105020437-105020459 AATTCTGGACAGGGTGGACCAGG + Intronic
1199572334 X:149279510-149279532 CAATTTTAATAGGGTGGACATGG + Intergenic
1201974173 Y:19830600-19830622 GAACTTGAACAGGGAGGTCAGGG - Intergenic