ID: 1122923956

View in Genome Browser
Species Human (GRCh38)
Location 14:104891390-104891412
Sequence CTTGAAGCCCATGAGGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122923949_1122923956 24 Left 1122923949 14:104891343-104891365 CCCAGGACCAGGGTGGATGGCAA 0: 1
1: 0
2: 0
3: 18
4: 215
Right 1122923956 14:104891390-104891412 CTTGAAGCCCATGAGGGACCTGG 0: 1
1: 0
2: 1
3: 9
4: 130
1122923950_1122923956 23 Left 1122923950 14:104891344-104891366 CCAGGACCAGGGTGGATGGCAAG 0: 1
1: 0
2: 2
3: 19
4: 202
Right 1122923956 14:104891390-104891412 CTTGAAGCCCATGAGGGACCTGG 0: 1
1: 0
2: 1
3: 9
4: 130
1122923951_1122923956 17 Left 1122923951 14:104891350-104891372 CCAGGGTGGATGGCAAGTGTTTG 0: 1
1: 0
2: 0
3: 10
4: 235
Right 1122923956 14:104891390-104891412 CTTGAAGCCCATGAGGGACCTGG 0: 1
1: 0
2: 1
3: 9
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122923956 Original CRISPR CTTGAAGCCCATGAGGGACC TGG Intronic
900730504 1:4255812-4255834 GTTGAAGCCCCTGGGGGTCCTGG - Intergenic
901261350 1:7874249-7874271 CTCAAAGCCCATGAGGGCCAAGG - Intergenic
902098321 1:13964921-13964943 CTCGAAGCAGATGAGGGAGCTGG + Intergenic
902512194 1:16972527-16972549 CTTGAGGCCCCCAAGGGACCGGG - Exonic
902816284 1:18918487-18918509 CCTGCAGCCCATGACAGACCTGG - Exonic
903391348 1:22965494-22965516 CTTGAGGCCTAGGAGGGGCCAGG - Intergenic
904539256 1:31221812-31221834 CCTGAAGGCAATGAGGGGCCAGG + Intronic
905011948 1:34753683-34753705 CTTCCAGACCATGAAGGACCTGG - Intronic
909630528 1:77765587-77765609 CTTGAAGCCCATAGGTGAACTGG + Intergenic
910245040 1:85129467-85129489 CTCGAAGCCCTCCAGGGACCAGG + Intronic
915118811 1:153616064-153616086 CCTGAAGCCCAGGCGGGGCCTGG - Intronic
916145899 1:161739125-161739147 CATGAAGCCTGTGAGGGACAAGG + Intergenic
920713183 1:208315160-208315182 TTTGAAGCCCACGAGTGATCAGG - Intergenic
922661178 1:227431768-227431790 CTGGAAGCACACGAGGGCCCTGG - Intergenic
923002638 1:230020261-230020283 CTCGAAGCACATGAGGAAGCAGG + Intergenic
923493744 1:234507081-234507103 CTTGAAGCCCAGGAAGGATTTGG - Intergenic
1069221308 10:65887201-65887223 CTTGAAGGCCAGGAGAGAACGGG - Intergenic
1070565596 10:77601763-77601785 CTTGAAGTCCATGTGGTTCCTGG - Intronic
1076406506 10:130215602-130215624 CTTGGAGGCCAAGAGGGCCCAGG + Intergenic
1076832127 10:133000857-133000879 CTTCAAGCACATGGGGGTCCTGG - Intergenic
1077375392 11:2203151-2203173 CCCGAGGCCCAGGAGGGACCTGG + Intergenic
1078110568 11:8388686-8388708 CTTGCTGCCAATGAGAGACCAGG - Intergenic
1085130852 11:74037235-74037257 CCAGAAGCCCATCAAGGACCTGG + Intronic
1085642467 11:78200940-78200962 CTTGAGGCACATGATGGACCTGG - Intronic
1088530407 11:110801859-110801881 CTTGAATCCCCTGAGAGATCTGG - Intergenic
1090955710 11:131511411-131511433 CATGAATCCCATGAGAGCCCTGG - Intronic
1094564538 12:31588215-31588237 CTTGAAGGACATGAGGAAGCAGG - Intronic
1096256983 12:50069033-50069055 CTTTAAGGCCCTGAGTGACCTGG + Intronic
1096845678 12:54405184-54405206 CTTGACCCCCCTGGGGGACCTGG - Exonic
1108365037 13:49702684-49702706 TTAGAAGCCCTTGAGGTACCCGG + Intronic
1108699211 13:52929415-52929437 CCTGAAGTCCATCAGGGAACAGG - Intergenic
1110408473 13:75177225-75177247 CTTCAACCTCATGAGGGACCAGG + Intergenic
1111105024 13:83633965-83633987 CTGGAAGCCCATGAGAAACATGG - Intergenic
1113608068 13:111624328-111624350 CTTCAAAGCAATGAGGGACCCGG - Intronic
1117894356 14:60465381-60465403 CTTGATGCCCATGAAGAACAAGG - Intronic
1122923956 14:104891390-104891412 CTTGAAGCCCATGAGGGACCTGG + Intronic
1134199290 16:12184543-12184565 TTTGAAGACCATGAGGGAACTGG - Intronic
1134625191 16:15718335-15718357 CATGGAGGCCATGAGCGACCGGG - Exonic
1136907142 16:34107312-34107334 CTTGAAGCCCATGGTGGAAAAGG + Intergenic
1138609635 16:58112456-58112478 CTGGAATCGCATGAGGGAACTGG - Intergenic
1139462547 16:67134080-67134102 CTTGAAGACCATGAGTGACAGGG + Intronic
1141902053 16:86997315-86997337 CTTGAAGGCCAGGAGGGAGAGGG - Intergenic
1147425647 17:40344812-40344834 CTTGAGGCACAGGAAGGACCCGG + Intronic
1148544219 17:48504546-48504568 CTTGAATCCCCTCAGGGAGCTGG + Intergenic
1148777141 17:50102152-50102174 CCTGAAGCCCCTCAGGGGCCTGG - Intronic
1152272182 17:79331183-79331205 CTTGAAGTCCATGAGGCTCAGGG - Intronic
1155336639 18:24771830-24771852 GTTAAAGACAATGAGGGACCAGG + Intergenic
1155963948 18:32018926-32018948 CCTGGAGCGCAGGAGGGACCCGG + Exonic
1162193649 19:8966855-8966877 CTGGAACTCCAGGAGGGACCAGG - Exonic
1163017263 19:14464004-14464026 CTTGAAGCCTGCGAGGGTCCTGG + Intronic
1163326271 19:16605422-16605444 ACTGAAGGCCATGAGTGACCAGG + Intronic
1163545114 19:17936683-17936705 CTGAAAGGCCAGGAGGGACCAGG + Intronic
1163699591 19:18780663-18780685 CCAGAAGCCCATGGGGGGCCAGG + Exonic
1163747588 19:19057466-19057488 CTCGAAGCCCATCCTGGACCTGG + Exonic
1165739559 19:38197297-38197319 CTTGAAGCCCCTGAGGGAAGGGG - Intronic
1167634456 19:50646373-50646395 CGTGAAGACCAGGAGGGACAGGG + Intronic
1167762294 19:51457417-51457439 CTCCCAACCCATGAGGGACCTGG + Intronic
1168103230 19:54152246-54152268 CTTGAAGTCCATGGCGGAACGGG + Exonic
925106481 2:1296601-1296623 CTTGAGGTCCCTGAGTGACCAGG - Intronic
925213726 2:2073858-2073880 CCTGCAGCCCATGAGGAACAGGG - Intronic
927646477 2:24880238-24880260 CTGGCAGATCATGAGGGACCTGG - Intronic
930244538 2:48969765-48969787 CTTGCAGCCCATCAGGGGCAGGG - Intronic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
933391833 2:81679547-81679569 GATAAAGCCCATGAGAGACCAGG - Intergenic
935691297 2:105734622-105734644 CTCTAAGCTCATGAGGGACCTGG - Intergenic
936665016 2:114584921-114584943 CTAGAAGCCCATCAGGATCCAGG + Intronic
937098844 2:119253260-119253282 CTTTAAGCCACTAAGGGACCAGG - Intronic
938709158 2:133960553-133960575 CTTCAATCCCATGAGGGGCTGGG + Intergenic
940445585 2:153772701-153772723 CTTGAAGACTATAAGGGATCAGG - Intergenic
942543542 2:177039141-177039163 CTGGAAGCCCTGGAGGGAACAGG - Intergenic
943699968 2:190978983-190979005 GATGAAGCCCATGATGCACCTGG + Exonic
944523903 2:200598972-200598994 CTGGATGCCCATGTGAGACCTGG + Intronic
944743655 2:202635280-202635302 CTTGCAGCCCATGAGGGCGACGG + Exonic
945933380 2:215879085-215879107 TTTCTACCCCATGAGGGACCCGG - Intergenic
946158750 2:217823361-217823383 CCTGTCACCCATGAGGGACCTGG - Intronic
947539993 2:230969792-230969814 CTTGAAGTCCATCAGGGACCAGG + Intergenic
1173388689 20:42611898-42611920 CCTGAAGCCATTGATGGACCAGG - Intronic
1175089178 20:56487791-56487813 CTAGAAGCCAATGAGAGGCCTGG - Intronic
1175253385 20:57623084-57623106 CTGCAAGCCCACCAGGGACCTGG - Intergenic
1175893650 20:62326631-62326653 GCTGAGGTCCATGAGGGACCTGG + Intronic
1176203679 20:63876699-63876721 CTTGAAGGTCCTGGGGGACCAGG + Intronic
1179932298 21:44578887-44578909 CTGAAAGCCCATGCGGAACCTGG + Intronic
1181779542 22:25182811-25182833 CCTGAAGCCCTTGAGGAATCCGG + Intronic
1182276168 22:29190124-29190146 CTTGGAGCCCTTTAGGAACCGGG + Intergenic
1182434602 22:30322274-30322296 ATTGAAGCCCAGGAAGGGCCGGG - Intronic
1182473982 22:30565882-30565904 CTAGAACCCCATCATGGACCAGG + Intronic
1182740501 22:32563962-32563984 CTTGAAACCCAACAGGGGCCGGG - Intronic
1184160342 22:42693865-42693887 CTTGAAGCCGATGATGAACAGGG + Exonic
1184403903 22:44289271-44289293 CTTGAAGTCAGAGAGGGACCTGG - Intronic
953387974 3:42517447-42517469 CTTCATGCCCGTGAGGGACTAGG - Intronic
960372229 3:116854491-116854513 GTTGAAGGCCAAGAGGGAGCTGG - Intronic
965985080 3:174742398-174742420 CCTGAAGCCCATGACTGATCTGG - Intronic
967776058 3:193387123-193387145 CTTGACTCCCATGAGGGGCATGG - Intergenic
969341602 4:6545393-6545415 GGTGCAGGCCATGAGGGACCAGG + Intronic
971387358 4:26153499-26153521 CTGGAAGCAGTTGAGGGACCAGG + Intergenic
972371665 4:38429995-38430017 CTTGTGGCCCATGAGGTATCTGG + Intergenic
982071170 4:151695673-151695695 CTTGAAGGACAGGAGGCACCAGG + Intronic
985859070 5:2456097-2456119 CTTGATGCCCAGGAGCGGCCTGG - Intergenic
986345806 5:6834052-6834074 CCTGAAGGCCATGACAGACCAGG + Intergenic
995915471 5:117240599-117240621 ATTGAAGGCAAAGAGGGACCAGG - Intergenic
996241412 5:121207674-121207696 CTTTAAGCCCATCAGGAAACTGG - Intergenic
998332864 5:141344988-141345010 ATTGAAGCACAGGATGGACCAGG + Exonic
998334176 5:141356155-141356177 GTAGAAGCCCATGATGGGCCTGG + Exonic
998375841 5:141690027-141690049 CCTGATGGCCATGAGGAACCAGG - Intergenic
1002798616 6:498802-498824 CTTGTCGCCCAAGAGGCACCTGG + Intronic
1005761235 6:28970009-28970031 CTTCAAGACCATGGAGGACCTGG - Intergenic
1006255472 6:32829214-32829236 ATGGAAGCCCAGGAGGGAACTGG + Intronic
1022285563 7:28953981-28954003 CCTTAAGCCCCTGAGGGTCCTGG - Exonic
1023481591 7:40640904-40640926 CTGGAAGCCAAGGAAGGACCTGG + Intronic
1026527297 7:71165596-71165618 CATGTGTCCCATGAGGGACCCGG - Intronic
1027435940 7:78164393-78164415 CATAAGGACCATGAGGGACCTGG - Intronic
1031663744 7:124459609-124459631 CTTGAACCGGAAGAGGGACCTGG - Intergenic
1032080690 7:128857057-128857079 CTTGTGGCCCAAGAGGGACTGGG - Intronic
1032081001 7:128858394-128858416 CGTGAAGCACATGGGGAACCGGG + Exonic
1032091247 7:128912766-128912788 CGTGAAGCACATGGGGAACCGGG - Intergenic
1036777493 8:11623663-11623685 CCTGAGCCCCACGAGGGACCTGG + Intergenic
1036949344 8:13126114-13126136 ATTTGAGCCCATGAGGGACATGG + Intronic
1038260364 8:25987795-25987817 CTTGAAGCCCCTGAGGGCAGGGG - Intronic
1038647404 8:29373076-29373098 CTTGTAGCCCGTAAGGGGCCGGG + Intergenic
1039105387 8:33984037-33984059 CTTTAAGCCCTTGAAGGACATGG + Intergenic
1047518900 8:125579289-125579311 CCTGATGCCCATGAGGCACCTGG - Intergenic
1048847408 8:138614166-138614188 CCTGAAACCCCTGTGGGACCAGG - Intronic
1049750120 8:144279125-144279147 CTTGAGGCCCATGGGGGTCATGG - Intronic
1053712121 9:40826281-40826303 CTTGAGGCCTATGATGGAACAGG + Intergenic
1054422659 9:64959531-64959553 CTTGAGGCCTATGATGGAACAGG + Intergenic
1057419361 9:94898252-94898274 CTGGAAACTCATGAGGGGCCAGG + Intronic
1057744736 9:97741821-97741843 CTTGAAGGCCTTGGGGGAACGGG + Intergenic
1057906578 9:98988011-98988033 CTTGAAGCCAGTTAGGGAGCAGG + Intronic
1059440935 9:114306459-114306481 CTTGAACCCCAGGCTGGACCAGG + Intronic
1061233933 9:129331467-129331489 CCTGAGGCCCATGAGGTACCTGG - Intergenic
1062094539 9:134696017-134696039 CTGGCAGCCCAGGAGGGGCCGGG - Intronic
1062172716 9:135144417-135144439 CTTGAAGCCCAGGAAGGAGGAGG + Intergenic
1062221731 9:135419682-135419704 CTTGATGCCCAGTAGGGAGCCGG - Intergenic
1062353850 9:136152634-136152656 CTTGATCCCCATCAGAGACCAGG - Intergenic
1062449619 9:136610026-136610048 CCTGAAGCCCATGAGGGCTGGGG - Intergenic
1194279840 X:91936190-91936212 CTTGAAGATCATAAGGTACCTGG - Intronic
1196435913 X:115674523-115674545 CTTGAAACCCATGAGAGGCCAGG - Intergenic
1196679944 X:118460501-118460523 TTTGGTGCCCATGAGGGTCCTGG + Intergenic
1199875240 X:151923141-151923163 CTTGATGGCACTGAGGGACCGGG + Intronic
1200597317 Y:5159670-5159692 CTTGAAGATCATAAGGTACCTGG - Intronic
1201096605 Y:10626042-10626064 CTTGAAGCCTATGATGGAAAAGG - Intergenic