ID: 1122925549

View in Genome Browser
Species Human (GRCh38)
Location 14:104897898-104897920
Sequence GGCCCGGCCCCCTTAACGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122925542_1122925549 6 Left 1122925542 14:104897869-104897891 CCGGGGCCACACTGGAGGTGGTC No data
Right 1122925549 14:104897898-104897920 GGCCCGGCCCCCTTAACGGGAGG No data
1122925535_1122925549 23 Left 1122925535 14:104897852-104897874 CCATCTGAACGCCACTCCCGGGG No data
Right 1122925549 14:104897898-104897920 GGCCCGGCCCCCTTAACGGGAGG No data
1122925541_1122925549 7 Left 1122925541 14:104897868-104897890 CCCGGGGCCACACTGGAGGTGGT No data
Right 1122925549 14:104897898-104897920 GGCCCGGCCCCCTTAACGGGAGG No data
1122925543_1122925549 0 Left 1122925543 14:104897875-104897897 CCACACTGGAGGTGGTCACCGCT No data
Right 1122925549 14:104897898-104897920 GGCCCGGCCCCCTTAACGGGAGG No data
1122925538_1122925549 12 Left 1122925538 14:104897863-104897885 CCACTCCCGGGGCCACACTGGAG No data
Right 1122925549 14:104897898-104897920 GGCCCGGCCCCCTTAACGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122925549 Original CRISPR GGCCCGGCCCCCTTAACGGG AGG Intergenic
No off target data available for this crispr