ID: 1122930958

View in Genome Browser
Species Human (GRCh38)
Location 14:104932935-104932957
Sequence TGCCAAACGCAGTCCTGGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122930958_1122930967 6 Left 1122930958 14:104932935-104932957 CCGGGCCAGGACTGCGTTTGGCA 0: 1
1: 0
2: 0
3: 9
4: 145
Right 1122930967 14:104932964-104932986 AGGGGGGCCTCTTTTTCTCTCGG 0: 1
1: 0
2: 0
3: 18
4: 170
1122930958_1122930966 -10 Left 1122930958 14:104932935-104932957 CCGGGCCAGGACTGCGTTTGGCA 0: 1
1: 0
2: 0
3: 9
4: 145
Right 1122930966 14:104932948-104932970 GCGTTTGGCAGGGCTGAGGGGGG 0: 1
1: 0
2: 4
3: 29
4: 469

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122930958 Original CRISPR TGCCAAACGCAGTCCTGGCC CGG (reversed) Exonic
900055053 1:623369-623391 GGCCTTACACAGTCCTGGCCAGG - Intergenic
900100086 1:958733-958755 TGCCAAACTCTGTCCTAGGCAGG - Intronic
900461613 1:2804652-2804674 TGCCAAAGGCAGTGCAGGCCTGG - Intergenic
900528908 1:3143146-3143168 TGGCAACCGCAGTGCTGGGCCGG + Intronic
901271188 1:7953353-7953375 TCCCAGACGGGGTCCTGGCCGGG - Intergenic
901473637 1:9474315-9474337 AGCAAAACCTAGTCCTGGCCAGG + Intergenic
903344796 1:22677262-22677284 CGGCAAACACAGGCCTGGCCGGG + Intergenic
904541695 1:31238180-31238202 TGCCATCCACAGACCTGGCCTGG - Intronic
908034783 1:60040278-60040300 GTCCACTCGCAGTCCTGGCCTGG + Intronic
908166585 1:61464868-61464890 TGTCAAACCCAGGCATGGCCTGG - Intergenic
910358931 1:86395742-86395764 TGCAGAACGAAGTCCTGACCGGG - Intronic
912422064 1:109549061-109549083 TGCTAAACGCAATTCTAGCCCGG - Intronic
916476980 1:165178949-165178971 TGCCAAAGTCAGTACTGGTCTGG + Intergenic
919141378 1:193576056-193576078 TGCCAAACATAGTCTTGGCCAGG - Intergenic
922359740 1:224810505-224810527 TCCCACATGCACTCCTGGCCTGG - Intergenic
1063639743 10:7818144-7818166 CGCCAAACGCAGACCTGCGCTGG - Intergenic
1067707799 10:48623730-48623752 TGCCAACCCCAGACCTGCCCTGG - Intronic
1070833967 10:79436478-79436500 TGCCAACCGCAGTGCTGACTGGG - Intronic
1070968218 10:80543007-80543029 TCCCAGATGCAGCCCTGGCCTGG + Intronic
1072200122 10:93150618-93150640 TACCATATGCTGTCCTGGCCAGG + Intergenic
1076699765 10:132265344-132265366 TGCCACACTCAGCCCAGGCCTGG + Intronic
1076997933 11:308073-308095 TGTCAAATGCAGAGCTGGCCAGG - Exonic
1077134780 11:993072-993094 TGCCACACGCTGACCTGCCCTGG - Intronic
1079400939 11:20105789-20105811 TGCAAAGTGCTGTCCTGGCCAGG - Intronic
1079691848 11:23427777-23427799 TGACAAAGAAAGTCCTGGCCGGG - Intergenic
1081148878 11:39601889-39601911 TTCAAAACTCAGTTCTGGCCAGG - Intergenic
1082065064 11:47892931-47892953 TCCCAGACGGAGTCATGGCCGGG - Intergenic
1084168198 11:67386957-67386979 TGCCAAATGCAGGCCTGGAAGGG + Intronic
1084960968 11:72716457-72716479 TGCCAAAGGCAGTGGTTGCCTGG - Intronic
1087171202 11:95051381-95051403 TGCCAAGCACAATTCTGGCCTGG + Intergenic
1090605644 11:128420631-128420653 TGCAGAACCCAGTCGTGGCCTGG + Intergenic
1090889827 11:130914214-130914236 TTCCAAACCCACTCCTAGCCCGG + Intronic
1091857698 12:3752827-3752849 TGCCACCCCCAGGCCTGGCCTGG - Intronic
1094103600 12:26785925-26785947 TCCCAGACGGGGTCCTGGCCGGG - Intronic
1095960958 12:47833904-47833926 TGGCAGACGCACGCCTGGCCCGG - Intergenic
1096154090 12:49332263-49332285 TGCCAGAGGCAGGCCTTGCCTGG + Intergenic
1102311836 12:111851191-111851213 TTTAAAAGGCAGTCCTGGCCGGG - Intronic
1103216958 12:119208981-119209003 TCCAAAACCCAGTCCTGGCAAGG + Intronic
1114199522 14:20507086-20507108 TCCCAGACGGGGTCCTGGCCGGG - Intronic
1114492721 14:23113486-23113508 TTCCATAAGCAGGCCTGGCCTGG - Intergenic
1118682710 14:68259896-68259918 TGCCCAACACATGCCTGGCCCGG - Intronic
1119182017 14:72611656-72611678 TGCCCAACACACTCCAGGCCAGG + Intergenic
1121711268 14:96040338-96040360 GGCCAAACGCAGCCCTTCCCTGG - Intronic
1121815463 14:96925122-96925144 TGCCAAGCTCAGCCCTGGCAGGG - Intronic
1121884619 14:97532154-97532176 TGCCAAACACAGTGCAGGCAGGG + Intergenic
1122101828 14:99418563-99418585 TGCCACAGGCTGTCCTGCCCAGG - Intronic
1122363237 14:101179831-101179853 TGCTGCACGCAGTCCTGGCAGGG - Intergenic
1122717176 14:103702718-103702740 GGCCAAACAGAATCCTGGCCAGG - Intronic
1122826443 14:104373070-104373092 TTCCCAAGGGAGTCCTGGCCAGG + Intergenic
1122930958 14:104932935-104932957 TGCCAAACGCAGTCCTGGCCCGG - Exonic
1126579342 15:50228791-50228813 TCCCCAACTTAGTCCTGGCCGGG - Intronic
1130411624 15:83653480-83653502 AGCCATAGGCACTCCTGGCCAGG - Intergenic
1130651975 15:85767282-85767304 TGTGAAAGTCAGTCCTGGCCGGG - Intronic
1131068451 15:89449028-89449050 TGCCAAAGGCATCCCCGGCCTGG + Intergenic
1133787110 16:8982118-8982140 TCCCAGACGCGGTCGTGGCCGGG - Intergenic
1136378326 16:29878332-29878354 CCCCACACGCAGTCTTGGCCCGG + Exonic
1139411320 16:66762978-66763000 TACAAAAAGGAGTCCTGGCCGGG - Intronic
1140873139 16:79125226-79125248 TGCCAATCGAATTCTTGGCCTGG - Intronic
1143113474 17:4567094-4567116 TGCCAAGGGCAGCCCTGGCTTGG + Intergenic
1148552060 17:48556307-48556329 AGTCAAAGGCAGGCCTGGCCCGG + Intronic
1149537712 17:57445175-57445197 TCACAAACGCATTCCTGGCTCGG - Intronic
1154131200 18:11738351-11738373 TGCCCACAGCAGACCTGGCCTGG - Intronic
1155908890 18:31486381-31486403 TGCTAACAGCAGTCCTGGACTGG - Intergenic
1157298075 18:46460042-46460064 TGCCGAAGGGGGTCCTGGCCAGG - Exonic
1158246032 18:55432807-55432829 TGCCAAGCACACTGCTGGCCTGG - Intronic
1159644863 18:70905848-70905870 TGACAAAAGGAGTCCTGGCCTGG - Intergenic
1161572488 19:5038201-5038223 TGCCACACCCAGTCCTGGGGTGG - Intronic
1161947762 19:7448937-7448959 TGCAGAACCAAGTCCTGGCCAGG - Intronic
1162587437 19:11569001-11569023 TCCAAAATGCAATCCTGGCCAGG - Intronic
1163291631 19:16383181-16383203 TGTCCAACTCTGTCCTGGCCCGG + Intronic
1165841817 19:38792665-38792687 TTCCGATCGCAGCCCTGGCCTGG - Intergenic
1167201169 19:48066540-48066562 GGCCACACACAGCCCTGGCCAGG + Intronic
1168636688 19:58002488-58002510 TCCCAAGCGCACTCCTGGGCCGG - Exonic
925028520 2:628794-628816 TGCCAAACACAGTCACGGCCAGG - Intergenic
925069053 2:951484-951506 TGGCCAACTCAGACCTGGCCTGG - Intronic
928205791 2:29282439-29282461 TGTCAAACGCAATCATGGCTAGG + Intronic
929822200 2:45282661-45282683 TGCCAAAGGCTGACCTGGCAGGG - Intergenic
931109399 2:59093740-59093762 TGCCAAAAGCATTCCTTGTCAGG + Intergenic
932737378 2:74263904-74263926 TGCCACATGCAGCCCTGGCTGGG + Intronic
932814216 2:74849009-74849031 GGCCATACACAGTCCTGGCCAGG - Intronic
934961920 2:98683196-98683218 TGCAAAGCGCTGTCCTGGACTGG + Intronic
936069288 2:109354450-109354472 TGCCAGAAGCAGTCCCTGCCTGG - Intronic
940275961 2:151940892-151940914 TGTCCAACTCAGTCCTGGTCTGG + Intronic
945875320 2:215272184-215272206 TGCCACAGGAAGGCCTGGCCTGG + Intergenic
1168816848 20:743550-743572 TGCCAAGCTCACTCCTGCCCTGG + Intergenic
1171544821 20:25991845-25991867 GGCTAAAACCAGTCCTGGCCAGG + Intergenic
1171892060 20:30725464-30725486 TTGCAAAGGCAGTGCTGGCCTGG - Intergenic
1172281922 20:33714009-33714031 AGCCAAAGGCACTCCTGGCGGGG + Intronic
1175928051 20:62480518-62480540 TCCCAGAAGCAGTCCTGGGCAGG + Intergenic
1175960651 20:62634732-62634754 GGCCAAGGGCAGTCCTGGACAGG + Intergenic
1176604775 21:8820004-8820026 TGCCAGACCCTGCCCTGGCCCGG - Intergenic
1179766686 21:43578920-43578942 TCCCAGAGGCGGTCCTGGCCGGG - Intronic
1180347065 22:11711609-11711631 TGCCAGACCCTGCCCTGGCCCGG - Intergenic
1180354813 22:11829699-11829721 TGCCAGACCCTGTCCCGGCCCGG - Intergenic
1180383438 22:12162632-12162654 TGCCAGACCCTGTCCCGGCCCGG + Intergenic
1180965789 22:19787364-19787386 TGCCAAACGGAGGGCTGGACTGG - Exonic
1184220823 22:43098697-43098719 GGGCCAACACAGTCCTGGCCCGG + Intergenic
1184259443 22:43306157-43306179 TGACAGACGCAGTACTGGACTGG + Intronic
1184564568 22:45284534-45284556 TGGAAAACGAAGTCCAGGCCTGG - Intergenic
1184739859 22:46421514-46421536 TCCCAAACACAGGCCTGGTCAGG - Intronic
961008655 3:123421902-123421924 TGCTAACCACAGCCCTGGCCTGG + Intronic
961201406 3:125048528-125048550 TGCCAAACTCATTCCTGTCTTGG - Intronic
961321749 3:126081999-126082021 TGCCAGAGGAAGGCCTGGCCAGG + Intronic
961580127 3:127874197-127874219 TGCCAGAAGCAGTCCAGGGCTGG + Intergenic
963141794 3:141952082-141952104 TGTCAAAGGCAGTCCAGGCAAGG + Exonic
968518932 4:1027117-1027139 TGCAGGACGCAGGCCTGGCCAGG - Intergenic
968927144 4:3555521-3555543 TTCCAAAAGCAATGCTGGCCGGG - Intergenic
969675014 4:8609845-8609867 TGCCAAACCCAGGCCTCTCCTGG - Intronic
970409647 4:15791897-15791919 TCCCAGACGGGGTCCTGGCCGGG - Intronic
985331738 4:188844819-188844841 TGCCTAACGCACTCTTGCCCTGG + Intergenic
986200467 5:5574100-5574122 TGCCCAGCGGAGTCCTGGTCAGG + Intergenic
986513903 5:8540996-8541018 TGCCAAACGCAGTCATGTTCTGG + Intergenic
986560309 5:9054086-9054108 TGCAACACGCAGCCCTGCCCAGG - Exonic
986626729 5:9729519-9729541 TGCCAAACACAATTCTGGGCAGG - Intergenic
987011582 5:13771400-13771422 TGCCAAATGCAGTCAGAGCCAGG - Intronic
987359005 5:17089856-17089878 GGCCACACTCAGTCCTTGCCAGG + Intronic
993401132 5:87452985-87453007 TGCCAAGCCCTGTCCTGTCCAGG + Intergenic
994744774 5:103664798-103664820 TCCCCAACCCTGTCCTGGCCTGG + Intergenic
995716778 5:115088201-115088223 AGCCAAGCACAGTCCTGGGCTGG - Intergenic
998005391 5:138653592-138653614 TGTCAAATGCATACCTGGCCTGG - Intronic
999029071 5:148269798-148269820 TGACAATCACAGTTCTGGCCTGG - Intronic
1000382779 5:160644210-160644232 AGCCAAAGCCAGTCCTGGTCTGG + Exonic
1001474756 5:172042600-172042622 TTCCCAACGCTGGCCTGGCCTGG + Exonic
1001532276 5:172471815-172471837 AGAAAAAAGCAGTCCTGGCCAGG - Intergenic
1003319235 6:5037531-5037553 TCCCAGACGGGGTCCTGGCCGGG + Intergenic
1007746151 6:44044041-44044063 TCCCAGACCCAGGCCTGGCCTGG - Intergenic
1013337170 6:109175453-109175475 TGTCAAACGCAGACTTGGCCAGG + Intergenic
1018094925 6:160377024-160377046 TACCAAAAGCTGTCCTTGCCAGG - Intronic
1019992076 7:4699053-4699075 TGCCAAACTCCATCCTGGGCTGG - Intronic
1022663395 7:32387396-32387418 TCCCAGACGGGGTCCTGGCCGGG + Intergenic
1028939123 7:96500844-96500866 AGCCAAATGTAGTCCAGGCCTGG - Intronic
1034412533 7:150948691-150948713 TCCCAAACTCAGTCTTTGCCTGG - Intronic
1035147177 7:156830858-156830880 TGCCTAGCACAGTCCTGGCACGG - Intronic
1036464244 8:8981499-8981521 AGTCAAATACAGTCCTGGCCCGG - Intergenic
1038310294 8:26441160-26441182 TGACTCACGCAGGCCTGGCCTGG + Intronic
1039414961 8:37385926-37385948 TGCAAAACTGAGTCCAGGCCAGG + Intergenic
1040445804 8:47492248-47492270 TGCCAGACACAGACGTGGCCTGG + Intronic
1040819034 8:51535190-51535212 TCCCAGACGGGGTCCTGGCCGGG - Intronic
1044217449 8:89628895-89628917 TGCCAAATTCATTCCTGTCCAGG - Intergenic
1048873829 8:138821165-138821187 TGCCAATCACAGTCTTGCCCTGG + Exonic
1049174555 8:141183827-141183849 TGGCAAAAGCTGTCCTGGCGGGG + Intronic
1049610592 8:143553102-143553124 TGCCAGACACTGTCCTGGCCTGG - Intergenic
1052902649 9:33807341-33807363 AGCCAAGCCCAGTCCAGGCCTGG - Intergenic
1053016997 9:34667562-34667584 TGCCAGAGACAGCCCTGGCCTGG - Intergenic
1053487935 9:38474544-38474566 AGCCAAGCCCAGTCCAGGCCTGG + Intergenic
1053802064 9:41770909-41770931 TTCCAAAAGCAATGCTGGCCAGG - Intergenic
1054190443 9:61982604-61982626 TTCCAAAAGCAATGCTGGCCAGG - Intergenic
1054462913 9:65475261-65475283 TTCCAAAAGCAATGCTGGCCAGG + Intergenic
1054648022 9:67605522-67605544 TTCCAAAAGCAATGCTGGCCAGG + Intergenic
1057047528 9:91897790-91897812 TTCCAAAGGCAGCCCAGGCCCGG + Intronic
1060731504 9:126039733-126039755 TGCCAATCGCTTTCCTGGCCAGG - Intergenic
1060845177 9:126831228-126831250 TGCCAAATGCATTCCTGCCTCGG + Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1062589585 9:137267393-137267415 TGCCGTATGCAGTCCTGCCCAGG + Intronic
1187201572 X:17138909-17138931 AGGCAAACGCAGTGCTGGCTCGG + Exonic