ID: 1122924045

View in Genome Browser
Species Human (GRCh38)
Location 14:104891724-104891746
Sequence GAGTTCTCTGCCTTCCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122924032_1122924045 25 Left 1122924032 14:104891676-104891698 CCAGGCCTGAGAGCAGAAGGGGA 0: 1
1: 1
2: 4
3: 40
4: 444
Right 1122924045 14:104891724-104891746 GAGTTCTCTGCCTTCCATGGTGG 0: 1
1: 0
2: 0
3: 13
4: 164
1122924042_1122924045 -7 Left 1122924042 14:104891708-104891730 CCCATGTGGGTTTCTGGAGTTCT 0: 1
1: 1
2: 4
3: 25
4: 229
Right 1122924045 14:104891724-104891746 GAGTTCTCTGCCTTCCATGGTGG 0: 1
1: 0
2: 0
3: 13
4: 164
1122924033_1122924045 20 Left 1122924033 14:104891681-104891703 CCTGAGAGCAGAAGGGGATGTGG 0: 1
1: 0
2: 1
3: 33
4: 306
Right 1122924045 14:104891724-104891746 GAGTTCTCTGCCTTCCATGGTGG 0: 1
1: 0
2: 0
3: 13
4: 164
1122924043_1122924045 -8 Left 1122924043 14:104891709-104891731 CCATGTGGGTTTCTGGAGTTCTC 0: 1
1: 0
2: 0
3: 28
4: 261
Right 1122924045 14:104891724-104891746 GAGTTCTCTGCCTTCCATGGTGG 0: 1
1: 0
2: 0
3: 13
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122924045 Original CRISPR GAGTTCTCTGCCTTCCATGG TGG Intronic
901051540 1:6428106-6428128 GTGCTCTCTGTCTTCCCTGGAGG - Intronic
901760237 1:11466430-11466452 GACTTTTTTGCCTTCAATGGAGG - Intergenic
901882053 1:12199689-12199711 GAGGTCTCAGCCTTTCTTGGGGG + Intronic
902581885 1:17413023-17413045 GAGGTCTCTTCCTTTCATGGGGG - Intronic
904353193 1:29922185-29922207 GATGTCCCTGCCTGCCATGGAGG - Intergenic
906951102 1:50334987-50335009 GAGTTCTCTGCCTCCTGAGGTGG - Intergenic
907192010 1:52657309-52657331 GAGTTCTCTGACTTCCCAGTTGG - Intronic
917008099 1:170438030-170438052 AAGTTCTCTGCCTTCCCAGATGG - Intergenic
917175057 1:172224875-172224897 GGGCTCTCTAGCTTCCATGGTGG + Intronic
917675667 1:177316896-177316918 GCGTTCTCTGCTTTTCTTGGGGG + Intergenic
920646014 1:207804975-207804997 GAGAGCTCTGCCATCCAAGGAGG + Intergenic
922869549 1:228890961-228890983 CTGTTCTCTGCCTTCTTTGGTGG - Intergenic
923176257 1:231468662-231468684 GAGGACTCTGCCTTACCTGGTGG - Intergenic
923824292 1:237482657-237482679 GAGATATCTGCACTCCATGGTGG - Intronic
923936675 1:238768608-238768630 CATTTCTCTGTCTTCCATGCTGG - Intergenic
924238227 1:242016962-242016984 GAGTGCTCTGCCTGCCAGGCTGG + Intergenic
1062878188 10:958544-958566 GAGGCCCCTGCCTTCCCTGGTGG - Intergenic
1063350306 10:5348053-5348075 GATTTCTCTGCGTTTCATGTGGG + Intergenic
1064259174 10:13771102-13771124 GAGTTCTCTGTCATCCAGGCTGG + Intronic
1065134011 10:22650514-22650536 GAGTGCTCTGTATTTCATGGTGG - Intronic
1068625938 10:59247364-59247386 GAGTTTTCTGCTTGGCATGGAGG + Exonic
1069632065 10:69903060-69903082 ATGTTCCCTGCCTTCCAGGGAGG + Intronic
1071617619 10:87090864-87090886 TATTTCTCTGCCTTCACTGGGGG - Intronic
1072230606 10:93411330-93411352 GCCTTCTCTGCCTCCCATGATGG + Intronic
1075293570 10:121252498-121252520 CTGTTCTCTGCCTTCCATGAAGG + Intergenic
1076820598 10:132936881-132936903 GAGCTCTGTCCCCTCCATGGGGG - Intronic
1077994044 11:7438141-7438163 GAGTTGTCAGCCTTCCACAGGGG + Intronic
1078652877 11:13212367-13212389 GAGTTCTCTGTCTTAGAGGGTGG - Intergenic
1083088498 11:60175560-60175582 GAGTGCTCTGTCTGCCCTGGTGG - Exonic
1083103839 11:60337770-60337792 GAGTGCTCTGTCTGCCCTGGTGG + Exonic
1083472814 11:62895556-62895578 CTGTTCTCTGCCTTCTATGTGGG - Intergenic
1084405457 11:68969646-68969668 AACTTCTCTGCCTTCCATCCAGG + Intergenic
1084786451 11:71444431-71444453 GAGCTCTGGGCCTTCCATGGGGG - Intronic
1089072577 11:115711629-115711651 GAGAGCCCTGTCTTCCATGGGGG + Intergenic
1089267879 11:117279232-117279254 GAATGTTCTGCCTTCAATGGAGG + Intronic
1089978749 11:122755079-122755101 GACTTCTCTCCATTGCATGGTGG - Intronic
1091601879 12:1922638-1922660 GAGTGCTCTCCCTGCCCTGGGGG - Intergenic
1091801567 12:3327857-3327879 GAGTTCTCTACCTTCGGTGCTGG + Intergenic
1093190174 12:16065373-16065395 GGGTTCTCTGCCGGGCATGGTGG - Intergenic
1093407083 12:18817769-18817791 GTTTTCTCTGCCTTCCAAGGAGG - Intergenic
1093426091 12:19031112-19031134 TAATTCTGTGCCTTCCATGGGGG - Intergenic
1095061337 12:37694895-37694917 GAGCTCTTTGACTTCCATTGTGG - Intergenic
1096879203 12:54653785-54653807 CAGTTCTCTGGCTTCCTTGAGGG + Intergenic
1105473361 13:20711426-20711448 GAGGGCTCTGCCATCCTTGGAGG - Intronic
1105983270 13:25540624-25540646 GAGTTCTCTGCCTGTGATGCTGG + Intronic
1106709800 13:32317666-32317688 GACTTTTCTGACATCCATGGTGG - Intronic
1107691180 13:42955249-42955271 GAGTTCCCTGCCCTCCAGGGTGG + Intronic
1110893159 13:80715167-80715189 GAGTTCTTTGCTTCCAATGGAGG + Intergenic
1111804052 13:93016800-93016822 GAGTTCTGAGCCTTGCACGGAGG + Intergenic
1113202139 13:107877378-107877400 GAGGTCTCTGCCATCCAGGCAGG - Intergenic
1117497648 14:56321546-56321568 GAGTTCTCGGCATCCCATGCAGG + Intergenic
1118813077 14:69289575-69289597 GACTGCCCTGGCTTCCATGGTGG + Intronic
1122038709 14:98966777-98966799 CACTTCTCTTCCTTCCTTGGAGG - Intergenic
1122044328 14:99012469-99012491 GAGCTCACTGCCTCCCAGGGTGG - Intergenic
1122246069 14:100404471-100404493 GTGCGCTCTGCCTCCCATGGTGG - Intronic
1122924045 14:104891724-104891746 GAGTTCTCTGCCTTCCATGGTGG + Intronic
1122993612 14:105250515-105250537 GAGTTCGCTGCCGTCCAGGACGG - Exonic
1123548448 15:21357189-21357211 GATTTCCCTGCCTTCTCTGGTGG + Intergenic
1125205456 15:37149392-37149414 GTGTTCTCTGTCTTTGATGGTGG + Intergenic
1125548349 15:40525448-40525470 GAGTGCTCAGCCATACATGGTGG - Intergenic
1128471923 15:67961723-67961745 GGGATCTCTGTCTTCCATGCTGG + Intergenic
1131309138 15:91271835-91271857 GTGTTCTTTGGCTTCCTTGGGGG + Intronic
1133273606 16:4624078-4624100 GAGTCTACTGCCTTCCGTGGAGG + Intronic
1134063083 16:11210716-11210738 GAGTCCTCAGCCTGCAATGGTGG + Intergenic
1136254491 16:29029240-29029262 AAGTTCTCTGCTTTCCTTAGGGG + Intergenic
1136473740 16:30498981-30499003 GAGTTCTCTGGCTTTGCTGGCGG + Intronic
1139337752 16:66245026-66245048 GAGATCTCGGAGTTCCATGGTGG + Intergenic
1139601675 16:67991173-67991195 GAGCTCTCTGCCCTGCAGGGTGG + Exonic
1144225504 17:13141075-13141097 TAGTTCTCTGCTTGCCTTGGTGG + Intergenic
1146655322 17:34631576-34631598 GAATTCTTTGCCTTCCGAGGTGG + Intronic
1147160450 17:38566517-38566539 GCGCTCTCTACCTCCCATGGTGG - Intronic
1147353979 17:39876347-39876369 TAGTTCTCTGCTTTCCAGGTAGG - Intronic
1147434830 17:40404380-40404402 GAGATCTATCCCTTCTATGGTGG - Exonic
1149252174 17:54783143-54783165 GAGTTAGCTGCCATCCATGGTGG - Intergenic
1149804466 17:59602200-59602222 GAGTTCTCTGAGTTCCATTTGGG + Intronic
1151766456 17:76135789-76135811 GAGCTCACTCCCTTCCCTGGTGG + Intergenic
1152380457 17:79939739-79939761 GGGCTCTCTGCCTTCTATGTGGG - Exonic
1152498803 17:80694586-80694608 CAGTTCTCTGCCTGCCAGGCAGG + Intronic
1152523175 17:80872422-80872444 GTGTGGTCTGGCTTCCATGGGGG - Intronic
1154171707 18:12057169-12057191 GAGGACCCTGCCTTCCATCGAGG - Intergenic
1156069869 18:33194016-33194038 GAGTGCTCTGCCTTCATGGGTGG - Intronic
1156406527 18:36787836-36787858 GAGTTCACTTCCTTCTATTGAGG - Intronic
1157142165 18:45120518-45120540 GGTTTTTCTGCCTTCCAGGGAGG + Intergenic
1157331771 18:46709217-46709239 GAGGTCTCTGCCCTCAATGATGG + Intronic
1160049531 18:75419913-75419935 GAGTTCTCTCCTTCCCACGGTGG - Intronic
1162344946 19:10113510-10113532 GAGTTCTTTCCCCTCCCTGGAGG - Intronic
1167959403 19:53094285-53094307 GAGTTCTCTTTCTTCCATCCCGG + Intronic
925146444 2:1586174-1586196 GATTTCTGTTCCTTCCATGGTGG - Intergenic
927835146 2:26390779-26390801 TAATTCTCTGACTTCCATGATGG - Exonic
931252948 2:60550062-60550084 GAGGTCTGTGCTTTGCATGGGGG + Intronic
932160784 2:69457409-69457431 GTGTGCCCTGCCTTCCATGTAGG - Intergenic
934025726 2:88000234-88000256 GAGTTCTCTTCCTCCCAGGTAGG - Intergenic
935385816 2:102499125-102499147 GAGTCCTTTGCCTTCCAGGAAGG + Intronic
936515921 2:113181597-113181619 GAGATCTCTGCCTTCTAGGGAGG - Intronic
937289178 2:120771751-120771773 GAGTCTTCTGCCTTCCAGAGGGG + Intronic
937320175 2:120956322-120956344 GACTTCCCTCCCTTCCATGAGGG - Intronic
940713672 2:157193003-157193025 GGGTTATCTGATTTCCATGGAGG - Intergenic
943299365 2:186178598-186178620 GAATTCTCTGTCATCCATGAAGG - Intergenic
946025146 2:216667436-216667458 TAGCTCTCGGCCTTGCATGGTGG + Intergenic
946977684 2:225171407-225171429 CAGCTCTCTGCTTTCCACGGAGG + Intergenic
947887366 2:233584346-233584368 GAGTGATCTACCTTCCCTGGAGG - Intergenic
947893638 2:233647902-233647924 GAGTGATCTACCTTCCCTGGAGG - Intronic
948717031 2:239871681-239871703 AAGTAATCTGCCTTCCATGATGG - Intergenic
1169220018 20:3816769-3816791 GACCTCTCTTACTTCCATGGTGG + Intergenic
1171311834 20:24150957-24150979 GGGTCCTGTGTCTTCCATGGAGG + Intergenic
1171825555 20:29900009-29900031 GAGTGCTTTGACTTCTATGGTGG + Intergenic
1174226393 20:49004075-49004097 GAGTTCTCTGCCGGGCGTGGTGG + Intronic
1179187260 21:39094408-39094430 GAGTTATCTGGGTTCCTTGGGGG - Intergenic
1179363247 21:40732298-40732320 GAATGTTCTGCCTTACATGGTGG - Intronic
1179591217 21:42409961-42409983 GAGGTATCTGCCTTCCCTTGAGG - Intronic
1181863558 22:25837806-25837828 GACTTCTCTGCCCATCATGGAGG + Intronic
1183104196 22:35604555-35604577 GAGTTTTCTGCTTTCCAGGCTGG + Intergenic
1183725073 22:39584083-39584105 GGGCTCTCTGGCTGCCATGGAGG + Intronic
1184193662 22:42911805-42911827 AAGTTCACTGCCTTCGATGATGG + Intronic
953671899 3:44969911-44969933 TAGGTCTCTGCCTAGCATGGGGG - Intronic
954715330 3:52524000-52524022 GGCTTCTCTGCCTTCCAGGTAGG + Exonic
959007500 3:101036947-101036969 GACTTCTCTTCCTTCTATTGCGG - Intergenic
960288384 3:115855474-115855496 GATGTCTCTGCCTCCCATGTGGG - Intronic
961209415 3:125114216-125114238 GTGTCCTCTGCCCTCCATCGTGG - Intronic
961809241 3:129512519-129512541 GAGTTCTCTGTCTTCCCTGAGGG - Intronic
961954182 3:130783869-130783891 GAGTTCTCTGCCTTTCCTCCTGG + Intergenic
967007413 3:185397765-185397787 CATTTCTCTGCCTGCCATGAGGG + Intronic
967615127 3:191555924-191555946 GACTTATCTGACTTCCAAGGAGG + Intergenic
969220235 4:5754355-5754377 GAGTTCCCAGCCTTGCATGTGGG + Intronic
971428713 4:26541593-26541615 GAGTTCTCTACCGGGCATGGTGG + Intergenic
972557803 4:40198156-40198178 GAGTTCTGTGAATTCCATGGAGG + Intronic
978483331 4:109220469-109220491 AAATTCCCTGCATTCCATGGGGG - Intronic
980025857 4:127765614-127765636 GAGCTCTATGTCTTACATGGGGG - Intronic
983982189 4:174011954-174011976 GAGTTCTATGCATGCCTTGGAGG + Intergenic
984028297 4:174571278-174571300 TAGTTCTCTGCCTTCCCATGAGG - Intergenic
985520469 5:371857-371879 GAGTTCTGTCCCTTCCAACGAGG + Intronic
985534746 5:457713-457735 GTGGTCACTGCCTCCCATGGGGG + Intronic
986125206 5:4878103-4878125 GAGGTTTCTGTCCTCCATGGGGG + Intergenic
987025888 5:13926103-13926125 TAGGTCCCTGCCCTCCATGGTGG - Intronic
988845532 5:35123913-35123935 AATTCCTCTGCCTTCCATGTAGG + Intronic
988870059 5:35379515-35379537 GAGTTGTCTGCTTTACTTGGGGG - Intergenic
989432547 5:41372754-41372776 GAGTTCTTGGCCATGCATGGTGG + Intronic
990985439 5:61637194-61637216 CAGCTCTGTGCCTGCCATGGAGG + Intergenic
998151560 5:139760327-139760349 GAGCTCTCTGTCTTCCAGGGTGG + Intergenic
999854717 5:155581518-155581540 GAGTTCTCTGACTACTGTGGTGG + Intergenic
1001269847 5:170302881-170302903 GAGTTCTGTGCCTTCTAGTGTGG - Intergenic
1001448546 5:171806541-171806563 CGGTTCTCTGCCCTCAATGGTGG - Intergenic
1001958387 5:175864155-175864177 GTGATCTCTACCTTCCAGGGTGG - Intronic
1003469562 6:6416633-6416655 GACTTCTCAGCCTGCCCTGGAGG - Intergenic
1014229331 6:118885164-118885186 GAGTGCTCTGTCTCCCATGCTGG - Intronic
1016987419 6:149905638-149905660 AAGTGCTCTGCCGGCCATGGGGG - Intergenic
1017829651 6:158114796-158114818 GAGTTCTTTGACTTCCAACGAGG + Exonic
1017885638 6:158597400-158597422 CTGTTCTCTGCCTTCCAGGATGG + Intronic
1019789523 7:3001931-3001953 CAGTCCTCTGCCTCCCATGCTGG + Intronic
1020543615 7:9493842-9493864 GAGTCCTCTGGATTCCATGCAGG + Intergenic
1023710269 7:42985285-42985307 AAGTTCACTGCCTTACATGAAGG + Intergenic
1027168441 7:75852827-75852849 GAATTATCTGCCTGGCATGGTGG - Intronic
1030898114 7:115086588-115086610 CAGTTCTCTGAGTTCCATGAGGG + Intergenic
1034103102 7:148468196-148468218 GAGTGCTCAGCGGTCCATGGAGG + Intergenic
1035254679 7:157618806-157618828 CCGTTCTCTGTCTTCCCTGGTGG + Intronic
1035346394 7:158202491-158202513 GACTCCTCTGCCCTCCATGCTGG + Intronic
1035716904 8:1762482-1762504 CAGTTCTCTGGCCTCCAGGGAGG + Intronic
1035958735 8:4113067-4113089 AAGTTCACTGTCTTACATGGGGG - Intronic
1046104888 8:109653432-109653454 GTCTTCTCTGTCTCCCATGGTGG + Intronic
1046364253 8:113205268-113205290 GAGTTCCCTGCCGGCCACGGTGG - Intronic
1046984753 8:120375013-120375035 GATTTCTCTGCCTTACATATTGG + Intergenic
1047438089 8:124851937-124851959 TAATCCTCTGCCTTCCATCGTGG - Intergenic
1048600111 8:135910813-135910835 GAGTTCTGTGCATTCCAAGTAGG - Intergenic
1049038201 8:140093208-140093230 ATGTTCTCTGCATTCCCTGGAGG + Intronic
1050820512 9:9873267-9873289 GAGCTCTCTGCTTTCAGTGGTGG + Intronic
1053069340 9:35091903-35091925 GAGTCCTCTGGCATCCATGGTGG - Exonic
1059566921 9:115391834-115391856 TAGTGCACTGACTTCCATGGGGG + Intronic
1062131467 9:134896300-134896322 GAGCCCTGTGCCTTCCATGACGG + Intergenic
1203356666 Un_KI270442v1:156112-156134 GAGTGCTTTGACTTCTATGGTGG - Intergenic
1186958656 X:14710935-14710957 GAGTTCATTACCTTCCAAGGTGG + Intronic
1187916130 X:24153658-24153680 GCCTTCTCTGTCTTCTATGGTGG + Intronic
1188019785 X:25144584-25144606 GATTTTTCTGCCTTCCACAGCGG - Intergenic
1189802787 X:44707348-44707370 TAGCACTCTGCCTTCTATGGGGG - Intergenic
1191980347 X:66918049-66918071 AAGTTCTCAGTCTACCATGGAGG + Intergenic
1192368405 X:70494348-70494370 GACTCCTCTGTCTTACATGGAGG + Intronic
1193644244 X:84047458-84047480 GAGGGGTCTGCCTTCCCTGGTGG - Intergenic
1196522442 X:116689481-116689503 GAGTCGTCTTTCTTCCATGGAGG + Intergenic
1199747622 X:150783856-150783878 GTGTTCTCTGCAGTGCATGGAGG + Intronic