ID: 1122931129

View in Genome Browser
Species Human (GRCh38)
Location 14:104933502-104933524
Sequence GAGGCGCGGAGCCCACGCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 224}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122931112_1122931129 19 Left 1122931112 14:104933460-104933482 CCGGAACCCAAATTCCCGCCCCG 0: 1
1: 0
2: 0
3: 10
4: 84
Right 1122931129 14:104933502-104933524 GAGGCGCGGAGCCCACGCCCGGG 0: 1
1: 0
2: 0
3: 15
4: 224
1122931123_1122931129 0 Left 1122931123 14:104933479-104933501 CCCGAGGCTGCCGGGGGAAGCGA 0: 1
1: 0
2: 1
3: 13
4: 177
Right 1122931129 14:104933502-104933524 GAGGCGCGGAGCCCACGCCCGGG 0: 1
1: 0
2: 0
3: 15
4: 224
1122931121_1122931129 4 Left 1122931121 14:104933475-104933497 CCGCCCCGAGGCTGCCGGGGGAA 0: 1
1: 0
2: 0
3: 14
4: 159
Right 1122931129 14:104933502-104933524 GAGGCGCGGAGCCCACGCCCGGG 0: 1
1: 0
2: 0
3: 15
4: 224
1122931115_1122931129 12 Left 1122931115 14:104933467-104933489 CCAAATTCCCGCCCCGAGGCTGC 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1122931129 14:104933502-104933524 GAGGCGCGGAGCCCACGCCCGGG 0: 1
1: 0
2: 0
3: 15
4: 224
1122931122_1122931129 1 Left 1122931122 14:104933478-104933500 CCCCGAGGCTGCCGGGGGAAGCG 0: 1
1: 0
2: 0
3: 16
4: 133
Right 1122931129 14:104933502-104933524 GAGGCGCGGAGCCCACGCCCGGG 0: 1
1: 0
2: 0
3: 15
4: 224
1122931111_1122931129 26 Left 1122931111 14:104933453-104933475 CCGCGCTCCGGAACCCAAATTCC 0: 1
1: 0
2: 0
3: 2
4: 71
Right 1122931129 14:104933502-104933524 GAGGCGCGGAGCCCACGCCCGGG 0: 1
1: 0
2: 0
3: 15
4: 224
1122931120_1122931129 5 Left 1122931120 14:104933474-104933496 CCCGCCCCGAGGCTGCCGGGGGA 0: 1
1: 0
2: 0
3: 30
4: 534
Right 1122931129 14:104933502-104933524 GAGGCGCGGAGCCCACGCCCGGG 0: 1
1: 0
2: 0
3: 15
4: 224
1122931127_1122931129 -10 Left 1122931127 14:104933489-104933511 CCGGGGGAAGCGAGAGGCGCGGA 0: 1
1: 0
2: 0
3: 11
4: 119
Right 1122931129 14:104933502-104933524 GAGGCGCGGAGCCCACGCCCGGG 0: 1
1: 0
2: 0
3: 15
4: 224
1122931114_1122931129 13 Left 1122931114 14:104933466-104933488 CCCAAATTCCCGCCCCGAGGCTG 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1122931129 14:104933502-104933524 GAGGCGCGGAGCCCACGCCCGGG 0: 1
1: 0
2: 0
3: 15
4: 224
1122931124_1122931129 -1 Left 1122931124 14:104933480-104933502 CCGAGGCTGCCGGGGGAAGCGAG 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1122931129 14:104933502-104933524 GAGGCGCGGAGCCCACGCCCGGG 0: 1
1: 0
2: 0
3: 15
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122931129 Original CRISPR GAGGCGCGGAGCCCACGCCC GGG Exonic