ID: 1122926381

View in Genome Browser
Species Human (GRCh38)
Location 14:104904813-104904835
Sequence TCACGTTCACCTCAGCTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122926381_1122926383 -10 Left 1122926381 14:104904813-104904835 CCTCTTAGCTGAGGTGAACGTGA 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1122926383 14:104904826-104904848 GTGAACGTGACTCTCATGTCGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1122926381_1122926384 16 Left 1122926381 14:104904813-104904835 CCTCTTAGCTGAGGTGAACGTGA 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1122926384 14:104904852-104904874 GAATTAGCCACTGCCTCAAGAGG 0: 1
1: 0
2: 1
3: 9
4: 115
1122926381_1122926387 30 Left 1122926381 14:104904813-104904835 CCTCTTAGCTGAGGTGAACGTGA 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1122926387 14:104904866-104904888 CTCAAGAGGAAAACCAGCACAGG 0: 1
1: 0
2: 0
3: 25
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122926381 Original CRISPR TCACGTTCACCTCAGCTAAG AGG (reversed) Intergenic
902645699 1:17796477-17796499 TCAGTTTCACCTCTGGTAAGTGG - Intronic
905154665 1:35965791-35965813 TCAAGTCTACCTCAGTTAAGTGG - Intronic
910632540 1:89370860-89370882 TGACCTTCACTTCCGCTAAGAGG - Intronic
923883472 1:238129598-238129620 GCACGTAGACCTCAGATAAGGGG - Intergenic
1064584846 10:16829758-16829780 TCACCTTCACCTCAGTCTAGTGG + Intronic
1067686452 10:48468856-48468878 TCATGTTCACCTGAGCTCTGGGG - Intronic
1070822818 10:79372423-79372445 TCACCTTCAGCTCAGCTTAATGG - Intergenic
1072437875 10:95430324-95430346 TGACGTGCACCTCAGCTACTTGG + Intronic
1073253832 10:102138507-102138529 CCAGGTTCAACTCAGCTAATGGG - Intronic
1074026929 10:109645761-109645783 TCAGGGTCACCTCTGATAAGGGG - Intergenic
1074112220 10:110430816-110430838 CCACGATCACCTAAGCAAAGGGG - Intergenic
1081938365 11:46919717-46919739 TTACTTTCCCCTCAGCTAACAGG - Intergenic
1086802366 11:91193017-91193039 TCACATAGACCTCAGATAAGGGG + Intergenic
1089311171 11:117559227-117559249 TCATGTACAGCTCAGGTAAGGGG + Intronic
1091857775 12:3753131-3753153 TCCCGTTCAGCTCCGCTGAGGGG - Intronic
1092648141 12:10602103-10602125 TCACCTTCTCCCCAGCTATGTGG - Intergenic
1108650736 13:52477156-52477178 TCAAGTGGACCTCAGGTAAGGGG + Intergenic
1110794776 13:79623508-79623530 GCACGTAGACCTCAGATAAGGGG + Intergenic
1111517578 13:89355374-89355396 TCACCTTCACCACATCTCAGAGG + Intergenic
1112287621 13:98118137-98118159 TCACGTAGATCTCAGATAAGGGG - Intergenic
1118583916 14:67332940-67332962 TTTCTTTCACCTCAGCCAAGTGG - Exonic
1120966829 14:90175014-90175036 TCATGTACATCTCAGATAAGGGG - Intronic
1122926381 14:104904813-104904835 TCACGTTCACCTCAGCTAAGAGG - Intergenic
1123832451 15:24154688-24154710 ACAAGTACACCTCAGATAAGGGG + Intergenic
1123847442 15:24316885-24316907 ACAAGTACACCTCAGATAAGGGG - Intergenic
1123866490 15:24524263-24524285 ACAAGTACACCTCAGATAAGGGG - Intergenic
1123919643 15:25061302-25061324 CCAGGTGCACCTCACCTAAGAGG + Intergenic
1129340784 15:74885101-74885123 TCACATTGACCTCAGATAAGGGG - Intergenic
1131481203 15:92783209-92783231 GCACGTAGACCTCAGCTAAGGGG + Intronic
1142631139 17:1227730-1227752 TCACGGTCTCCTCAGCCACGCGG - Intronic
1143865196 17:9918239-9918261 TCACCTTCACCTTAGATATGGGG - Intronic
1149985533 17:61344192-61344214 TCAGGTTCTCCTAAGCAAAGAGG - Intronic
1154389533 18:13924426-13924448 TCACGTGCACGCCAGCAAAGAGG - Intergenic
1159793455 18:72813070-72813092 TCACATTCAGCTCACGTAAGTGG - Intronic
1162604309 19:11694971-11694993 TCAGGCGCACTTCAGCTAAGAGG - Intergenic
1164436501 19:28234903-28234925 TCAAGTTCCGCTCAGCTCAGTGG - Intergenic
926658429 2:15436567-15436589 GCACGTTAACCTCATCTAAATGG + Intronic
931711763 2:64993931-64993953 TCCAGTTCACCTGAGCTAATGGG + Intronic
932527480 2:72486677-72486699 TCAAGTTCACCTCTGGTAACAGG - Intronic
933586100 2:84180851-84180873 ACACGTTCAGCTGAGCTGAGTGG - Intergenic
936073182 2:109384695-109384717 CAAAGTTCACCTCAGCAAAGCGG - Intronic
947154980 2:227153437-227153459 CCACCTTCAGCTCAGCTATGTGG + Intronic
947848820 2:233267724-233267746 GCATGTTCACGTCAGCTGAGAGG + Intronic
1170572520 20:17640601-17640623 TAACCTTCTCCTCACCTAAGAGG + Intronic
1170674628 20:18467503-18467525 TCACCTTCACCTCCGCCATGAGG - Exonic
1172455265 20:35066515-35066537 TCATGTTCACTTCAGGTAATGGG + Intronic
1173442714 20:43092622-43092644 TCACTTTCACTTCAGTTTAGTGG - Intronic
1181984053 22:26787071-26787093 TCACCTAAACCTCAGATAAGGGG - Intergenic
1183647262 22:39133980-39134002 TCACGGTCACCTCACTTGAGGGG + Exonic
1184233747 22:43172073-43172095 TCACCTCCACCCCAGCTCAGTGG - Intronic
1185185152 22:49394566-49394588 ACACATCCACCTCAGCTCAGAGG - Intergenic
959487042 3:106938786-106938808 TCATGTAGACCTCAGATAAGAGG - Intergenic
959582825 3:107999678-107999700 TCACATAGACCTCAGGTAAGAGG - Intergenic
966174570 3:177122019-177122041 TCACCTTCACATCAGTTAATTGG - Intronic
971831588 4:31702059-31702081 TCAAGTTCCACACAGCTAAGAGG - Intergenic
980983675 4:139675004-139675026 TCACACAGACCTCAGCTAAGCGG - Intronic
984446525 4:179843718-179843740 TCAAGTTTATCTCAGTTAAGAGG - Intergenic
987251075 5:16102208-16102230 GCACGTTCAACTCAGCTTAATGG - Intronic
992267761 5:75034927-75034949 TCAGGGACACCCCAGCTAAGCGG + Intergenic
992267768 5:75034962-75034984 TCAGGGACACCCCAGCTAAGCGG + Intergenic
992267775 5:75034997-75035019 TCAGGGACACCCCAGCTAAGCGG + Intergenic
992267782 5:75035032-75035054 TCAGGGACACCCCAGCTAAGCGG + Intergenic
992267789 5:75035067-75035089 TCAGGGACACCCCAGCTAAGCGG + Intergenic
992267796 5:75035102-75035124 TCAGGGACACCCCAGCTAAGCGG + Intergenic
992267802 5:75035137-75035159 TCAGGGACACCTCAGCTAAGTGG + Intergenic
995088522 5:108143662-108143684 GCACCTTTACCTCAGCTAAGGGG - Intronic
997458684 5:134037263-134037285 TCATGTGGACCTCAGATAAGAGG + Intergenic
1003648102 6:7932686-7932708 TCACTTGCACCGCAGCTGAGGGG + Intronic
1004292819 6:14383879-14383901 TCACATAGACCTCAGATAAGGGG - Intergenic
1005987207 6:30882748-30882770 CCACGCTGACCCCAGCTAAGTGG - Intronic
1008738617 6:54577487-54577509 GCACGTAGACCTCAGATAAGAGG - Intergenic
1017370261 6:153697138-153697160 TGAAGTGTACCTCAGCTAAGGGG + Intergenic
1024322558 7:48085577-48085599 TCACTTCCCCTTCAGCTAAGTGG + Intergenic
1027437070 7:78175389-78175411 ACACTTGCACCTCAGCTGAGGGG - Intronic
1041942448 8:63403524-63403546 TCATGTAGACCTCAGATAAGGGG + Intergenic
1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG + Exonic
1046827077 8:118703195-118703217 TCAGGTTCACCTGAGCTAAGTGG + Intergenic
1052312552 9:27083631-27083653 TCAGGCTTACCTCAGCTAAGAGG + Intergenic
1056391201 9:86143052-86143074 TCACGTAGACTTCAGGTAAGGGG + Intergenic
1192547817 X:72028121-72028143 TCCCATTCACCTTAGCTGAGTGG - Intergenic
1198251205 X:134880712-134880734 TCATCTTCTCCTCACCTAAGGGG - Intergenic