ID: 1122929367

View in Genome Browser
Species Human (GRCh38)
Location 14:104926325-104926347
Sequence GAGGCACCCTTCCCCCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 153}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122929360_1122929367 10 Left 1122929360 14:104926292-104926314 CCCTGCACCCGGGGAGGGCGCCT 0: 1
1: 0
2: 1
3: 6
4: 115
Right 1122929367 14:104926325-104926347 GAGGCACCCTTCCCCCATGGTGG 0: 1
1: 0
2: 1
3: 14
4: 153
1122929356_1122929367 15 Left 1122929356 14:104926287-104926309 CCCCTCCCTGCACCCGGGGAGGG 0: 1
1: 0
2: 4
3: 37
4: 346
Right 1122929367 14:104926325-104926347 GAGGCACCCTTCCCCCATGGTGG 0: 1
1: 0
2: 1
3: 14
4: 153
1122929362_1122929367 3 Left 1122929362 14:104926299-104926321 CCCGGGGAGGGCGCCTCTGTACT 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1122929367 14:104926325-104926347 GAGGCACCCTTCCCCCATGGTGG 0: 1
1: 0
2: 1
3: 14
4: 153
1122929358_1122929367 14 Left 1122929358 14:104926288-104926310 CCCTCCCTGCACCCGGGGAGGGC 0: 1
1: 0
2: 1
3: 29
4: 370
Right 1122929367 14:104926325-104926347 GAGGCACCCTTCCCCCATGGTGG 0: 1
1: 0
2: 1
3: 14
4: 153
1122929363_1122929367 2 Left 1122929363 14:104926300-104926322 CCGGGGAGGGCGCCTCTGTACTT 0: 1
1: 0
2: 0
3: 10
4: 95
Right 1122929367 14:104926325-104926347 GAGGCACCCTTCCCCCATGGTGG 0: 1
1: 0
2: 1
3: 14
4: 153
1122929365_1122929367 -10 Left 1122929365 14:104926312-104926334 CCTCTGTACTTGTGAGGCACCCT 0: 1
1: 0
2: 0
3: 3
4: 107
Right 1122929367 14:104926325-104926347 GAGGCACCCTTCCCCCATGGTGG 0: 1
1: 0
2: 1
3: 14
4: 153
1122929359_1122929367 13 Left 1122929359 14:104926289-104926311 CCTCCCTGCACCCGGGGAGGGCG 0: 1
1: 0
2: 3
3: 35
4: 228
Right 1122929367 14:104926325-104926347 GAGGCACCCTTCCCCCATGGTGG 0: 1
1: 0
2: 1
3: 14
4: 153
1122929361_1122929367 9 Left 1122929361 14:104926293-104926315 CCTGCACCCGGGGAGGGCGCCTC 0: 1
1: 0
2: 1
3: 17
4: 162
Right 1122929367 14:104926325-104926347 GAGGCACCCTTCCCCCATGGTGG 0: 1
1: 0
2: 1
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122929367 Original CRISPR GAGGCACCCTTCCCCCATGG TGG Intronic