ID: 1122925799

View in Genome Browser
Species Human (GRCh38)
Location 14:104899211-104899233
Sequence CCTCGGATGTGATACAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122925793_1122925799 3 Left 1122925793 14:104899185-104899207 CCCGCAGAACGCTGGAGCCGAGC No data
Right 1122925799 14:104899211-104899233 CCTCGGATGTGATACAGGCCTGG No data
1122925794_1122925799 2 Left 1122925794 14:104899186-104899208 CCGCAGAACGCTGGAGCCGAGCA No data
Right 1122925799 14:104899211-104899233 CCTCGGATGTGATACAGGCCTGG No data
1122925792_1122925799 6 Left 1122925792 14:104899182-104899204 CCACCCGCAGAACGCTGGAGCCG No data
Right 1122925799 14:104899211-104899233 CCTCGGATGTGATACAGGCCTGG No data
1122925790_1122925799 24 Left 1122925790 14:104899164-104899186 CCAGGGGAGGCAGGAAAACCACC No data
Right 1122925799 14:104899211-104899233 CCTCGGATGTGATACAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122925799 Original CRISPR CCTCGGATGTGATACAGGCC TGG Intergenic
No off target data available for this crispr