ID: 1122924109

View in Genome Browser
Species Human (GRCh38)
Location 14:104891945-104891967
Sequence CCATCTGGGCAGAGGGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 298}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122924100_1122924109 4 Left 1122924100 14:104891918-104891940 CCAGGGCAGCCAGTGGGATGTGC 0: 1
1: 0
2: 2
3: 32
4: 241
Right 1122924109 14:104891945-104891967 CCATCTGGGCAGAGGGTGCTGGG 0: 1
1: 0
2: 2
3: 27
4: 298
1122924094_1122924109 21 Left 1122924094 14:104891901-104891923 CCCAGTCCTGAATGGGGCCAGGG 0: 1
1: 0
2: 0
3: 12
4: 231
Right 1122924109 14:104891945-104891967 CCATCTGGGCAGAGGGTGCTGGG 0: 1
1: 0
2: 2
3: 27
4: 298
1122924102_1122924109 -5 Left 1122924102 14:104891927-104891949 CCAGTGGGATGTGCAAGGCCATC 0: 1
1: 0
2: 1
3: 12
4: 108
Right 1122924109 14:104891945-104891967 CCATCTGGGCAGAGGGTGCTGGG 0: 1
1: 0
2: 2
3: 27
4: 298
1122924097_1122924109 15 Left 1122924097 14:104891907-104891929 CCTGAATGGGGCCAGGGCAGCCA 0: 1
1: 0
2: 0
3: 26
4: 265
Right 1122924109 14:104891945-104891967 CCATCTGGGCAGAGGGTGCTGGG 0: 1
1: 0
2: 2
3: 27
4: 298
1122924096_1122924109 20 Left 1122924096 14:104891902-104891924 CCAGTCCTGAATGGGGCCAGGGC 0: 1
1: 0
2: 0
3: 12
4: 184
Right 1122924109 14:104891945-104891967 CCATCTGGGCAGAGGGTGCTGGG 0: 1
1: 0
2: 2
3: 27
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122924109 Original CRISPR CCATCTGGGCAGAGGGTGCT GGG Intronic
900595613 1:3478906-3478928 CCATGTGAGCAGAGGGAGGTGGG + Intronic
901039682 1:6356411-6356433 TGAGCTGGGCTGAGGGTGCTGGG - Intronic
901044271 1:6386094-6386116 CCACCTGGGCAGAGAGGTCTTGG + Intronic
901049054 1:6417141-6417163 CCCTCTGGGCACAGGGAGGTGGG + Exonic
901221857 1:7587935-7587957 CCATCTGGGCCGAGGGAGGCGGG - Intronic
901646688 1:10720702-10720724 CCATCTGGGGAGAGGGAGGACGG + Intronic
901714961 1:11145900-11145922 TCATAAGGACAGAGGGTGCTTGG - Intronic
902705044 1:18198900-18198922 GCATCTGGGCAGAGGGGGCAGGG - Intronic
902914628 1:19629302-19629324 CCAGCAGGGCACAGGATGCTAGG + Exonic
903447368 1:23431044-23431066 CCTTCTGGGCAGAGGCTGCCTGG + Exonic
903451558 1:23456989-23457011 CCATCTAGGCTGAGCCTGCTTGG - Intronic
904925356 1:34043277-34043299 ACATCTGGGCACAGAGTCCTAGG - Intronic
905186912 1:36203594-36203616 ATCTCTGGGCGGAGGGTGCTGGG + Intergenic
905789078 1:40780886-40780908 CCGGCTGGGCACTGGGTGCTGGG - Intergenic
905869434 1:41394707-41394729 CCCTCTGGGGAGAGGGTGGTGGG + Intergenic
905878365 1:41447967-41447989 CCATCTGGGCAGGGAGTGTCTGG + Intergenic
907045523 1:51297959-51297981 CCGTTAGGGCAGAGGGAGCTGGG - Intronic
907111744 1:51932829-51932851 CCCTCTTGGCAAAGGTTGCTAGG + Intronic
907242970 1:53090832-53090854 CCATCCTGGAGGAGGGTGCTGGG - Intronic
910369561 1:86502052-86502074 CCAAATGGGCAGAGGGTTGTTGG + Intergenic
910603369 1:89055502-89055524 CCATATGGGCTGAGCCTGCTGGG + Intronic
910637347 1:89423612-89423634 CCATATGGGCTGAGCCTGCTGGG - Intergenic
910681775 1:89873290-89873312 CCTTCTGGGAAGAGAATGCTGGG + Intronic
912658067 1:111505384-111505406 CCAGATGGGCAGAGGTGGCTGGG - Intronic
914513188 1:148352448-148352470 CCACCTAGGCAGAGGTTCCTGGG - Intergenic
915583670 1:156831468-156831490 CCATGTGTCCAGATGGTGCTGGG + Intronic
915758786 1:158290159-158290181 GTATCTGGGTAGAGTGTGCTGGG + Intronic
916072377 1:161177648-161177670 CCCCCTGGGGAGCGGGTGCTAGG + Exonic
916654177 1:166858946-166858968 CCAGCAGGGCAGAGAGGGCTTGG + Intronic
920461708 1:206145666-206145688 CCATCTGGGGGCAGGGTGCAGGG + Intergenic
921503659 1:215938924-215938946 GCATCAGAGCATAGGGTGCTGGG + Intronic
922755332 1:228093445-228093467 ACATATGGGCAGAGGGTGGCTGG - Intronic
922815545 1:228446467-228446489 CCATCTGGGGAGAAGGTGTGCGG - Intergenic
923190093 1:231611927-231611949 CCAGCTGGGCACAGGGAGCTGGG + Intronic
923742074 1:236664160-236664182 CCATCTGGAAAGAGGCTTCTAGG + Intergenic
1062886627 10:1021292-1021314 CCAGCTGGGCTGAGGAAGCTGGG + Intronic
1062974118 10:1671167-1671189 CCAGACGGGGAGAGGGTGCTGGG + Intronic
1063264597 10:4434132-4434154 CCATCAGGGCTGTGGGTCCTGGG + Intergenic
1064566272 10:16641922-16641944 CCAGCTTGTCAGAGGGTCCTGGG - Intronic
1066362417 10:34744128-34744150 CCATTTGGCCAGAGGGAGATGGG - Intronic
1067238392 10:44470423-44470445 CCATGTGGACAGAGGCTGCCTGG + Intergenic
1067513906 10:46920530-46920552 CCTCCAGAGCAGAGGGTGCTGGG + Intronic
1067648348 10:48131302-48131324 CCTCCAGAGCAGAGGGTGCTGGG - Intergenic
1067694354 10:48524199-48524221 CCAGCTGGGCGCAGGGTGCGCGG + Intronic
1067811235 10:49428832-49428854 CCTCCTGGGCAGAGGGTAGTAGG + Intergenic
1067851654 10:49758688-49758710 CCCACTGGGCAGATGGTGCTGGG + Intronic
1068423237 10:56822621-56822643 CAATCTGGGCACAGGTGGCTTGG + Intergenic
1068965995 10:62912636-62912658 CCATCTGGTCCGAGGCAGCTGGG - Intronic
1070571243 10:77640402-77640424 GCATCTTTGGAGAGGGTGCTTGG + Intergenic
1070768824 10:79070676-79070698 CCAGGTGGGCCAAGGGTGCTTGG + Intronic
1071358402 10:84820954-84820976 CCATCAGGGCAGATCATGCTGGG - Intergenic
1071527333 10:86366250-86366272 CCAACGGGGCAGGGGGTGCGCGG - Intronic
1072747233 10:97949346-97949368 CAATCTGTGCAGAGAGTCCTGGG + Intronic
1073127280 10:101159234-101159256 CCAAATGGGCAGAGGCTGCAGGG + Intergenic
1073438340 10:103535931-103535953 CCATGTGGGCACAGGGGGCATGG + Intronic
1074111289 10:110424248-110424270 TCATCTGGGAGGAGGGGGCTAGG + Intergenic
1074715425 10:116214143-116214165 CCGGCTGGTCAGAGGGTGGTTGG - Intronic
1074971854 10:118545469-118545491 CAGTGTGGGGAGAGGGTGCTGGG - Intergenic
1075907284 10:126092727-126092749 CCATTTGGGCAGAGGCTTCAGGG - Intronic
1076071429 10:127493095-127493117 ACATCTGTGCAGTGAGTGCTTGG - Intergenic
1076135682 10:128044436-128044458 CTTCCTGAGCAGAGGGTGCTGGG + Intronic
1076234843 10:128855764-128855786 CCATCTTGGCAGAGCGTTCCAGG - Intergenic
1076946841 10:133657370-133657392 CCATCTGGGCTGGGGCTGTTGGG - Intergenic
1077268804 11:1665648-1665670 CCCTCTGGGCTCAGGGAGCTGGG - Intergenic
1077271949 11:1685532-1685554 CCCTCTGGGCTCAGGGAGCTGGG + Intergenic
1077614720 11:3666623-3666645 CCATTTGTGCAGAGGTGGCTGGG - Intronic
1080898367 11:36464271-36464293 CAATATGGCAAGAGGGTGCTGGG + Exonic
1081207116 11:40289484-40289506 CTTTCTGGGCATAGGGTCCTCGG + Intronic
1083324142 11:61865062-61865084 CCACCTGGGCAGAGGCTGGCTGG - Intronic
1083602331 11:63956481-63956503 CCAACTGGTCAATGGGTGCTTGG + Exonic
1084525416 11:69694764-69694786 TCATCTCGGCTGAGGCTGCTGGG + Intergenic
1084666447 11:70578972-70578994 ACAGCTGGGCAGAGGGTGGATGG - Intronic
1084889884 11:72231479-72231501 CAATCTGGGTAGAGAGTGCATGG - Exonic
1085473539 11:76773464-76773486 CCTTCTGGGCACAGAGGGCTGGG - Intergenic
1085647641 11:78237158-78237180 CCATCTGGGCATAGTTTTCTAGG + Intronic
1086492013 11:87365057-87365079 GCATATGAGCAGAGGCTGCTAGG - Intergenic
1086992379 11:93318153-93318175 CCATCTTGGAAGTGGGTCCTTGG + Intergenic
1087053577 11:93909792-93909814 ACAGCTGGGAAGAGAGTGCTGGG + Intergenic
1087242743 11:95797827-95797849 CTGACTGGGCAGAGGGTGGTCGG + Intronic
1089698819 11:120232005-120232027 ACATGTGGGCAGGGGGTGGTGGG + Intergenic
1089969165 11:122678601-122678623 GCCTCTGGGCAGTGGGTCCTGGG - Intronic
1091654644 12:2336760-2336782 GCATCTGGGCGGAGGTTTCTGGG + Intronic
1091690822 12:2596332-2596354 CCTTCTGGTCAGAGCATGCTGGG - Intronic
1094447919 12:30552234-30552256 TAATGTGGGCAGTGGGTGCTGGG + Intergenic
1096334113 12:50740077-50740099 TCAACTGGGCAGAGGGTGATGGG - Intronic
1097196136 12:57243336-57243358 CCATCTGGGCTGAGGTTGGCGGG - Intergenic
1101318019 12:103647222-103647244 CAATCCAGGCAGAGGGTGGTAGG + Intronic
1101822695 12:108196042-108196064 GCATCTGGGCAGAGGTTTCCGGG + Exonic
1102802286 12:115746637-115746659 TCATCTGGGAAGGGAGTGCTTGG - Intergenic
1102907364 12:116687263-116687285 CCGTCTGAGCCCAGGGTGCTGGG - Intergenic
1103340929 12:120220816-120220838 CCATCAGGGCCAAGGGTGCAGGG + Intronic
1103874622 12:124117251-124117273 CCATTTGGGCAGAGAATTCTGGG - Intronic
1104018341 12:124975312-124975334 GCATCTGTGCCGAGGGTGCTGGG - Intronic
1104387759 12:128365813-128365835 CCATCTGGACAAAGGGGGCTGGG - Intronic
1104595410 12:130117026-130117048 CCAGCAGGGCAGAGGGTGGGCGG + Intergenic
1105003090 12:132703714-132703736 ACCTCTGGGCAGAGGGGGCTGGG + Intronic
1105022905 12:132828980-132829002 CCCTGTGGGCAGAGGGTCCCCGG - Intronic
1105069892 12:133227915-133227937 CCCTCTGGGCAGAGGGAGGGGGG + Exonic
1106362017 13:29039394-29039416 CCCTATGGCCAGAGGGTGCCCGG - Intronic
1113902228 13:113803760-113803782 CCTTCTGGGCAGCTGGTCCTTGG - Intronic
1118290106 14:64512338-64512360 CTATGTGGGAAGAGTGTGCTAGG + Intronic
1118726186 14:68630622-68630644 CCATCTGGGCAGGAGGTGCCAGG + Intronic
1119157775 14:72427496-72427518 CAATTTGGGCAGAGGTTGGTCGG - Intronic
1119414378 14:74459847-74459869 CCATCTGGGCAGTGAGTTATTGG - Intergenic
1119725722 14:76920756-76920778 CCATCTGGGCAGGGGGTTGGGGG + Intergenic
1119900496 14:78255387-78255409 CCACGTGGGCAGAGGATGGTTGG + Intronic
1121422358 14:93824611-93824633 CCAGCAGGGGAGAGGGAGCTGGG + Intergenic
1121646858 14:95524313-95524335 CCATATGAGCAGCCGGTGCTTGG + Intergenic
1122588346 14:102826762-102826784 CCATCTGAGCAGAGGCCGCGTGG + Intronic
1122775868 14:104116807-104116829 TCGTCTGGGCCGGGGGTGCTCGG - Intergenic
1122924109 14:104891945-104891967 CCATCTGGGCAGAGGGTGCTGGG + Intronic
1202920918 14_KI270723v1_random:29925-29947 CCATCTGGGCTGGGGCTGTTGGG - Intergenic
1125728333 15:41879496-41879518 CCACCTGGGCAGAGGGTACAAGG + Exonic
1126423011 15:48495122-48495144 CCAACTTGGCATAGGGTGCACGG + Exonic
1128532146 15:68461829-68461851 CCATCTGGGCAGAGGACTCTGGG - Intergenic
1128748756 15:70133516-70133538 CCAGCTGGGCAGAGTTTGCAGGG - Intergenic
1129383156 15:75180546-75180568 AAAGCTGGGCAGAGGGTTCTGGG + Intergenic
1129682774 15:77667322-77667344 CCTTCTAGGCTGTGGGTGCTCGG + Intronic
1130915633 15:88302475-88302497 CCAGTTGGGCAGAGGGTGAGTGG - Intergenic
1131552750 15:93372188-93372210 CCATGTGGGCAGAAGCTGCTTGG + Intergenic
1131632722 15:94196143-94196165 CCCTCTGGGCACAGGGTGCAGGG + Intergenic
1132590111 16:722903-722925 GCAGGTGGGCAGAGGGAGCTGGG - Exonic
1132712990 16:1277505-1277527 ACATCTGGCCAGAGTGGGCTTGG - Intergenic
1133113138 16:3561618-3561640 CCAGCTGAGCAGAGGATGATGGG + Intronic
1134267306 16:12703333-12703355 CCATCTGGGAATACAGTGCTGGG - Intronic
1135597766 16:23756369-23756391 GCATCTGGGGAGAGGGTGGGAGG - Exonic
1136683992 16:31983566-31983588 TCAGCTGGTGAGAGGGTGCTGGG + Intergenic
1136784618 16:32927118-32927140 TCAGCTGGTGAGAGGGTGCTGGG + Intergenic
1136885165 16:33926688-33926710 TCAGCTGGTGAGAGGGTGCTGGG - Intergenic
1138276534 16:55738910-55738932 CCATCAGGGCAGCTGGTTCTGGG - Intergenic
1138282459 16:55782302-55782324 CCATCAGGGCAGCTGGTTCTGGG - Intergenic
1138286488 16:55814319-55814341 CCATCAGGGCAGCTGGTTCTGGG + Intronic
1139306810 16:65993613-65993635 CCATCTGTGCCAAGGGTGCCAGG - Intergenic
1139678913 16:68544721-68544743 ACCTCTGGACAGAGGGAGCTCGG - Intronic
1140473200 16:75226230-75226252 CCTTCTGAGCCCAGGGTGCTGGG - Intergenic
1140663784 16:77211474-77211496 CCGTCTGGGCAGGTGATGCTGGG - Intronic
1141585120 16:85028282-85028304 CATTCTGGGGAGAGGGTGCAAGG + Intronic
1142110789 16:88329961-88329983 CACTCTGGGCACAGGGTGCCTGG + Intergenic
1142155197 16:88529822-88529844 CCAGCTGGCCAGAGGGGGATGGG + Intronic
1142232999 16:88908569-88908591 CCAGCTGGGCAGGGCGGGCTGGG - Intronic
1142297002 16:89230728-89230750 CCATCAGGGCAGCAGCTGCTTGG + Exonic
1203087277 16_KI270728v1_random:1191124-1191146 TCAGCTGGTGAGAGGGTGCTGGG + Intergenic
1143947034 17:10602391-10602413 CCATCTGGACCGTGGGTCCTGGG - Intergenic
1145994146 17:29096018-29096040 CCAGCTGGGGAGATGGTGGTTGG + Intronic
1146824389 17:36010332-36010354 CCATCTCGGGAGAGGCTGCAAGG + Intergenic
1146929181 17:36765795-36765817 CCATGAGGTCAGGGGGTGCTGGG + Intergenic
1147144918 17:38479269-38479291 TCAGCTGGTGAGAGGGTGCTGGG + Intronic
1148325237 17:46779489-46779511 CCAGCTGGGCAGTGGGTGGTCGG - Intronic
1148776034 17:50096193-50096215 CCAGCTGGGGAGAGGCTGCCAGG - Intronic
1148902007 17:50885283-50885305 CTCTCTGAGCAGAGGTTGCTGGG + Intergenic
1149594739 17:57858039-57858061 CCTTCTGGGAAAATGGTGCTGGG + Intergenic
1150105489 17:62459619-62459641 GCGCCTGGGCAGGGGGTGCTGGG + Intronic
1150815254 17:68387679-68387701 CAGTCTGGGCGGAGGGTGCCGGG - Intronic
1151908632 17:77066521-77066543 CTACCTGGCCAGAGGCTGCTGGG - Intergenic
1152616075 17:81338497-81338519 CCCACTGTGCAGAGGCTGCTTGG - Intergenic
1154217228 18:12423944-12423966 CCAGCTGGGCAGAGTGTGGCTGG - Intronic
1155520915 18:26668201-26668223 ACACCCGGGCAGAGGGTGCAAGG - Intergenic
1156845494 18:41661212-41661234 TCATCTGGGCAGAGAAGGCTGGG + Intergenic
1157424183 18:47570848-47570870 CCTTCTGGGAAGAGGGTACCCGG - Intergenic
1157824193 18:50797744-50797766 GCATCCGGGGAGTGGGTGCTAGG + Intronic
1158722511 18:59938190-59938212 CCATCTGCAGAGTGGGTGCTAGG - Intergenic
1160015463 18:75136698-75136720 GCATCTGGGGAGTGGGTGGTGGG + Intergenic
1160434300 18:78833613-78833635 CCGGCTGGGGAGAGGGTGCCGGG - Intergenic
1160507948 18:79437685-79437707 CCGTCAGGGCAGAGGGTGGAGGG - Intronic
1160510853 18:79452552-79452574 CCCTCTGGGATGAGAGTGCTGGG - Intronic
1160872402 19:1283246-1283268 CCATGTGGGCAGTGGGTGCTGGG + Intergenic
1161520012 19:4718629-4718651 CCACCTGGGCACAGGCTGCTGGG - Intronic
1161943773 19:7421834-7421856 ACTTCTGAGCAGAGGGTCCTGGG + Intronic
1162329800 19:10020812-10020834 GCACGTGGGCAGAGGGGGCTTGG + Intronic
1163668349 19:18613411-18613433 CCATCAGGCCTGAGGGAGCTGGG - Intronic
1164593325 19:29518019-29518041 CCCTCTGAGCAGAGGGTCCAAGG + Intergenic
1164819896 19:31241687-31241709 ATATCTGGGCAGAGGATGGTGGG - Intergenic
1165049538 19:33132615-33132637 CCACCTGAGCAGGGCGTGCTGGG + Intronic
1165103995 19:33457954-33457976 CCACCCGAGCCGAGGGTGCTGGG - Intronic
1165135624 19:33666559-33666581 GCATCAGGGAAGAGGGTGCCGGG + Intronic
1165532809 19:36418291-36418313 CGGTGTGGGCAGAGGATGCTGGG + Intronic
1166256016 19:41605136-41605158 CCATCAGGAGAGAGGATGCTGGG + Intronic
1166684813 19:44789999-44790021 CCATCTGGGTAGAGGTAGCTGGG - Exonic
1168109419 19:54183677-54183699 CCAGCTGGGCAGAAGGGGGTGGG + Exonic
1168351180 19:55676872-55676894 AAACCTGGGCAGAGGGAGCTAGG - Exonic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925307561 2:2861110-2861132 ACATCTGGGGAGAGGCTGCCCGG - Intergenic
927349727 2:22094803-22094825 CCATCTGGGCACAGAAGGCTTGG - Intergenic
929096668 2:38268874-38268896 CAATCTCTGCAGAGGGTCCTGGG - Intergenic
929642168 2:43593030-43593052 CCATCTGGAAAGAAGTTGCTAGG + Intronic
929758689 2:44788552-44788574 TCATCTGGGCAGAGGTGGCCAGG - Intergenic
930479206 2:51926003-51926025 CCAACTGTGCAGAGGGAGCCTGG + Intergenic
930949696 2:57125577-57125599 CCATCTGGCTAGAGGTGGCTGGG - Intergenic
932598829 2:73110800-73110822 ACATCTGTTCAGGGGGTGCTGGG - Intronic
934473668 2:94578128-94578150 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
935155086 2:100477581-100477603 CCCTCTGGGCTGGGGGTGGTAGG + Intronic
935268790 2:101416106-101416128 CCATCTGGGCAGTGGAGGCCAGG + Intronic
936056794 2:109267846-109267868 CCTGCTGGACAGAGGTTGCTTGG + Intronic
936056944 2:109268494-109268516 CCTGCTGGACAGAGGTTGCTTGG - Intronic
936269728 2:111040623-111040645 CAAGCTGGGCAGGGGGTGCAGGG + Intronic
937227376 2:120377559-120377581 CCATGGGGTCAGAGGCTGCTGGG - Intergenic
938405057 2:131027907-131027929 GCAGCTGGGCAAAGGGGGCTGGG - Intronic
940972970 2:159913637-159913659 CCACCAGGGCTGAGGGAGCTGGG + Intergenic
941469251 2:165864031-165864053 GCATCTGGGAAGAGCCTGCTCGG - Intronic
942510038 2:176688310-176688332 TCATCTGAGCAGAGGGAGATGGG + Intergenic
1168806929 20:676936-676958 CCCCCTGCCCAGAGGGTGCTGGG + Intergenic
1169099362 20:2932641-2932663 CCATCTGCTCAGAGGGAGCTTGG + Intronic
1169914932 20:10674584-10674606 CGACCTGGGCAGACGCTGCTGGG + Intergenic
1171125301 20:22597239-22597261 GCAACTGGGCAGCGGGTGTTAGG + Intergenic
1171352931 20:24518619-24518641 CGCTCTGGGCAGAAGGTGCTGGG + Intronic
1171490510 20:25513539-25513561 CCTTCTGGTGAGAGTGTGCTAGG - Intronic
1172885630 20:38229025-38229047 CCATCTGGCCAGTGGGTACAGGG + Intronic
1173854469 20:46241192-46241214 CCATCTCAGGCGAGGGTGCTGGG - Exonic
1175306423 20:57978886-57978908 GCTTGTGGGCAGAGGTTGCTGGG - Intergenic
1175724868 20:61310826-61310848 CCCTGTGGGAAGAGGGAGCTAGG - Intronic
1175804674 20:61820861-61820883 CCAGGTGGACAGAGGGTCCTGGG - Intronic
1177287994 21:19076506-19076528 AAACCTAGGCAGAGGGTGCTTGG - Intergenic
1177327630 21:19612737-19612759 CCATCTTGGCAGAAGGTGAAGGG - Intergenic
1178358952 21:31932338-31932360 CCTTCAGGACAGAGGGTGCGAGG - Intronic
1178715798 21:34963261-34963283 CCAACTGGGACGAAGGTGCTGGG + Intronic
1178912334 21:36685465-36685487 CCATGTGGCCAGTGAGTGCTGGG - Intergenic
1179453215 21:41479816-41479838 GCATCGGGGGAGAGGGTGGTAGG - Intronic
1179785563 21:43727993-43728015 CCAGCTGGGCAGGGGCTGCCAGG - Intronic
1179885171 21:44310807-44310829 CCAGCTGTGCAGAGGGTGTCTGG + Intronic
1179925300 21:44530852-44530874 CCATCAGGGAGGAGGGTGCCAGG + Intronic
1180070614 21:45434255-45434277 GCATCTGACCAGAGGGTGCAGGG + Intronic
1180091599 21:45536386-45536408 CCATCTGGTCAGTGGGTGGCAGG + Intronic
1180141486 21:45896042-45896064 CCTGCTGGGCACAGGGTGCACGG - Intronic
1180593552 22:16959911-16959933 CCATCTGTGGAGTGGGTGGTTGG - Intergenic
1181036945 22:20174291-20174313 TCACCTGGGCAGAGGGTGGGAGG + Intergenic
1181182105 22:21075583-21075605 CCATCTGGGCAGAGCTGGTTGGG + Intergenic
1182011183 22:27002006-27002028 CCATAGGGGCAGAGGGAGTTAGG - Intergenic
1185214049 22:49588291-49588313 CCATCTGGGCAGAGGGTCCAGGG - Intronic
1185329974 22:50248100-50248122 CCCTCTGGGGAGTGGCTGCTGGG + Exonic
950017761 3:9766199-9766221 CCACCTGGGGAGAGCCTGCTTGG + Exonic
950123638 3:10498273-10498295 ACATCTGGGCCCAGGCTGCTTGG - Intronic
950444489 3:13028471-13028493 GCATCTGGGTAGAGGCTGTTTGG + Intronic
950638740 3:14334183-14334205 CACTCTGGGCAGAGGGGGCTGGG - Intergenic
952271310 3:31834643-31834665 CCATTTGGGAAAGGGGTGCTTGG + Intronic
953843470 3:46408178-46408200 CCAGCTGGGCTGAGAGTGCCTGG - Exonic
953980871 3:47412426-47412448 GGATCTGGGCAGATGGGGCTGGG + Intronic
954906510 3:54067738-54067760 CCCTCTGGGCAGAGGGGGCCAGG - Intergenic
955391906 3:58528058-58528080 CCAACAGGACAGAGGCTGCTGGG + Intronic
958188369 3:90152621-90152643 CCATCTGGACAGAGGGAATTTGG + Intergenic
958410893 3:93814455-93814477 CCATCTGGACAGAGGGAATTTGG + Intergenic
964729713 3:159851802-159851824 CCATCTGGAGTGAGGGTCCTGGG + Intronic
968577096 4:1372524-1372546 ACACGTGGGGAGAGGGTGCTAGG - Intronic
971471062 4:27027629-27027651 CCATGTGGGAAGCGGATGCTTGG - Intergenic
978534437 4:109746032-109746054 CCTTCTGAGCATGGGGTGCTGGG + Intronic
985450296 4:190058169-190058191 CCATCTGGGCTGGGGCTGTTGGG - Intergenic
985669475 5:1200235-1200257 CCATGTGGGCAGTGGGGGCAGGG + Intergenic
985676246 5:1232688-1232710 GCTTCTGGGCAGAGGGAGCTGGG + Intronic
992458954 5:76942601-76942623 CCAGCTGGTGAGAGTGTGCTGGG + Intergenic
994140753 5:96338683-96338705 ACCCCTGGGAAGAGGGTGCTTGG + Intergenic
998106333 5:139471488-139471510 CCATCTGGGAAGGGGAAGCTAGG + Intergenic
999050757 5:148521870-148521892 TCATGTGGGTAGAGGCTGCTGGG - Intronic
999250813 5:150181231-150181253 ACATCTGGGGAGAGGCTTCTAGG - Intronic
999326720 5:150648675-150648697 CCATCAGCACACAGGGTGCTGGG - Exonic
1000352276 5:160361283-160361305 CAGTCTGGGCAGAGGGCCCTTGG - Intronic
1001000249 5:167999278-167999300 CCATCTGGGCCCAGGGAGTTGGG - Intronic
1001551121 5:172602950-172602972 CCATGTGGGCCGAGGGGGCCTGG - Intergenic
1001685636 5:173592985-173593007 CCATCTGGGTAGAGAATTCTGGG + Intergenic
1002079658 5:176729795-176729817 ACACATGGGCAGAGTGTGCTGGG + Intergenic
1002099095 5:176848592-176848614 CCATCTGGGAATAGGGTGTCTGG - Intronic
1002653322 5:180720824-180720846 CCATCTGGGCACATGGAGGTAGG + Intergenic
1003248238 6:4402111-4402133 CGCTCTGGGAAGAGGCTGCTGGG - Intergenic
1003500800 6:6701208-6701230 GCAACTGGGGAGAGGGGGCTTGG - Intergenic
1004682400 6:17909169-17909191 TCATCTGGGAAAAGGGTACTGGG + Intronic
1004750924 6:18561130-18561152 CCATCTGGGCAGAGGGAATGTGG - Intergenic
1005418038 6:25622144-25622166 CCATCTGGGCACATGCTTCTTGG + Intergenic
1006388377 6:33744916-33744938 CCATCTGGGCAGAGCAGGATGGG + Intronic
1007431857 6:41781076-41781098 CCTTCAGGGCAGCGGGTGTTGGG + Intronic
1009491228 6:64294543-64294565 TCATCTGGACAGATGGTCCTTGG - Intronic
1013486956 6:110606420-110606442 CGATCTGGACAGGGGGTGATGGG + Intergenic
1017123308 6:151044252-151044274 CTTTCTGGGCAGAGGGTGACAGG + Intronic
1017497674 6:154995676-154995698 CCCTCCGGGGAGAGGGTGCCAGG - Intronic
1018397853 6:163393971-163393993 CCAGCAGGGCAGAGGGAGCTGGG - Intergenic
1018799432 6:167210707-167210729 CCAAGTGGGCAGAGGGAGCAGGG + Intergenic
1019094059 6:169564583-169564605 ACATTTGGGGAGAGTGTGCTGGG + Intronic
1022383086 7:29878832-29878854 GTATCAAGGCAGAGGGTGCTTGG + Intronic
1023703259 7:42912908-42912930 CCATCTGCAAAGAGGGTGCTTGG - Intronic
1023847360 7:44129940-44129962 CCTTCTGAGTGGAGGGTGCTGGG - Intergenic
1025236621 7:57239208-57239230 GCATCTGGGCAGCGGGTGGGGGG - Intergenic
1025983159 7:66424634-66424656 CCTTCAGGCCAGAGGATGCTAGG - Intergenic
1026032041 7:66802671-66802693 CCTTCAGGCCAGAGGATGCTAGG + Intronic
1031991693 7:128202874-128202896 CTGTCTGTGCAGAGGGTGCCAGG + Intergenic
1032034648 7:128512819-128512841 GCACCTGGCCAGGGGGTGCTGGG + Intergenic
1032542539 7:132715175-132715197 CCAGGAGGGCAGAGGGTACTGGG + Intronic
1033118703 7:138648358-138648380 CCATCTTGGCACAAAGTGCTGGG - Intronic
1034400878 7:150860721-150860743 AGATCTGGGCAAAGGGTGGTTGG - Intronic
1034994862 7:155571106-155571128 CCAGGTGGGCTGAGGCTGCTGGG - Intergenic
1035916810 8:3634056-3634078 ACATCTGGGTAGGGGGTGGTGGG + Intronic
1036498910 8:9295588-9295610 GCATTTGTGCAGGGGGTGCTAGG + Intergenic
1036709943 8:11071803-11071825 CCCAGTGGGGAGAGGGTGCTGGG - Intronic
1037493019 8:19413297-19413319 GCACCTGGGCTGAGGATGCTGGG - Intronic
1037516280 8:19635153-19635175 CCATCAGGGCAGAGGGGACCAGG + Intronic
1037708921 8:21339913-21339935 GCAACTGGGCAAAGGGTGCATGG + Intergenic
1039630539 8:39107501-39107523 CGATCTCGACAGAGGGCGCTGGG + Intronic
1039984254 8:42434813-42434835 GCATCTAGGCAGTGGCTGCTCGG - Intronic
1040569061 8:48592188-48592210 CCCTGTGGTGAGAGGGTGCTAGG + Intergenic
1042216609 8:66434602-66434624 TCATCTGGGCAAAGTGGGCTAGG + Intronic
1042696159 8:71556898-71556920 CCACCTGCGGAGAGGGTGCAGGG + Intronic
1046300364 8:112278254-112278276 CCACCTGGCTAGAGAGTGCTTGG + Intronic
1046642023 8:116742766-116742788 GCCTCTGGGAAGAGGGTGCTTGG + Intronic
1048762067 8:137805712-137805734 CCATCCCGACAGAGTGTGCTAGG - Intergenic
1048880078 8:138864701-138864723 TCATCTGGGCTGAGAGTTCTGGG - Intronic
1049218929 8:141420098-141420120 GCAGCTGGGAAGGGGGTGCTGGG + Intronic
1049237051 8:141517681-141517703 CCACCTGGGGAGAGGCTGCAGGG - Intronic
1049413894 8:142486464-142486486 TCATCTCGGCACAAGGTGCTTGG + Intronic
1049457775 8:142702479-142702501 CCCTGTGGGCAGAATGTGCTGGG - Intronic
1049846418 8:144804029-144804051 CCATCAGGGCACAGAGTGCTTGG - Intronic
1050386488 9:5096492-5096514 CCATGTGGGGGGAGGGTGGTAGG + Intronic
1051062257 9:13058062-13058084 GCATCTGGGCAAAGGGTTTTGGG + Intergenic
1052553099 9:29977190-29977212 CCCTCAGGGCAGAGTGTGCGAGG + Intergenic
1053684662 9:40510384-40510406 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1053934628 9:43138662-43138684 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054279064 9:63114581-63114603 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
1054297756 9:63345846-63345868 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054395772 9:64650357-64650379 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054430416 9:65155552-65155574 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054499964 9:65865969-65865991 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
1057196544 9:93118837-93118859 CCAACTGGGCAGAGTGTGATGGG - Intergenic
1057449499 9:95144124-95144146 ACATCTGGGGAGGGGGGGCTGGG + Intronic
1061222852 9:129262287-129262309 CTCTCTGGGCAGAGGGGTCTGGG + Intergenic
1061249795 9:129420120-129420142 CCATATGCTCAGTGGGTGCTTGG + Intergenic
1062145155 9:134984972-134984994 CCATGTGTGCAGAGGGTGTCTGG + Intergenic
1062338195 9:136081774-136081796 CCATCCAGGTAGAGGGAGCTTGG - Intronic
1188926731 X:36052842-36052864 GCATTTGGGTAGAGTGTGCTTGG + Intronic
1191850255 X:65581063-65581085 CCATCTGGGCCGTGAGTTCTAGG - Intergenic
1194379533 X:93176574-93176596 CCATCTGGGGAGAGGCTTCAAGG + Intergenic
1198119825 X:133580915-133580937 CCATATGGGCAGAGGTTGGGAGG - Intronic
1199676185 X:150191118-150191140 CTCTCTGTGCAGAGGCTGCTTGG - Intergenic
1200077315 X:153557557-153557579 CCTTCTGGGCTACGGGTGCTGGG - Intronic