ID: 1122931307

View in Genome Browser
Species Human (GRCh38)
Location 14:104933971-104933993
Sequence CTGAGTGAGGGGAGGGTGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1673
Summary {0: 2, 1: 1, 2: 13, 3: 139, 4: 1518}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122931293_1122931307 19 Left 1122931293 14:104933929-104933951 CCTGCGACTGAGGGGACGGGGAG 0: 1
1: 3
2: 7
3: 31
4: 248
Right 1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG 0: 2
1: 1
2: 13
3: 139
4: 1518

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122931307 Original CRISPR CTGAGTGAGGGGAGGGTGGG AGG Exonic
900104066 1:974747-974769 CTGGGGCAGGGAAGGGTGGGAGG + Exonic
900357983 1:2273894-2273916 GTGAGTGAGAGGGTGGTGGGCGG - Intronic
900372481 1:2338087-2338109 CTGAGTGAGTGGAGGGGCGCTGG + Intronic
900509341 1:3051200-3051222 ATGGGTGAGTGGATGGTGGGTGG - Intergenic
900568436 1:3346744-3346766 CACTGTGAGGTGAGGGTGGGTGG + Intronic
900581411 1:3411707-3411729 GTGAGTGCGGGGAACGTGGGAGG - Exonic
900637475 1:3672984-3673006 CTGGGTATGAGGAGGGTGGGTGG - Intronic
900654798 1:3751167-3751189 CTTGGTGAGGGGAGTGTGGCAGG - Intergenic
900735299 1:4296011-4296033 ATGACTGATGGGTGGGTGGGTGG - Intergenic
900897000 1:5490226-5490248 TTGAGAGGGTGGAGGGTGGGAGG + Intergenic
900930595 1:5734688-5734710 CAGAGACAGGGGAGGGTGCGTGG - Intergenic
901014127 1:6218027-6218049 CTGAGGGAGGGAAGGGTGTGTGG - Intronic
901025066 1:6274804-6274826 CTGAGCGCGGTGTGGGTGGGCGG + Intronic
901028548 1:6292350-6292372 CGCAGTGAGGGCAGGTTGGGTGG - Intronic
901197318 1:7447413-7447435 TTGAGTGGGGGCGGGGTGGGGGG + Intronic
901447177 1:9315704-9315726 CTGAGTGGGGAGTTGGTGGGGGG + Intronic
901689759 1:10965111-10965133 CTGAATGAGGGCAGCCTGGGAGG - Intronic
901744346 1:11362745-11362767 AAGAGTGAGCGGAGGGTGCGAGG + Intergenic
901789635 1:11647565-11647587 CTGGGGGAGGGGAGGTGGGGAGG - Intergenic
901796199 1:11681013-11681035 CTGGGGGAGGGGAGAGGGGGCGG - Intronic
901826414 1:11864676-11864698 CTAAGCAAGGGGAGGGAGGGAGG - Intergenic
901913858 1:12482265-12482287 CTGGATAAGGGGAGGCTGGGTGG - Intronic
901930708 1:12595084-12595106 CAGAGGGAGGGGAGGGGAGGCGG + Intronic
902328554 1:15718672-15718694 CAGGGTGGGGGCAGGGTGGGCGG + Intronic
902374948 1:16026280-16026302 CTGGGGCAGGGTAGGGTGGGCGG - Intronic
902843956 1:19094898-19094920 CTGAGTGAGGACAAGGTGAGTGG - Exonic
903050020 1:20593816-20593838 CTGTGTGAGGCCAAGGTGGGAGG - Intronic
903322792 1:22552796-22552818 CGGGGTGAGGGGAGGGTGCCAGG + Intergenic
903408247 1:23117477-23117499 CTGATTGTGGGGGGGGGGGGGGG - Intronic
903813777 1:26049767-26049789 CTGAGTCTGGAGATGGTGGGAGG - Intergenic
903846194 1:26280940-26280962 CTGGGGGACGGGGGGGTGGGGGG + Intronic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
903967481 1:27099755-27099777 CTGAGTAAGGACAGGTTGGGTGG + Exonic
904080985 1:27872527-27872549 CAGACTGAGGGGCGGGCGGGCGG - Intronic
904160960 1:28521700-28521722 CTGAGGGAAGGTGGGGTGGGTGG - Intronic
904330293 1:29754153-29754175 CTGAGGGAGTGGGGCGTGGGGGG + Intergenic
904376600 1:30085922-30085944 CAGAGAGAGGGGAGAGTGGGTGG - Intergenic
904380948 1:30110514-30110536 GTGAGTGATGGGAGGATGGGAGG - Intergenic
904421562 1:30397793-30397815 CTGAAGGAGGGGTTGGTGGGTGG - Intergenic
904471940 1:30741548-30741570 CTGGGTGCTGAGAGGGTGGGAGG - Intronic
904495229 1:30882704-30882726 CTGAGAGAGGATGGGGTGGGAGG - Intronic
904625212 1:31798554-31798576 CTGAGTGAGGAGGTGGTGGAGGG - Exonic
904625830 1:31801544-31801566 CTGGGGGAGGGCAGGCTGGGTGG + Intronic
904741939 1:32684200-32684222 CTGGCTGAGGGGATGGTGGGAGG - Exonic
904842147 1:33379455-33379477 GTGGGTGGGGGGATGGTGGGGGG - Intronic
905037121 1:34925511-34925533 CTGAGTGAGGGGAGGGGAGAGGG + Intronic
905267221 1:36762882-36762904 GTGAGTGAGGGGAGGAGCGGAGG + Intergenic
905274107 1:36806065-36806087 CTGTGGGAGGGGTGGGTGTGTGG - Intronic
905389036 1:37624470-37624492 CTGAGGGAGGTGGGGTTGGGGGG - Intronic
905461526 1:38125906-38125928 CTGAGAGGGTGGAGTGTGGGAGG + Intergenic
905624084 1:39475507-39475529 ATGAGTGAGGGCTGGGTGGGTGG + Intronic
905874692 1:41424257-41424279 CTGAGTGAGTGGCGGGGGTGTGG + Intergenic
905915509 1:41681735-41681757 CTGAGGGAGGAGGGGCTGGGAGG + Intronic
905970558 1:42138693-42138715 CTGGGTATGGGGAGAGTGGGAGG - Intergenic
906145688 1:43558757-43558779 CTGGGGGAGGGGAGGGAGGCAGG + Intronic
906146782 1:43565274-43565296 CCTAGCGAGGGGAGGGTCGGGGG - Intronic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906465898 1:46078962-46078984 CTGAGGGAGGGGAGAATGGGGGG + Intronic
906699803 1:47849719-47849741 CTAAGTGAGGGGATGGGGTGCGG + Intronic
907311420 1:53541110-53541132 CTGAGAGAGTTGGGGGTGGGAGG + Intronic
907394286 1:54178514-54178536 CTGAGTGAGCGGAGGGGATGTGG + Intronic
907400387 1:54221673-54221695 CTGAGTGTGTGGTGTGTGGGTGG - Intronic
907437118 1:54457060-54457082 CTGAGTGAGGGGCGAGTTGCAGG - Intergenic
907840317 1:58150833-58150855 TGGGGTGAGGGGACGGTGGGGGG - Intronic
909169974 1:72282741-72282763 GGGAGGGAGGGGAGGGAGGGAGG - Intergenic
909276340 1:73691273-73691295 TTGAGAGGGTGGAGGGTGGGAGG - Intergenic
910206267 1:84751729-84751751 CTGAGGGGTGGGAGGGTGGGAGG + Intergenic
911898257 1:103467351-103467373 GTGAGTGAGTGGTGGGTGAGTGG - Intergenic
912667214 1:111593072-111593094 CTGAGTGGGTGGAGGGGGCGGGG + Intronic
913121720 1:115748512-115748534 CTGAATGAGGGGTGGGGGTGGGG - Intronic
913688542 1:121256815-121256837 TTCAGTCAGGGGAAGGTGGGGGG + Intronic
913975540 1:143451740-143451762 CTGGGGGTGGGGGGGGTGGGGGG - Intergenic
914040398 1:144044458-144044480 TTCAGTCAGGGGAAGGTGGGGGG + Intergenic
914081135 1:144412471-144412493 CTGGGGGCGGGGGGGGTGGGGGG + Intergenic
914149058 1:145023462-145023484 TTCAGTCAGGGGAAGGTGGGGGG - Intronic
914370610 1:147021532-147021554 CAGAGGGAGGGGAGGATAGGGGG - Intergenic
914469222 1:147959542-147959564 GTGGGTGCTGGGAGGGTGGGTGG - Intronic
915297553 1:154932036-154932058 CTGAGTGAGAGGGTGGTGTGAGG + Intronic
915328314 1:155092687-155092709 CTGAGGGAGAGGGGGCTGGGGGG + Intergenic
915386989 1:155503964-155503986 CTTAGGGAGGCCAGGGTGGGTGG - Intronic
915549721 1:156625058-156625080 CCGACCGAGGGCAGGGTGGGCGG - Intronic
915587439 1:156851865-156851887 GTGAGTGTAGGGAGGGTGGGGGG - Intronic
915622643 1:157095322-157095344 CTGAGTGAGGGGTGGAGGTGAGG + Intronic
915851745 1:159331748-159331770 TGGAGTGAGGGGAGGGGGGAGGG - Intergenic
915875681 1:159609742-159609764 CGGAGTGGGGGGAGGGTGGAGGG + Intergenic
915932324 1:160068353-160068375 CTGAGTGGGGGGTGGGGGGATGG + Intronic
915972324 1:160363373-160363395 TTGAGGGAGGGGAGGGAGGTTGG - Intergenic
916039098 1:160947102-160947124 CTTAGTGAGGGGAGTGTAGCAGG + Intronic
916187224 1:162145247-162145269 GTATGTGAGGGGTGGGTGGGGGG + Intronic
916445094 1:164864606-164864628 CTGGGGGAGGGAAGGGTGAGGGG + Intronic
916564751 1:165964795-165964817 TTGGGTGAGGGGAGGGGGGAGGG - Intergenic
916712927 1:167427781-167427803 CTGGGTGGGGGCCGGGTGGGGGG + Intergenic
917002602 1:170375944-170375966 GTGTGTGTGGGGGGGGTGGGGGG + Intergenic
917593891 1:176507783-176507805 AGGAGGGAGGGGAGGGAGGGAGG + Intronic
917838729 1:178960734-178960756 CTGAGGGAGGGGTGGGTGGCAGG - Intergenic
918224622 1:182470368-182470390 ATGAGTGAGGGGAGGGAAGTAGG - Intronic
918419279 1:184346814-184346836 TTGGGTGGGGGGAGGGTGGCAGG - Intergenic
919204604 1:194405902-194405924 TTCAGGGAGTGGAGGGTGGGAGG + Intergenic
919289726 1:195614169-195614191 TTGGGTGAGGGGAGGGGGGAAGG - Intergenic
919640479 1:200040397-200040419 CTGAGTGAGTTGGGGGTGGGAGG + Intronic
919693071 1:200544735-200544757 GTGAGGAAGGGGAGGGAGGGAGG + Intergenic
919856748 1:201711383-201711405 GTCAGGGAGGGGAGGCTGGGTGG - Intronic
919922311 1:202174025-202174047 CTGAGTGAGAGCAGGCTGGTGGG + Intergenic
920053064 1:203175071-203175093 CTGAGTAAGGGAAGGGTAAGGGG - Intronic
920343151 1:205288374-205288396 CCGGGTGAGTGAAGGGTGGGTGG - Intergenic
920347966 1:205318839-205318861 CTGAGGGAAGGGCAGGTGGGCGG - Intronic
920387401 1:205578722-205578744 CTGAGAGAGGGGAGGGGGAAAGG - Intronic
920475864 1:206275314-206275336 TTCAGTCAGGGGAAGGTGGGGGG + Intronic
920558010 1:206918357-206918379 GCGAGTGAGGGGAGAGAGGGAGG - Intronic
920566746 1:206980263-206980285 CTGAGTCAGGGAAGGAAGGGAGG + Intergenic
920825874 1:209423856-209423878 CTGGGTGAGGGGGAGGTGTGGGG + Intergenic
920955093 1:210612302-210612324 CTGAGAGAGGAGAGGATGAGAGG - Intronic
921155948 1:212438955-212438977 CTGAGAAGGTGGAGGGTGGGTGG - Intronic
921165911 1:212506999-212507021 CTGAGAGTGGGGAAGGTAGGAGG - Intergenic
921174870 1:212585076-212585098 CTGAGTGTCGGAGGGGTGGGAGG + Intronic
921233298 1:213096443-213096465 CTTTGGGAGGGCAGGGTGGGTGG + Intronic
921260453 1:213381459-213381481 CTGAATGAGAGGAGGGGGGCAGG + Intergenic
921624199 1:217359956-217359978 TTGGGTGAGGGGAGGGGGGAGGG + Intergenic
921880273 1:220247590-220247612 CTCGATGAGGGGAGGTTGGGAGG + Intronic
922406704 1:225321820-225321842 CAGAGTCAGGGGAGGAAGGGTGG - Intronic
922860829 1:228814939-228814961 CTCAGAAAGGGGAGGGCGGGAGG - Intergenic
922889753 1:229052578-229052600 CTTGGTGGGGGAAGGGTGGGAGG + Intergenic
923274761 1:232386406-232386428 CTGAGTGAGGAGAGGAAGGAAGG + Intergenic
923657054 1:235926242-235926264 CTCAGAAAGGGGAGGATGGGAGG - Intergenic
924123238 1:240823811-240823833 CAGAGTGGGGGGCGGGAGGGGGG - Intronic
924172663 1:241357505-241357527 CTGTGCGATGGGTGGGTGGGTGG + Intergenic
924632273 1:245752309-245752331 CTCTGTGAGGGCAGGGAGGGAGG - Intronic
924784512 1:247183128-247183150 CTGAGTGTGGGGTGGGAGGAAGG - Intergenic
1062799865 10:371138-371160 CAGGGTGAGGGGATGGTGGCAGG - Intronic
1062810054 10:456394-456416 CTGCCTGAGGGGAGGCTGTGAGG + Intronic
1062831465 10:608486-608508 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
1062903828 10:1166372-1166394 CTGGGAGAGGGGAGGAGGGGAGG + Intergenic
1063049446 10:2430861-2430883 CGGAGGGAAGGGAGGGAGGGAGG + Intergenic
1063343371 10:5289604-5289626 ATCAGTGGGTGGAGGGTGGGAGG + Intergenic
1063350813 10:5352937-5352959 CTGTGTGTGGGGAGGATGGAGGG - Intergenic
1063686703 10:8243566-8243588 CTGCCTGAGGCTAGGGTGGGTGG - Intergenic
1063957987 10:11283609-11283631 CTGAATGATGGATGGGTGGGTGG + Intronic
1064503990 10:16009627-16009649 TTGAGGGTGGGGAGGGTGGGAGG + Intergenic
1064724284 10:18261660-18261682 TTGAATGATGGGATGGTGGGGGG + Intronic
1064917288 10:20474088-20474110 TTCAGAGAGGGAAGGGTGGGAGG + Intergenic
1064978935 10:21147199-21147221 CTCAGAGAGGGGAGTGTGTGTGG - Intronic
1065288815 10:24210075-24210097 CTGAGGGAGGGTGGGGCGGGTGG - Intronic
1065323195 10:24527845-24527867 CTCAGAGGGTGGAGGGTGGGAGG - Intronic
1065430205 10:25646213-25646235 CTTTGAGAGGCGAGGGTGGGAGG - Intergenic
1065472196 10:26093931-26093953 CTGAGTGAAGAGAGAGTCGGGGG - Intronic
1066004524 10:31134230-31134252 CTGCGTGGAGGGGGGGTGGGGGG + Intergenic
1066370562 10:34815321-34815343 CTGGGGGAGGGGACGGCGGGAGG + Exonic
1066934291 10:41805979-41806001 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
1067472774 10:46548496-46548518 CTGAGGAAGGGGAGAATGGGTGG - Intergenic
1067570503 10:47368021-47368043 CCCAGGGAGGTGAGGGTGGGTGG + Exonic
1067726272 10:48773679-48773701 CAGGATGATGGGAGGGTGGGCGG + Intronic
1068405619 10:56585144-56585166 CTGAGAAGGGGGAGAGTGGGAGG - Intergenic
1069224748 10:65929017-65929039 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1069388876 10:67911606-67911628 GGGAGGGAGGGGAGGGGGGGAGG - Intronic
1069637758 10:69936058-69936080 GGGAGTGAGGGAAGGGAGGGAGG + Intronic
1069637760 10:69936062-69936084 GTGAGGGAAGGGAGGGAGGGAGG + Intronic
1069778709 10:70941682-70941704 CTGTGTGAGGGGTGGGGAGGAGG + Intergenic
1069798797 10:71069756-71069778 CTACGTGATGGGAGGGAGGGCGG - Intergenic
1069867844 10:71514639-71514661 CTTAGTGAGGGGAGTGGGGTGGG - Intronic
1069941929 10:71962534-71962556 CATAGTGAATGGAGGGTGGGGGG + Intergenic
1069957490 10:72060965-72060987 CTGGGTGAGTGGTGGGTGTGGGG - Exonic
1070645701 10:78200796-78200818 CTACGTGAAGGGAGGCTGGGAGG - Intergenic
1070793475 10:79203436-79203458 CTGAGTGGGAGGAGGGAGTGTGG - Intronic
1070959721 10:80490158-80490180 CAGAGTGAGGGGATGGATGGTGG + Intronic
1071144431 10:82550966-82550988 TTGGGGGAGGGGAGGGTGTGGGG - Intronic
1071505713 10:86230229-86230251 CTGGGTTGGGGTAGGGTGGGTGG - Intronic
1071601576 10:86961127-86961149 CTGCGTTAGGAGTGGGTGGGTGG + Intronic
1071939550 10:90573585-90573607 CTGACAGAGGGGTGGGTGTGGGG + Intergenic
1072211839 10:93253259-93253281 CGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1072425261 10:95324666-95324688 GGCAGTGAGTGGAGGGTGGGTGG - Intronic
1072571242 10:96659057-96659079 CTGAGTGAGGGTTGCTTGGGTGG - Intronic
1072719191 10:97770533-97770555 GGGACTGAGGGGTGGGTGGGAGG + Intronic
1072731712 10:97850653-97850675 GTGTGTGAGGGGAGGGAAGGCGG + Intronic
1072751034 10:97979004-97979026 CTGAGTGAGGAGATGGGGGCAGG + Intronic
1072802781 10:98404992-98405014 GTGAGGGAGGGGAGGGAGGATGG + Intronic
1073025780 10:100486427-100486449 CTGGGTGTGTTGAGGGTGGGGGG - Intergenic
1073104955 10:101027257-101027279 GTGAGGGAGGGGAGGGTGGAGGG - Intronic
1073104957 10:101027261-101027283 CTCAGTGAGGGAGGGGAGGGTGG - Intronic
1073119173 10:101111192-101111214 CTGGGAGTGGGGTGGGTGGGAGG - Intronic
1073119689 10:101113931-101113953 GGGAGGGAGGGGAGGGAGGGAGG + Intronic
1073164159 10:101429502-101429524 GGGAGGGAGGGGAGGGGGGGAGG - Intronic
1073185511 10:101613142-101613164 CCGGGTGGGGTGAGGGTGGGGGG - Intronic
1073442100 10:103558249-103558271 GTGAGTGAGGGGAGGGTGACAGG + Intronic
1073451153 10:103610141-103610163 CAGAGTGAGTGAGGGGTGGGAGG + Intronic
1073563246 10:104514931-104514953 CAGACTGGGGGCAGGGTGGGGGG - Intergenic
1073824322 10:107303163-107303185 GTGACTGATGGGATGGTGGGTGG + Intergenic
1074109129 10:110410199-110410221 GTGAGGTAGGGGTGGGTGGGAGG + Intergenic
1074328629 10:112479652-112479674 ATGAGTTACGGGAAGGTGGGGGG - Intronic
1074372729 10:112913366-112913388 GTGTGTGAGGGGTGGGTGTGTGG + Intergenic
1074382128 10:112989906-112989928 TGGGGTGAGGGGAGGGTGGTGGG + Intronic
1074399312 10:113128749-113128771 ATGAAGGAGGGGAGTGTGGGAGG - Intronic
1074627721 10:115211753-115211775 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1074856401 10:117477189-117477211 CAGAGTGAGGAGAGGCTAGGAGG + Intergenic
1074874728 10:117604790-117604812 TGGAGAGAGGGGAGGGTGCGTGG + Intergenic
1075367985 10:121909801-121909823 CTTTGGGAGGCGAGGGTGGGAGG + Intronic
1075382402 10:122029912-122029934 CAGGGGGTGGGGAGGGTGGGAGG + Intronic
1075489977 10:122858403-122858425 TTGGGTGAGGGGAGGGGGGAGGG + Intronic
1075618061 10:123905784-123905806 CTGGGTGAGGGTGGGGTGGGAGG - Intronic
1075953428 10:126501905-126501927 CTCAGAAAGGGGAGGGTGAGAGG + Intronic
1076278195 10:129223882-129223904 ATGAGTGACGGGTGGGTGAGTGG + Intergenic
1076278211 10:129223953-129223975 ATGAGTGACGGGTGGGTGAGTGG + Intergenic
1076292535 10:129358152-129358174 GTGTGTGTGGGGGGGGTGGGGGG + Intergenic
1076355710 10:129851345-129851367 CTGACAGATGTGAGGGTGGGGGG - Intronic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076522140 10:131087917-131087939 AGGAGCGAGGGGAGGGTGGCAGG + Intergenic
1076527825 10:131123506-131123528 GGCAGTGAGGGGAGGGTGTGGGG + Intronic
1076603315 10:131673493-131673515 CTTAGAGAGGGGAGAGAGGGAGG - Intergenic
1076682497 10:132180412-132180434 CCCAGAAAGGGGAGGGTGGGTGG + Intronic
1076731535 10:132441408-132441430 GTGAGTGCGGGGAGGTCGGGTGG - Intergenic
1076734014 10:132450788-132450810 CTTCGTGAAGGGAGAGTGGGGGG + Intergenic
1076736727 10:132462338-132462360 CTGAGGAGGGGGCGGGTGGGGGG + Intergenic
1076807559 10:132866633-132866655 CTTAGCGAGGAGAGGCTGGGGGG - Intronic
1076996873 11:301662-301684 CTGGGGGTGGGGGGGGTGGGGGG + Intergenic
1077039751 11:514613-514635 TTGAGGGAGGGTAGGGTGGTGGG + Intergenic
1077093658 11:790354-790376 GTGGGTGAGGGGTCGGTGGGTGG + Intergenic
1077104688 11:837094-837116 CGGCATGAGGGGAGGTTGGGTGG - Intronic
1077118849 11:897667-897689 CTGTGTGAAGGGAGGCTGGGAGG - Intronic
1077177732 11:1198211-1198233 GAGGGTGAGGGGAGAGTGGGCGG + Intronic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1077317438 11:1925687-1925709 CAGAGTGAGGGGAGAGAAGGCGG + Intronic
1077322416 11:1948188-1948210 GGGAGAGAGGGGAGGGTGGCAGG + Intronic
1077533146 11:3106663-3106685 GTGAGTGACGGGAGGGAGGATGG - Intronic
1077539932 11:3141784-3141806 CTGGGTGGGAGGCGGGTGGGGGG - Intronic
1077629906 11:3804347-3804369 ATGAGTGAGCTGGGGGTGGGTGG + Intronic
1077664823 11:4098373-4098395 GAGAGGGAGGGGAGGGAGGGAGG - Intronic
1078527321 11:12110749-12110771 CTCAGGGTGGGGAGGGCGGGCGG + Intronic
1079006502 11:16794855-16794877 CTGATTGGGGGCAGGGTGGTGGG - Intronic
1079104922 11:17564437-17564459 CTGGGTAAGGAGAGGGAGGGAGG + Intronic
1079140077 11:17802745-17802767 CTGATTGAAGGGAGGGAGGGAGG - Intronic
1079165575 11:18038902-18038924 CTGGGAGAGGGAAGGGAGGGAGG + Intronic
1079650581 11:22923222-22923244 TTGAGTGTTGGGGGGGTGGGTGG - Intergenic
1080034684 11:27699774-27699796 CTGACTGAGGGGAGGGTGCTGGG - Intronic
1080050235 11:27851956-27851978 AGGAGGGAGGGGAGGGAGGGAGG - Intergenic
1080587836 11:33697479-33697501 AGGAGTGAGGGGAGAGTGGTAGG - Intergenic
1080684629 11:34504851-34504873 CTGAGAAAGAGGAGGGAGGGTGG + Intronic
1080935119 11:36855101-36855123 CTATGTGCAGGGAGGGTGGGAGG + Intergenic
1081091512 11:38872755-38872777 CAGAAAGAGGGTAGGGTGGGAGG - Intergenic
1081571579 11:44294589-44294611 ATGAGTGATGGGAGGGGCGGGGG - Intronic
1081633951 11:44708265-44708287 CACAGTGAGGAGAGCGTGGGTGG - Intergenic
1081728972 11:45355264-45355286 CTGAGAAAGGAGAGGGAGGGGGG + Intergenic
1081770747 11:45649445-45649467 CTGAATGGGGGGGGGGGGGGCGG + Exonic
1081915996 11:46730532-46730554 GTGGGTGAGGGGAGAGAGGGGGG + Intronic
1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG + Intronic
1081967885 11:47180441-47180463 CTGAAGGAGGTGAGGCTGGGTGG - Exonic
1082065906 11:47900085-47900107 CTGGGTGAGTAGAGGCTGGGTGG + Intergenic
1082786948 11:57322494-57322516 CTGAGGGAGGGGAGAGAGTGGGG - Intronic
1083729435 11:64644803-64644825 CTGGGAGAGAGGAGGCTGGGAGG + Intronic
1083826449 11:65206693-65206715 CTGGGAGAGGGGAGAGTGGCAGG - Intronic
1083994097 11:66263748-66263770 GTGAGTGAGGGTTGGGTGGGAGG + Intronic
1084020208 11:66412813-66412835 CTGAGGCAGGAGAGGGTGGCGGG - Intergenic
1084030245 11:66476662-66476684 CCAAGTGAGTGGTGGGTGGGTGG + Exonic
1084033741 11:66495540-66495562 CTGGGGGCGTGGAGGGTGGGTGG + Intronic
1084068332 11:66718369-66718391 CTGGGTGTGGGGAGAGTGGCCGG - Intronic
1084162709 11:67358646-67358668 CTGAGTGAGTAGGGGGCGGGTGG - Intronic
1084166961 11:67379578-67379600 CTGAGTGACGGGTGTGTGGAGGG + Intronic
1084178802 11:67436639-67436661 CCGGGGGAGGGGAGGATGGGAGG - Intronic
1084403002 11:68955976-68955998 CAGGGTGGGGGTAGGGTGGGGGG + Intergenic
1084537278 11:69764560-69764582 CTGGGGGAGGGGTGGGTGGGGGG + Intergenic
1084596245 11:70118653-70118675 ATGATTGATGGGTGGGTGGGTGG + Intronic
1084690984 11:70726457-70726479 CTGAGTCTGGTGTGGGTGGGTGG + Intronic
1084793247 11:71488385-71488407 CTGCGGGAGGCGAGGGTGGGTGG + Intronic
1084861034 11:72018344-72018366 CTGGGTGAGGGGAGGGGCTGGGG + Intronic
1085020000 11:73200584-73200606 CTGAGTGGGAGCAGGGTGGCTGG + Intergenic
1085068188 11:73517387-73517409 CTGCATGAGGGGAAGGGGGGTGG - Intronic
1085173611 11:74468201-74468223 TTGAGTGAGGGCATGGTGGTGGG - Intergenic
1085465556 11:76721154-76721176 CGGAGTGGGGGCGGGGTGGGTGG - Intergenic
1085619956 11:78030605-78030627 GTGAGTGAGGGGAGGGCAGAAGG - Intronic
1085622787 11:78050039-78050061 TTGAGTGAGGGATGGATGGGGGG + Intronic
1085699914 11:78736660-78736682 GTGAGTTAAGGAAGGGTGGGAGG + Intronic
1086051082 11:82591193-82591215 CAGAATGGTGGGAGGGTGGGAGG - Intergenic
1086107082 11:83157745-83157767 CTGAGTTGGAGGGGGGTGGGGGG - Intronic
1087158360 11:94925990-94926012 CTAAGTGTGGGGAAGGTAGGAGG + Intergenic
1087458192 11:98414121-98414143 GTGAGGGGGTGGAGGGTGGGGGG - Intergenic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1088803909 11:113333267-113333289 CTGAGTGAGGAGAGTATAGGGGG - Intronic
1088871835 11:113896980-113897002 CTGAGTGGGGAGAGGGTGAACGG - Intergenic
1088920598 11:114257708-114257730 CTGAGGGAGGGGAGGGGAGCTGG - Intergenic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089379037 11:118014664-118014686 CTGGGTGAGGTGGGGGTTGGGGG - Intergenic
1089447539 11:118565502-118565524 CTGAGGCGGGGTAGGGTGGGAGG + Intronic
1089455026 11:118621147-118621169 CTGAGTGAAGGAAAGGTGAGAGG - Intronic
1089563391 11:119357127-119357149 AGGAGTGGGGGGAGAGTGGGTGG + Intronic
1089632727 11:119793701-119793723 CTGAGTGGGGTGAGTGTGTGGGG + Intergenic
1089639651 11:119839322-119839344 GGGAGTGAGGTGGGGGTGGGAGG - Intergenic
1089697486 11:120225112-120225134 CGGGGTGAGGGCAGAGTGGGAGG - Intronic
1090044232 11:123316882-123316904 GAGAGGGAGGGGAGGGAGGGAGG + Intergenic
1090181492 11:124704128-124704150 CTGTGTGAGTGGAGGCTGGGTGG - Intergenic
1090183130 11:124718264-124718286 CCGACTGCGGGGAGGGAGGGTGG + Intergenic
1090187201 11:124746331-124746353 CTGAAAGGGGGAAGGGTGGGGGG + Intronic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1090660498 11:128878695-128878717 ATGACTGAGGGGGTGGTGGGTGG - Intergenic
1202805434 11_KI270721v1_random:3501-3523 GGGAGAGAGGGGAGGGTGGCAGG + Intergenic
1091667577 12:2430540-2430562 CTGAGTCAGGGGTGGGCAGGTGG - Intronic
1091816963 12:3446065-3446087 CTGAGGGTGGGGAGGGGGAGTGG - Intronic
1092199357 12:6570512-6570534 CTGGGGGAGGGGAGGGAGTGAGG - Exonic
1092231222 12:6776586-6776608 GTGAGAGATGGGTGGGTGGGAGG - Intronic
1092880696 12:12885675-12885697 CTGGGTGTGGGGCGGGGGGGCGG + Intergenic
1093879916 12:24392592-24392614 CAGGGTGAGGGTAGGGTTGGGGG - Intergenic
1094231417 12:28108445-28108467 CTGAAAGAGAGGAGGATGGGAGG + Intergenic
1094283652 12:28768317-28768339 TTGAGTGTAGGGAGGTTGGGAGG + Intergenic
1094292155 12:28863623-28863645 AGGAGGGAGGGGAGGGAGGGAGG - Intergenic
1094719786 12:33052403-33052425 CTCAGGGAGGGGACGGAGGGGGG - Intergenic
1095500289 12:42830166-42830188 GTGTGTCAGGGGTGGGTGGGTGG + Intergenic
1095811770 12:46379615-46379637 CTGAGGGAGTGGAGGGGAGGAGG - Intergenic
1095943710 12:47741625-47741647 CTGGGTGGGGGAAGGGAGGGAGG + Intronic
1096106776 12:49000612-49000634 CAGAGAGAGGGGAGAGTGTGTGG + Intergenic
1096109490 12:49020574-49020596 GTCAGCGCGGGGAGGGTGGGGGG - Exonic
1096124593 12:49110217-49110239 CTGGGTGAGGGGTGGGAGGGAGG + Intronic
1096189214 12:49604261-49604283 CTCTGGGAGGGGAGTGTGGGTGG - Intronic
1096418013 12:51430483-51430505 ATGTGTGAGGAGAGGGTGGAGGG - Intronic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1096799974 12:54104024-54104046 CTATGTGGGGGGAGGCTGGGAGG - Intergenic
1096861591 12:54532639-54532661 CTGAGGGCAGGCAGGGTGGGTGG - Intronic
1096989049 12:55783566-55783588 ATGATTTAGGGGAGGCTGGGGGG + Intronic
1097096817 12:56555821-56555843 CTGAGTGAGGGGACTGTTTGAGG - Intronic
1097195808 12:57241963-57241985 CTCAGTGAGGCTAGGGAGGGGGG + Intergenic
1097223416 12:57463191-57463213 CTGAGTGAGGGGAGGGGTAAGGG - Intronic
1097477219 12:60073127-60073149 TTGAGTGAGGGGAGAGGAGGAGG - Intergenic
1097537679 12:60894187-60894209 CTGAGGGAGAGGAGAATGGGAGG - Intergenic
1098532449 12:71556166-71556188 CTCAGAGGGTGGAGGGTGGGAGG + Intronic
1098551734 12:71770075-71770097 CAGAGAGAGGACAGGGTGGGTGG + Intronic
1098716119 12:73830074-73830096 CTGAGGGAGAGAAGGGAGGGTGG - Intergenic
1098731083 12:74037613-74037635 CTGGGGGAGAGAAGGGTGGGTGG - Intergenic
1098791800 12:74833574-74833596 CTGAGGAATGGGGGGGTGGGAGG + Intergenic
1098917866 12:76275899-76275921 CAGAGAGAGGGGAGGGAGGAAGG + Intergenic
1099212416 12:79808248-79808270 CAGAGTAAGGGGAAAGTGGGAGG - Intronic
1099782481 12:87215314-87215336 CTGAGTTAAGTGAGGGTGGGAGG - Intergenic
1099865670 12:88277831-88277853 CTGGGTGGGGGGAGTGTGGAGGG - Intergenic
1100039780 12:90301371-90301393 TTGAGAAAGTGGAGGGTGGGAGG - Intergenic
1100048497 12:90413780-90413802 CTGAGTTGGAGGAGGGTTGGTGG - Intergenic
1100913621 12:99392828-99392850 GTGAGGGAGGGTAGGGTGGGAGG - Intronic
1101103130 12:101414202-101414224 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
1101227988 12:102708917-102708939 CTGAGTTGGGGCAGGGTAGGGGG + Intergenic
1101565753 12:105903274-105903296 CTGAGAGAGGAGAGGGTGATGGG - Intergenic
1101711930 12:107275714-107275736 CTGAGAGAGGGGAGTGGGGGCGG + Intergenic
1101801007 12:108021932-108021954 ATGAGTGAGTGGATGATGGGCGG - Intergenic
1102022185 12:109691425-109691447 CTGAGGGGGGGGGGGGGGGGTGG - Intergenic
1102192459 12:110999016-110999038 CTGATTTAGGAGAGGCTGGGAGG + Intergenic
1102236525 12:111297495-111297517 CTGAGTGAGGGGCTGCTTGGTGG + Intronic
1102243346 12:111339354-111339376 CTGAGGCAGAGGAGGGAGGGAGG - Intronic
1102422842 12:112817565-112817587 CTGCGTGTGCGGGGGGTGGGGGG - Intronic
1102557276 12:113735484-113735506 CTGAAGGAGGTCAGGGTGGGGGG - Intergenic
1102561044 12:113762530-113762552 CTGGGGGTGGGGAGGGAGGGGGG - Intergenic
1102596141 12:113993906-113993928 CTGAGTAGGGGGTGGGAGGGAGG - Intergenic
1102664013 12:114554537-114554559 CTGAGTGATGGGGGGGTGTTAGG - Intergenic
1102666669 12:114580072-114580094 CTGTGGGAGGCGAAGGTGGGGGG + Intergenic
1102887730 12:116534226-116534248 TGGAGTGGGGGGAGGGGGGGAGG + Intergenic
1102959695 12:117084709-117084731 CTGAGTCAGGGGAGGGAGGCTGG - Intronic
1102983723 12:117262448-117262470 CAGAGAGAGGAGAGGGAGGGAGG + Intronic
1103023466 12:117555100-117555122 CTGGGTGAGGGGTAGGAGGGAGG - Intronic
1103123369 12:118399574-118399596 TTGAGGGAGGGGAGGATGGATGG + Intronic
1103245784 12:119455956-119455978 AGGAGGGAGGGGAGGGAGGGAGG + Intronic
1103261576 12:119593614-119593636 AGGAGTGAGGGGAGGCGGGGAGG - Exonic
1103606140 12:122087388-122087410 CTGGGGCTGGGGAGGGTGGGTGG + Intronic
1103685739 12:122730650-122730672 CTGAGAGGCGGTAGGGTGGGGGG + Exonic
1103698395 12:122835177-122835199 GTGAGTGAGGTGGGGGTTGGAGG + Intronic
1103766505 12:123283967-123283989 CTGTGGGAGGGCAAGGTGGGTGG - Intergenic
1103936679 12:124480927-124480949 ATGGGTGAGGGGCGGCTGGGAGG + Intronic
1104147641 12:126050833-126050855 GTGAGTGAAGGGTGAGTGGGAGG - Intergenic
1104147643 12:126050837-126050859 CTGGGTGAGTGAAGGGTGAGTGG - Intergenic
1104439255 12:128781676-128781698 GTGAATGAGGGGAGGGTGTCTGG + Intergenic
1104467830 12:129004949-129004971 CTGAGAGAGGAGCGGGTTGGAGG + Intergenic
1104467903 12:129005239-129005261 CTGAGAGAGGAGCGGGTTGGAGG + Intergenic
1104638668 12:130453402-130453424 CTGAGAGAGAGGATGGTGGAAGG - Intronic
1104892867 12:132148741-132148763 GGGGGTGAGGGGCGGGTGGGCGG - Intronic
1104925951 12:132313970-132313992 GTGGGTGATGGGTGGGTGGGTGG - Intronic
1104933753 12:132353775-132353797 TTCAGTGAGGGGATGGTGGCAGG - Intergenic
1105396149 13:20037942-20037964 ATGAAAGAGTGGAGGGTGGGAGG - Intronic
1105405127 13:20127371-20127393 GTGAGGGTGAGGAGGGTGGGGGG - Intergenic
1105446473 13:20461900-20461922 TTGTGGGAGGAGAGGGTGGGAGG + Intronic
1105532066 13:21229301-21229323 GTGAGTGTGGGGGGGGTGGGAGG - Intergenic
1105621673 13:22073605-22073627 GTGACTGATGGGTGGGTGGGTGG + Intergenic
1105623606 13:22092168-22092190 ATGAGTGAGGGCAGGGTTAGAGG + Intergenic
1105879321 13:24590103-24590125 CGGAGTGAGGAGGGGGTGGCAGG - Intergenic
1105932599 13:25067082-25067104 CTTAGCCAGGGTAGGGTGGGGGG - Intergenic
1105951071 13:25229899-25229921 CCGAGTGAGGTGAGGGGGTGTGG + Intergenic
1106020448 13:25909796-25909818 CTGAGTTGGGGGAGGGCGGCGGG - Intronic
1106142131 13:27020309-27020331 CTGAGTGAGGCCAGAGTGGAGGG + Intergenic
1106568819 13:30908677-30908699 GGGAGGGAGGGGAGGGAGGGAGG - Intronic
1106813239 13:33380472-33380494 TTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1107095417 13:36530296-36530318 ATCAGTGAGGGCAGGGAGGGAGG + Intergenic
1107628170 13:42312588-42312610 ATGGGTGAGGGGATGTTGGGGGG - Intronic
1107989589 13:45806562-45806584 ATGAGAGTGGGGAGGGTGGAAGG + Intronic
1108445317 13:50503179-50503201 TGGAGTGGGGGGAGGGGGGGAGG - Intronic
1108626049 13:52229780-52229802 CTGAGTTAGAGGAAGGTGTGTGG + Intergenic
1108660014 13:52576699-52576721 CTGAGTTAGAGGAAGGTGTGTGG - Intergenic
1109014533 13:56992796-56992818 GTGGGTGGGGGGAGGGGGGGAGG - Intergenic
1109763336 13:66860333-66860355 CTGGGGGAGGGGAGGGGTGGTGG + Intronic
1110115946 13:71816904-71816926 TTTAGTGGGTGGAGGGTGGGAGG + Intronic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1110705180 13:78596410-78596432 CTGAGTGAGTGAGGGGAGGGCGG + Intergenic
1111157008 13:84340967-84340989 ATCAGAGAGTGGAGGGTGGGAGG - Intergenic
1111262957 13:85766750-85766772 CTGAGTTTGGGTAGGGAGGGAGG + Intergenic
1111926154 13:94464997-94465019 GAGGGTGAGGGGAGTGTGGGAGG - Intronic
1112157453 13:96833199-96833221 CTGAGAGAGGAGAGGGCAGGAGG - Exonic
1112251135 13:97781722-97781744 CTGGGTCAGGGGAGGATGGAAGG + Intergenic
1112441375 13:99426991-99427013 AGGAGAGAGGGGAGGGTGGAAGG + Intergenic
1112441425 13:99427110-99427132 GGGAGGGAGGGCAGGGTGGGAGG + Intergenic
1112441461 13:99427217-99427239 AGGATGGAGGGGAGGGTGGGGGG + Intergenic
1112539873 13:100298597-100298619 GGGAGGGAGGGGAGGGAGGGAGG - Intronic
1112539884 13:100298618-100298640 GGGAGGGAGGGGAGGGAGGGAGG - Intronic
1113104434 13:106757803-106757825 GGGAGGGAGGTGAGGGTGGGTGG + Intergenic
1113149464 13:107246050-107246072 ATGAGATAGAGGAGGGTGGGCGG - Intronic
1113618007 13:111694745-111694767 CGGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113618018 13:111694804-111694826 CGGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113618064 13:111695039-111695061 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623540 13:111780006-111780028 CGGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623551 13:111780065-111780087 CGGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623597 13:111780300-111780322 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113657069 13:112073567-112073589 GTGAGAGAGGGGAGGGGGAGGGG + Intergenic
1113663054 13:112120157-112120179 AGGAATGAGGGAAGGGTGGGAGG + Intergenic
1113888670 13:113725174-113725196 CTGCGTGGGGGGCGCGTGGGAGG - Intronic
1113966349 13:114155677-114155699 CTGAGTGTGGGGGTGGAGGGTGG + Intergenic
1114155511 14:20099191-20099213 CGGGGCGGGGGGAGGGTGGGAGG + Intergenic
1114450093 14:22819683-22819705 CTGAGTCAGGGGAGAGGGGAAGG + Intronic
1114615323 14:24065122-24065144 CTGAGTCGGGGGAGGGGGTGGGG - Exonic
1115156355 14:30343998-30344020 CTGAGAGGTGGGAGGATGGGAGG - Intergenic
1115642189 14:35341884-35341906 CCCAGTGAAGGGAGGCTGGGAGG - Intergenic
1115786935 14:36837105-36837127 CAGAGTGATGGGAAGGTGTGTGG + Intronic
1116029181 14:39550342-39550364 CGGGGTGAGGGGAGGGAGGATGG - Intergenic
1116036462 14:39633679-39633701 TGGAGTGAGGGGAGGGGGGAGGG - Intergenic
1116167581 14:41352699-41352721 CAGAGTCTGGGGAGGGTAGGGGG - Intergenic
1116718251 14:48455831-48455853 CTGTGTGTGGGGATGGGGGGTGG + Intergenic
1116962805 14:50983993-50984015 CTGAGGGAGGGGAGGAGGGATGG + Intronic
1117516052 14:56502287-56502309 CTGAGTGATGGGAACCTGGGAGG - Intronic
1117997236 14:61489289-61489311 TTGAGGGAGGGGAGGGAGAGAGG + Intronic
1118365447 14:65091521-65091543 ATGAGTGAAGGGATGGTGGCAGG - Intronic
1118433560 14:65747746-65747768 CTCAGAAAGAGGAGGGTGGGAGG + Intergenic
1118435566 14:65767918-65767940 CTGAGTGGGGGATGAGTGGGGGG - Intergenic
1118441744 14:65818516-65818538 TTGTGTGTGGGGAGGGTGGGGGG - Intergenic
1119103087 14:71898288-71898310 TGGGGTGAGGGGAGGGTTGGAGG - Intergenic
1119383860 14:74245311-74245333 CCGAGAGAGGGGAGAGTGGAGGG - Intronic
1119649726 14:76375152-76375174 ATGAGTGTGGGGAGGGGGGTAGG - Intronic
1120152495 14:81052935-81052957 CTGAGGGAGGGGAGAGGGAGAGG + Intronic
1121099780 14:91242507-91242529 CTGATGGAAGGGTGGGTGGGTGG + Intronic
1121273290 14:92651883-92651905 CTGGGGGAGGGGGTGGTGGGCGG - Exonic
1121377988 14:93431164-93431186 CTGAGGTTGGGGCGGGTGGGGGG + Intronic
1121490569 14:94356090-94356112 GGGAGACAGGGGAGGGTGGGTGG - Intergenic
1121676729 14:95759579-95759601 CAGAGTGAGAGGAGAGAGGGGGG - Intergenic
1121739864 14:96243725-96243747 CTGAGGCAGAGGAGAGTGGGTGG - Exonic
1121781562 14:96625373-96625395 GTGTGTGAGGGGAGGATGAGGGG - Intergenic
1121936705 14:98026308-98026330 ATGAGTGAGTGGATGGTGGGTGG + Intergenic
1122129610 14:99597504-99597526 CTGTGTCAGGGGAGGTTGCGTGG - Intronic
1122271350 14:100569630-100569652 CTGAGCCAGCGCAGGGTGGGAGG + Intronic
1122468699 14:101951313-101951335 CTGAATGAGGGGAGGTTTAGAGG + Intergenic
1122553183 14:102561090-102561112 CTGAGTGAGGTGAGGCAGGATGG + Intergenic
1122572749 14:102718571-102718593 ATGACTGAGGGTTGGGTGGGAGG + Intronic
1122606137 14:102948421-102948443 GGAGGTGAGGGGAGGGTGGGGGG + Intronic
1122748647 14:103916799-103916821 GTGAGTGGGTGGAGGGAGGGAGG - Intronic
1122805365 14:104253672-104253694 CTGAGGGAGTGGAGGGCTGGGGG + Intergenic
1122810168 14:104283774-104283796 CTGGGTGAGGGGAGCCGGGGTGG + Intergenic
1122903174 14:104790343-104790365 CTGGGGGTGGGGAGGGAGGGAGG - Intronic
1122931197 14:104933698-104933720 CTGAGTGAGGGAAGGGCGGGAGG + Exonic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931268 14:104933869-104933891 CTGAGTGAGGGGAGGGCGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1123020405 14:105395339-105395361 CTGAGAGTGGGGAAGGTGTGAGG - Exonic
1123503625 15:20915489-20915511 CTGAGTGTGGCGAGGGAAGGTGG - Intergenic
1123560872 15:21489163-21489185 CTGAGTGTGGCGAGGGAAGGTGG - Intergenic
1123597111 15:21926454-21926476 CTGAGTGTGGCGAGGGAAGGTGG - Intergenic
1123819160 15:24010332-24010354 TTGAGTGGGGGGAGGGGGGACGG - Intergenic
1124645739 15:31436555-31436577 ATGAGTGAGGCAAGGGTGGGTGG + Intergenic
1124682083 15:31740415-31740437 CTCAGTGAGCAGATGGTGGGGGG + Intronic
1124759356 15:32437243-32437265 CTGAGTGAGAAAAGGGTGGTGGG + Intergenic
1124875108 15:33584772-33584794 GTGGGTGAGGTGGGGGTGGGGGG - Intronic
1125033252 15:35093763-35093785 CTGAGTGGTGGGAGGGTGGGAGG + Intergenic
1125128645 15:36255044-36255066 CAGAGAGTGGGGAAGGTGGGGGG - Intergenic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125447757 15:39776166-39776188 CAGAGGGAGGGGAGGGGCGGAGG + Intronic
1125585367 15:40815807-40815829 ATTAGGGAGGGCAGGGTGGGGGG - Intronic
1125672055 15:41480871-41480893 CTGGGGGAGGGGAGGCTGGTGGG - Exonic
1125694273 15:41622030-41622052 CGGGGTAGGGGGAGGGTGGGGGG + Intronic
1125718774 15:41835220-41835242 CTGGGTGAGTGGAGGTGGGGTGG + Exonic
1126173380 15:45713077-45713099 GGGAGGGAGGGGAGGGAGGGAGG - Intergenic
1126506824 15:49414392-49414414 GTGTGTGGGGGGAGGGAGGGGGG + Intronic
1127229495 15:56973170-56973192 CTGACAGATGGGAGGGAGGGAGG - Intronic
1127304144 15:57685506-57685528 GTGTGTCGGGGGAGGGTGGGGGG + Intronic
1127806021 15:62521277-62521299 CTGGGTGCCGTGAGGGTGGGGGG + Intronic
1127903367 15:63357819-63357841 CTGAGAGCAGGGAGAGTGGGAGG - Intronic
1127996588 15:64156476-64156498 CTGAGTGAAGGAGGGGAGGGAGG + Exonic
1128250895 15:66163707-66163729 CTGAGTTATGGGAAGGCGGGCGG + Intronic
1128332402 15:66764058-66764080 CTGAGTGAGTGGTGGGTGATTGG + Intronic
1128335279 15:66781545-66781567 CGGCGGGAGGGGCGGGTGGGAGG + Exonic
1128515505 15:68339468-68339490 CAGAGTGAGGGGAGGCTGGCGGG - Intronic
1128715967 15:69908255-69908277 ATGAGTGAGTGGGGGGTGGGTGG - Intergenic
1128929688 15:71693109-71693131 CAGGATGTGGGGAGGGTGGGGGG + Intronic
1129161810 15:73751949-73751971 CTGGCTGGGGGGAAGGTGGGGGG - Intronic
1129263506 15:74382044-74382066 CTGAGTGGGAGGAGGATTGGGGG + Intergenic
1129698399 15:77753716-77753738 CTGAGGGAGGAGAGGGCTGGAGG + Intronic
1129769495 15:78194125-78194147 CTGACTGAGGGGACCCTGGGAGG - Intronic
1129912871 15:79242589-79242611 AGGAGTGAGGGGAGGGTTGACGG + Intergenic
1129933021 15:79428176-79428198 GAGAGGGAGGGGAGGGAGGGAGG - Intergenic
1130797866 15:87229934-87229956 TGGGGTGGGGGGAGGGTGGGAGG - Intergenic
1130850543 15:87789409-87789431 GTGAGTGGGGGGAGGGGGGAGGG + Intergenic
1131039550 15:89250545-89250567 TGGAGTGAGGGGAGGGGGGAGGG + Intronic
1131084688 15:89566480-89566502 CTGAGTGAGCGGGGAGTTGGAGG - Intergenic
1131259362 15:90880591-90880613 CTGCGTGGGGGAAGGGTGTGTGG + Intronic
1131367246 15:91852090-91852112 CCGAGTGATAGGAGGGTGTGGGG + Intergenic
1131406141 15:92166542-92166564 GTGAGTGAGGGGAAGCTGGAGGG - Intronic
1131462166 15:92625149-92625171 CAGAGTTTGGGGAGGGAGGGAGG - Intronic
1131530839 15:93190438-93190460 CTGTGTGTGGGGAGGGTGAGAGG - Intergenic
1131798110 15:96041295-96041317 CTCAGAGAGTGGAGGGTGGAAGG + Intergenic
1131913176 15:97231563-97231585 GGGAGGGAGGGGAGGGAGGGAGG + Intergenic
1202969217 15_KI270727v1_random:216327-216349 CTGAGTGTGGCGAGGGAAGGTGG - Intergenic
1132530505 16:445952-445974 CTGTGTGAGGTGGGGGTAGGTGG + Intronic
1132572744 16:651134-651156 CTCGGTGGTGGGAGGGTGGGTGG + Intronic
1132583822 16:697230-697252 CTGGGTGGTGGGAGGGTGGGTGG + Exonic
1132587366 16:711458-711480 CTAAGTGGGGGGTGGCTGGGCGG - Intronic
1132625998 16:891769-891791 CTTATTGAGGGCAGGGTGGCTGG + Intronic
1132648565 16:1010222-1010244 CGGCCTGAGGGGAGTGTGGGGGG + Intergenic
1132704201 16:1235737-1235759 CTGTGGGAGGCCAGGGTGGGAGG - Intergenic
1132707317 16:1250688-1250710 CTGTGGGAGGCCAGGGTGGGAGG + Intergenic
1132724048 16:1331198-1331220 CTCAGGGTGGGGAGGGTGGGCGG + Intergenic
1132801177 16:1754528-1754550 CTGTGGGAGGCCAGGGTGGGCGG + Intronic
1133063175 16:3188557-3188579 GTGAGTGAGAGGAGGGAGGCGGG + Intergenic
1133147825 16:3803253-3803275 CTGACGGCGGGGAGGGGGGGGGG + Intronic
1133313991 16:4870777-4870799 CAGAGTGAGGGGAGAGGCGGTGG + Intronic
1133496189 16:6320082-6320104 CTGAGAGGGGGAAGGTTGGGAGG + Intronic
1133514645 16:6496714-6496736 CTGTGGGAGGCCAGGGTGGGTGG + Intronic
1133712862 16:8418217-8418239 CTACATGAGTGGAGGGTGGGAGG + Intergenic
1133853063 16:9524271-9524293 GGGAGGGAGGGGAGGGAGGGAGG - Intergenic
1134224400 16:12380380-12380402 ATGGATGAGGGGTGGGTGGGTGG - Intronic
1134224411 16:12380407-12380429 ATGGATGAGGGGTGGGTGGGTGG - Intronic
1134224675 16:12381214-12381236 ATGGATGAGGGGTGGGTGGGTGG - Intronic
1134224756 16:12381499-12381521 ATGAATGATGGGTGGGTGGGTGG - Intronic
1134224792 16:12381618-12381640 ATGAATGATGGGTGGGTGGGTGG - Intronic
1134291752 16:12907172-12907194 CGGAGGGAGGGAAGGGTGGAAGG - Intronic
1134318190 16:13139204-13139226 GGGAGTGAGGGAAGGGAGGGAGG - Intronic
1134513492 16:14867938-14867960 GCGAGTGAGGGGACAGTGGGAGG - Intronic
1134701129 16:16266433-16266455 GCGAGTGAGGGGACAGTGGGAGG - Intronic
1134803562 16:17106733-17106755 GTGAGTAGGGGGAGGATGGGAGG + Exonic
1134846335 16:17443986-17444008 TTGAGTGAGGGGAGCCTGGTGGG - Intronic
1134970699 16:18528213-18528235 GCGAGTGAGGGGACAGTGGGAGG + Intronic
1135051759 16:19198972-19198994 CTGAGTGGTCGGTGGGTGGGTGG + Intronic
1135102009 16:19614019-19614041 CTGAGTGGGTAGAGCGTGGGGGG + Intronic
1135526942 16:23220436-23220458 GTGAATGAGTGGAGGGTGAGTGG - Intergenic
1135593416 16:23722188-23722210 CTGAAACAGTGGAGGGTGGGAGG - Intergenic
1135726537 16:24858440-24858462 ATGAGTGAGTGGATGGTGGATGG + Intronic
1136221681 16:28833351-28833373 CTGAGTGAGTGGAGCGGGGTGGG + Exonic
1136553231 16:30992795-30992817 CTGGGAGAGAGAAGGGTGGGGGG + Exonic
1136607835 16:31348461-31348483 ATGGGTGATGGGAGGGTGGATGG + Intergenic
1136631824 16:31493409-31493431 CGGAGTGAGGGGAGTGTGGGTGG + Intronic
1136702233 16:32154768-32154790 CTGAGGGCGGGGGAGGTGGGCGG - Intergenic
1136765434 16:32772717-32772739 CTGAGGGCGGGGGAGGTGGGCGG + Intergenic
1136802665 16:33097662-33097684 CTGAGGGCGGGGGAGGTGGGCGG - Intergenic
1136938474 16:34498948-34498970 ATGAGAGAAGGGAGGGAGGGAGG - Intergenic
1136961345 16:34849609-34849631 ATGAGAGAAGGGAGGGAGGGAGG + Intergenic
1137000167 16:35222242-35222264 CCCAGTGTGGGCAGGGTGGGAGG - Intergenic
1137218722 16:46426809-46426831 ATGAGAGAAGGGAGGGAGGGAGG - Intergenic
1137774383 16:51043235-51043257 TTGAGACAGGGGAAGGTGGGTGG - Intergenic
1137889576 16:52144913-52144935 ATCAGGGAGTGGAGGGTGGGGGG + Intergenic
1138027574 16:53534435-53534457 GTGAGTGAGTGGAGGGGGAGGGG + Intergenic
1138281389 16:55774462-55774484 CTGACAGAGGGGACGTTGGGAGG + Intergenic
1138423169 16:56912986-56913008 GTGAGCAAGGCGAGGGTGGGAGG + Intronic
1138600597 16:58051814-58051836 GTAAGATAGGGGAGGGTGGGAGG - Intergenic
1138767319 16:59619916-59619938 CTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1138986445 16:62334555-62334577 CTTTGTGAGGCCAGGGTGGGAGG - Intergenic
1139256352 16:65546614-65546636 CATTGTGAGGGGAGGGTTGGGGG + Intergenic
1139431805 16:66914767-66914789 ATGAGTGATGGGAGGTTGGATGG + Intronic
1139755716 16:69141979-69142001 CGGGGTGAGGGGAGGGGGGAGGG - Intronic
1139782604 16:69364298-69364320 CTCAGGGAAGGGAGGGAGGGAGG - Intronic
1139919352 16:70449545-70449567 CAGTGTGAGGAGAAGGTGGGTGG + Intergenic
1140049530 16:71467955-71467977 CTCAGTGGGGGGGGGGGGGGGGG + Intronic
1140068310 16:71627760-71627782 GTGAGCTAGGGGAGGGTGGGGGG + Intronic
1140245572 16:73245057-73245079 CTCTGTGAAGGGAGGATGGGTGG + Intergenic
1140250320 16:73289320-73289342 CAGAGCAAGGGCAGGGTGGGGGG + Intergenic
1140284859 16:73592594-73592616 CTGAGGCAGGGGAGAGTAGGAGG + Intergenic
1140864923 16:79051562-79051584 CTGTGTGCTGGGTGGGTGGGAGG + Intronic
1140914644 16:79483029-79483051 TGGAGGGAGGGGAGGGAGGGAGG - Intergenic
1141155991 16:81597579-81597601 GTGAGCGAGGGGAGCGGGGGGGG + Intronic
1141178303 16:81734976-81734998 GTGGGTGAGAGAAGGGTGGGTGG + Intergenic
1141506320 16:84480805-84480827 CTGAGACAGGGGCGGGTGAGTGG + Intronic
1141524796 16:84604307-84604329 CCGTGGGAGGGGAGCGTGGGTGG - Intronic
1141651575 16:85395798-85395820 CAGAGCCTGGGGAGGGTGGGCGG - Intergenic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1141786110 16:86201880-86201902 CCGGGTGAGGAGAGGCTGGGTGG + Intergenic
1141804871 16:86335948-86335970 CAGAGGCCGGGGAGGGTGGGTGG - Intergenic
1142095607 16:88237798-88237820 CAGAGTGCAGGGAGGGTGAGTGG - Intergenic
1142152700 16:88519704-88519726 CAGATGGATGGGAGGGTGGGTGG + Intronic
1142257781 16:89023640-89023662 ATCAGTGAGGGGAGGGGAGGTGG + Intergenic
1142281036 16:89147545-89147567 CAGAGCGAGGAGGGGGTGGGAGG + Intronic
1142324013 16:89402620-89402642 TTGAGTGAGCTGTGGGTGGGGGG + Intronic
1142419932 16:89963945-89963967 CTTAGGGAGTGGAGGGCGGGGGG + Intronic
1203067822 16_KI270728v1_random:1034939-1034961 CTGAGGGCGGGGGAGGTGGGCGG + Intergenic
1142478573 17:204438-204460 CTGGGTGGGGGAAGGGTGAGTGG - Intergenic
1142606377 17:1083649-1083671 CAGAGGGAGAGGAGGGTGGGAGG + Intronic
1142785159 17:2215836-2215858 ATGAGGGAGGGGAGTGAGGGTGG + Intronic
1142889852 17:2936248-2936270 CTGGGTGGGGGGAGGGGGGAGGG - Intronic
1143021260 17:3918144-3918166 GAGAGGGAGGGGAGGGAGGGAGG + Intergenic
1143021267 17:3918157-3918179 GGGAGGGAGGGGAGGGAGGGAGG + Intergenic
1143028370 17:3953895-3953917 CTGAGTCGGGGGAGGGTAGAGGG - Intronic
1143341399 17:6214066-6214088 CTGAGAGGTAGGAGGGTGGGGGG + Intergenic
1143382144 17:6503234-6503256 CAGAGTGAGGGGTGGGAGGCTGG - Intronic
1143571498 17:7761726-7761748 CTGAGGGAGGCTAAGGTGGGTGG - Intronic
1144063188 17:11601347-11601369 AGGAGGGAAGGGAGGGTGGGAGG + Intronic
1144063234 17:11601726-11601748 CTGAGAGAGAGGAGAGGGGGTGG - Intronic
1144078128 17:11737322-11737344 CGGTGGGAGGGGTGGGTGGGGGG - Intronic
1144576377 17:16432323-16432345 CTGAGTGTGGGGTGGGGTGGGGG - Intronic
1144758860 17:17695763-17695785 CTTAGGGAGGCGAAGGTGGGAGG - Intronic
1144956213 17:19020123-19020145 ATGAGTGAGGATAGGGTTGGGGG - Intronic
1145407274 17:22614754-22614776 CTGGGAGTGTGGAGGGTGGGAGG + Intergenic
1145792578 17:27637216-27637238 CTGAGAGAGATGAAGGTGGGGGG + Intronic
1146184720 17:30717366-30717388 CTGTGTGTGGGGAGGGTTGCTGG - Intergenic
1146196007 17:30813748-30813770 CTGGGTGTGGGGAGGGGGGAGGG - Intronic
1146299500 17:31677233-31677255 CTCAGTGAGGGGGGCGTGGTAGG - Intergenic
1146314989 17:31799777-31799799 CTGGGTGTGGTGGGGGTGGGGGG + Intergenic
1146571053 17:33953737-33953759 CTGAATGAGGGGAGTGTTGTGGG + Intronic
1146693250 17:34891036-34891058 TGGAGCAAGGGGAGGGTGGGGGG - Intergenic
1146726918 17:35163926-35163948 CTGAGTGAGGGGTGTGTGTGAGG + Intronic
1146739579 17:35270771-35270793 CTGGGGTAGGGGAGGGAGGGTGG - Exonic
1147187449 17:38720329-38720351 CTGAGGGAGGGGCGAGGGGGCGG - Intronic
1147262031 17:39214378-39214400 CAGAGCGAGTGGAGAGTGGGGGG - Intronic
1147403697 17:40195697-40195719 CTGAGGGAGGGGAGAGGGGATGG + Intergenic
1147436838 17:40421572-40421594 CAGAGTGGGGGCAGGGTGGGTGG - Intergenic
1147459808 17:40560985-40561007 ATGAGTCAGTGGAGGGCGGGTGG - Intronic
1147590483 17:41680029-41680051 GGGAGGGAGGGGAGGGAGGGAGG + Intergenic
1147764957 17:42828287-42828309 GTAAGTGGGGGCAGGGTGGGAGG + Intronic
1147869648 17:43578358-43578380 CTCAGTGAGGGCTGGGAGGGAGG + Intronic
1147879342 17:43643877-43643899 TGGGGTGGGGGGAGGGTGGGAGG - Intronic
1148149807 17:45389854-45389876 TTGAGAGAGGGAAGGCTGGGAGG + Intergenic
1148155771 17:45424658-45424680 GGGAGTGGGGGAAGGGTGGGAGG + Intronic
1148193514 17:45697068-45697090 GGGAGGGAGGGGAGGGGGGGAGG + Intergenic
1148243485 17:46014965-46014987 GGTAGTGAGGGGATGGTGGGGGG + Intronic
1148348185 17:46918319-46918341 CTTAGTGAGGCCAAGGTGGGCGG - Intergenic
1148350454 17:46938104-46938126 CTCTGGGAGGGGTGGGTGGGAGG - Intronic
1148370409 17:47095422-47095444 GGGAGTGAAGGGAGGGAGGGAGG + Intergenic
1148458989 17:47826980-47827002 CTGAGTCTGGTGGGGGTGGGGGG + Intronic
1148460954 17:47838720-47838742 CTGTGGGAGGGGAGAGTGGCTGG + Intronic
1148496879 17:48058377-48058399 CTGATTGATGGGAGTGTTGGGGG - Exonic
1148509115 17:48153786-48153808 CTGAGTGGGGGATGGGTGGGGGG - Intronic
1148590377 17:48812066-48812088 CTGAGCGGGGGGTGGGGGGGGGG - Intronic
1148652730 17:49261193-49261215 ATGTGTGTGGGGAGTGTGGGTGG - Intergenic
1148751668 17:49948890-49948912 CTGAGGGAGGAGTGGGAGGGAGG + Intergenic
1148806103 17:50264725-50264747 CACAGGGAGGGGAGGGTGGAGGG + Intergenic
1148876485 17:50690334-50690356 CGGCGGGAGGGGAGGGGGGGCGG + Intronic
1149515813 17:57280125-57280147 CTGAGGGAAGAGAGGGTGGCTGG + Intronic
1150373250 17:64660385-64660407 CTGAATGAGGGGGGAGGGGGTGG + Intronic
1150387461 17:64773325-64773347 GGGAGTGGGGGAAGGGTGGGAGG + Intergenic
1150642599 17:66959738-66959760 CTGATGGAGGGGAGGCTGGTAGG + Intergenic
1151028578 17:70708166-70708188 ATCAGAGAGTGGAGGGTGGGAGG + Intergenic
1151162303 17:72175845-72175867 CTAAGTGAGGCGAGGTTGGGGGG - Intergenic
1151205397 17:72502658-72502680 CTAAGTCAGGGTGGGGTGGGGGG + Intergenic
1151221308 17:72615146-72615168 CAGGGTGATGGGAGGGAGGGAGG - Intergenic
1151406920 17:73893939-73893961 CTGATTGCCTGGAGGGTGGGTGG - Intergenic
1151658786 17:75508012-75508034 CTGAGTGAGGGGAGGGGCCCTGG - Intronic
1151797060 17:76353515-76353537 CAGAGTAAGGGGGCGGTGGGAGG - Exonic
1151882928 17:76905675-76905697 CTGGGTGGAGGGAGGGAGGGAGG - Intronic
1151898091 17:76993957-76993979 CTGGGGGAGGGTGGGGTGGGAGG - Intergenic
1152016509 17:77754408-77754430 CTGACTTAGGGGAGGGTCTGAGG - Intergenic
1152033563 17:77858280-77858302 TTGGATGAGGGGTGGGTGGGTGG - Intergenic
1152034066 17:77861206-77861228 GTGAATGAGTGGAGGATGGGTGG + Intergenic
1152226045 17:79093269-79093291 CTGGGTGGTGGGAGGGTGGGAGG - Intronic
1152256751 17:79244479-79244501 CTGAAGGTGGGGAGGGTGGGTGG - Intronic
1152314617 17:79572870-79572892 CTGCATGGGGTGAGGGTGGGTGG - Intergenic
1152435645 17:80274593-80274615 GTGAGTGGGGTGAGTGTGGGGGG + Intronic
1152435667 17:80274657-80274679 GTGAGTGGGGTGAGTGTGGGGGG + Intronic
1152435685 17:80274701-80274723 GTGAGTGGGGTGAGTGTGGGGGG + Intronic
1152491887 17:80640601-80640623 CTGAGTCAGGGCAGGGAGAGTGG + Intronic
1152527271 17:80895515-80895537 CTGGGTGTGGACAGGGTGGGAGG - Intronic
1152700705 17:81817553-81817575 CTGAGTGAGTGCAGGGTGTCTGG - Intergenic
1152743820 17:82030277-82030299 GGGAGTGAGGCGAGGGTTGGGGG - Intronic
1152775591 17:82199767-82199789 CTGAGTGGAGGGAGGGTGTCTGG - Intronic
1152797176 17:82314206-82314228 GTGAGTGAGGGGCAGGTGTGAGG + Intergenic
1153475522 18:5494651-5494673 TTGGGTGGGGGGAGGGTGGATGG - Intronic
1153540225 18:6146080-6146102 CTGGGTGAGGGGAAGGGTGGCGG + Intronic
1153598009 18:6748561-6748583 CTGATGGAGGAGAGGCTGGGAGG + Intronic
1153647187 18:7205890-7205912 GGGAGGGAGGGGAGGGAGGGAGG - Intergenic
1154216671 18:12420793-12420815 CGGGGTGGGGGGACGGTGGGGGG + Intronic
1155085118 18:22451160-22451182 TTCAGAGGGGGGAGGGTGGGAGG + Intergenic
1155195389 18:23469366-23469388 GGGAGGGAGGGGAGGGAGGGAGG - Intronic
1155259708 18:24029653-24029675 CTCAGCGGGGGAAGGGTGGGAGG - Intronic
1155392215 18:25349928-25349950 CGGAGAGCGGGGAGGGCGGGCGG - Intronic
1155407305 18:25503054-25503076 CTGAGGCTGGGAAGGGTGGGAGG + Intergenic
1155958099 18:31970864-31970886 CTGAGTGAGGGATGAGTGTGAGG - Intergenic
1155987649 18:32247229-32247251 CTTGGTGTGGGGAGAGTGGGAGG - Intronic
1156505038 18:37585108-37585130 GTGTGTGAGGGCAGGGTGGGAGG + Intergenic
1156542495 18:37928854-37928876 CTAAAAGAGTGGAGGGTGGGAGG - Intergenic
1156675664 18:39524712-39524734 CTGAGTAAGGGGAGGGGAGAAGG - Intergenic
1156922318 18:42536827-42536849 CTAAAAGATGGGAGGGTGGGTGG + Intergenic
1156998678 18:43498521-43498543 TTGAGTGATGAGAGGGTGGCTGG - Intergenic
1157393519 18:47323036-47323058 TTGAGAGAGGGGAGGGTGGGTGG - Intergenic
1157496572 18:48161353-48161375 CTCAGAGAGGGGAGGAAGGGAGG + Intronic
1157562359 18:48657480-48657502 CTGAGAGAAGGGAGGGTTGGTGG - Intronic
1157600328 18:48889529-48889551 GTGGGAGAGGGGAGGATGGGCGG + Intergenic
1157603069 18:48906517-48906539 CTGTGGGAGGCCAGGGTGGGTGG + Intergenic
1157619333 18:49007061-49007083 CTGAGAGAGGAGTGGGTGGAAGG - Intergenic
1157653020 18:49356508-49356530 AGGAGTGAGGGTAGGGTTGGGGG - Intronic
1157833585 18:50879102-50879124 CCGAGAGAGGGGAGGGCGCGAGG - Exonic
1158579946 18:58671960-58671982 GTGAGTGAGCGGAGGTGGGGAGG + Intronic
1158640669 18:59201035-59201057 CTTAGTGTGGGGAGGTTGGATGG - Intergenic
1158702169 18:59758012-59758034 CTGGGTGAGGAGAAGGTTGGAGG - Intergenic
1159995470 18:74960395-74960417 CTGAGTGAGGACTGGGTGGAGGG + Intronic
1159995585 18:74960935-74960957 CTGAGTGAGGACTGGGTGGAGGG + Intronic
1159995593 18:74960971-74960993 CTGAGTGAGGACTGGGTGGAGGG + Intronic
1159995602 18:74961007-74961029 CTGAGTGAGGACTGGGTGGAGGG + Intronic
1159995611 18:74961043-74961065 CTGAGTGAGGACTGGGTGGAGGG + Intronic
1160188016 18:76690651-76690673 CTGGGTGAGGGGAGCCAGGGAGG - Intergenic
1160350447 18:78174062-78174084 TTGAGTTTGGGGTGGGTGGGGGG + Intergenic
1160409149 18:78663144-78663166 CTGGGGGAGGGCCGGGTGGGAGG + Intergenic
1160495973 18:79375635-79375657 CTGAGTGAGGGGAAGGGGCCGGG + Intronic
1160527114 18:79544510-79544532 CTCTGTGTGTGGAGGGTGGGCGG + Intergenic
1160717505 19:583007-583029 CTGAGTCATGGCCGGGTGGGCGG + Exonic
1160790664 19:921837-921859 CGGCGGGAGGGGAGGGGGGGCGG - Intergenic
1160833480 19:1113812-1113834 CTGAGGGACGGCAGGGTGGCGGG + Intronic
1160940515 19:1618519-1618541 CAGAGTGAGGAGAGGGAGAGAGG - Intronic
1160977714 19:1802079-1802101 GTGGGTGAGGGGTGGATGGGTGG - Intronic
1160977718 19:1802090-1802112 GTGAGTGATGGGTGGGTGAGGGG - Intronic
1160977741 19:1802156-1802178 GTGAGTGATGGGTGGGTGAGGGG - Intronic
1160977751 19:1802186-1802208 GTGAGTGATGGGTGGGTGAGGGG - Intronic
1160977773 19:1802246-1802268 ATGAGTGGGGGGTGGGTGGATGG - Intronic
1161115794 19:2495704-2495726 TAGAGGGAGGGCAGGGTGGGGGG + Intergenic
1161142248 19:2654629-2654651 CTGAGTGGGGGGAGGGAGAGAGG + Intronic
1161195401 19:2983610-2983632 CAGAGTGAGAGGAGGAGGGGGGG + Intronic
1161262101 19:3343824-3343846 CTGGGACAGGGGTGGGTGGGTGG - Intergenic
1161273814 19:3404589-3404611 CTGGGTGGGGTGGGGGTGGGGGG - Intronic
1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG + Intergenic
1161290357 19:3490780-3490802 TTGGGTGAGGGGAGCGTGGGAGG - Intergenic
1161329062 19:3677871-3677893 GGGAGGGAGGGGAGGGAGGGAGG + Intronic
1161451730 19:4350124-4350146 CTGAAGGTGGGGAGGGAGGGAGG + Intronic
1161473800 19:4473676-4473698 CTGAGTGAGGGGCTGGGGGTGGG + Intronic
1161490433 19:4558150-4558172 CTGAGTGAGGGGGTGGAGAGGGG + Intronic
1161575385 19:5051889-5051911 CAGAGGCAGGAGAGGGTGGGCGG - Intronic
1161657652 19:5525793-5525815 GTGAGGGAGGGGAGGATGGATGG - Intergenic
1161756428 19:6137456-6137478 CAGAGTGAGGAGGGGGAGGGAGG + Intronic
1161759813 19:6162864-6162886 CCTGGTGGGGGGAGGGTGGGCGG + Intronic
1161807977 19:6456093-6456115 CTGTGTGGGTGGAAGGTGGGAGG + Intronic
1161846343 19:6713736-6713758 CTGGGAGTGGGGAAGGTGGGGGG - Intronic
1161846389 19:6713831-6713853 CTGGGGGTGGGGAAGGTGGGGGG - Intronic
1161865764 19:6831119-6831141 CTGTGGTAGGTGAGGGTGGGAGG + Intronic
1161901850 19:7125162-7125184 TGGAGTGAGGGGTGGGTAGGAGG + Intronic
1161959593 19:7516290-7516312 CTGGGTGGGGGGCGGGCGGGCGG + Intronic
1162099790 19:8332989-8333011 CAGAGCCAAGGGAGGGTGGGTGG - Intronic
1162145690 19:8611157-8611179 CTGAGTGAGGTGGGGGGAGGTGG + Intergenic
1162171182 19:8790248-8790270 CTGAGGGGAGGGAGGGAGGGAGG + Intergenic
1162292339 19:9789534-9789556 CTTAGTGAGGGGAGTGTAGCAGG + Intronic
1162314326 19:9928559-9928581 CTGAGGGAGGCCAAGGTGGGTGG + Intronic
1162322493 19:9978532-9978554 CTGGGTGGGGGCAGGGTGGAGGG - Intronic
1162337872 19:10072840-10072862 CTGAAGGGAGGGAGGGTGGGGGG + Intergenic
1162345320 19:10115130-10115152 CTGGGGTAGGGGAGGGTGGCAGG + Exonic
1162433837 19:10644818-10644840 CTGAGAGAGGGGAGGCCTGGGGG - Intergenic
1162562519 19:11425894-11425916 CTGAGTAAGGGGAAGGCTGGAGG + Intronic
1162751590 19:12833147-12833169 CTGATTGTGGGGCAGGTGGGTGG + Intronic
1162784196 19:13023948-13023970 GTGAGTTGGGGGCGGGTGGGGGG - Intronic
1162966040 19:14156559-14156581 GTGTGTGTGGGGGGGGTGGGGGG + Intronic
1162974063 19:14198327-14198349 CTGTGTGTGGGGAGGGTTGCTGG + Intronic
1163431594 19:17271231-17271253 CTTAGGGAGGGCAAGGTGGGTGG - Intronic
1163556824 19:17998002-17998024 CCGTGTGAGGGGTGGCTGGGAGG - Intronic
1163721290 19:18899368-18899390 CTGTGTGAGGGGCGGGGTGGGGG + Intergenic
1163811219 19:19432996-19433018 CTGAGTGACTGGGTGGTGGGTGG + Intronic
1164308887 19:24029468-24029490 GGGAGTGAGGGTAGGATGGGTGG - Intergenic
1164326964 19:24202293-24202315 TTGGGTCAGGGGAGGGTGGAGGG + Intergenic
1164380318 19:27730991-27731013 TTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1164464359 19:28475043-28475065 CTGAGGGAGCAGGGGGTGGGCGG - Intergenic
1164676358 19:30104247-30104269 CTGAGGAAGGGGAGGCAGGGGGG - Intergenic
1164680093 19:30128432-30128454 CTCCATGAGGGGACGGTGGGTGG - Intergenic
1164709668 19:30346486-30346508 CTCAGAGGGTGGAGGGTGGGAGG - Intronic
1164752363 19:30666239-30666261 CTGAGTGATGGGAGACTGGGAGG - Intronic
1164857616 19:31537274-31537296 CTGGGTTATGGGAGGGTGAGAGG - Intergenic
1164901536 19:31930245-31930267 GTAAGTCAGGGGAGGGTGGGGGG + Intergenic
1165157462 19:33796828-33796850 GTGGGTGGGGGGAGGGTTGGGGG + Intronic
1165323869 19:35102793-35102815 GTGAGTGAGGGGCAGGTGGGAGG - Intergenic
1165326671 19:35118110-35118132 CTGAGGGAGGCCGGGGTGGGTGG + Intronic
1165344241 19:35233813-35233835 TTGTGTGTGGGGAGGGTAGGGGG + Intergenic
1165412397 19:35670211-35670233 CTGAGTGAGGAGGAGGTTGGGGG + Intronic
1165453899 19:35900078-35900100 CTGAGTGCGGGGGGGGGGGGGGG - Intronic
1165793564 19:38506188-38506210 TTGAGCCAGGGGAGGGTGGAGGG + Intronic
1165823783 19:38693929-38693951 GTGAGTGCGGGGAAGGGGGGTGG - Intronic
1165890916 19:39111813-39111835 CCAAGTGAGGGGCGGGTGGGAGG - Intergenic
1166052220 19:40267125-40267147 CTGAATGTGGGGTGAGTGGGAGG - Intronic
1166053656 19:40275763-40275785 CTGGGGGGGGGGGGGGTGGGCGG + Intronic
1166157170 19:40922402-40922424 CTTAGTGAGGGGAGTGTAGCAGG + Intergenic
1166301228 19:41913139-41913161 CTGCGGGAGGAGAGGCTGGGAGG - Intronic
1166334607 19:42097945-42097967 CTGAGAGGGGTGAGAGTGGGTGG - Intronic
1166357218 19:42234328-42234350 CAGAGTTATGGGAGGGTGGCGGG - Intronic
1166502640 19:43353301-43353323 CTGAGGGAGGAGGGGCTGGGGGG + Intergenic
1166530816 19:43542433-43542455 CTGAGGGTGGGAAGGTTGGGAGG - Intergenic
1166662184 19:44654251-44654273 CTGAGGGAGGAGGGGCTGGGGGG + Intronic
1166677694 19:44749274-44749296 CTGAGTGACGTGGGGGGGGGGGG + Intronic
1166679693 19:44759043-44759065 CTGAGGGAGGAGGGGCTGGGGGG - Intronic
1166683520 19:44781843-44781865 TTGAGGGAGGAGAGGGCGGGGGG + Intronic
1166683627 19:44782137-44782159 TTGAGGGAGGGGAGGGCTGGGGG + Intronic
1166759969 19:45218168-45218190 CTGCCTGAGGGGAGGGGAGGTGG - Intronic
1166760926 19:45224165-45224187 AGGAGTGGGGGGAGGGTGGCGGG + Intronic
1166876847 19:45902633-45902655 CCGAAAGAGGGGAGGGAGGGAGG - Intergenic
1166877128 19:45904049-45904071 CTGTGTGGAGGGTGGGTGGGAGG + Intergenic
1166994475 19:46713788-46713810 CTGGGGGAGGAGAGGGTAGGGGG - Intronic
1167087641 19:47321052-47321074 GTGTGTGTGGGGGGGGTGGGGGG - Exonic
1167234012 19:48302945-48302967 CTGAGGGAGGGAAGGGGGCGGGG + Intronic
1167249648 19:48393223-48393245 CTGAGGGAGGAGGGGCTGGGGGG + Intergenic
1167286115 19:48599675-48599697 CTGAGGGAGGAGAGGGCTGGGGG + Intergenic
1167305208 19:48704176-48704198 CTTTGTGAGGCCAGGGTGGGTGG + Exonic
1167327945 19:48836734-48836756 CTGAGGGAGGAGGGGCTGGGAGG - Intergenic
1167327959 19:48836771-48836793 CTGAGGGAGGAGGGGCTGGGAGG - Intergenic
1167334445 19:48875822-48875844 CTGGGTGAGGGCAGGGATGGGGG - Exonic
1167361244 19:49031721-49031743 CTCAGGGAGGGGAGGGTTCGAGG - Intronic
1167422705 19:49413508-49413530 CTGAAAGAGGGGAGGGGGAGAGG - Intronic
1167423997 19:49420363-49420385 CAGAGCCAGGGCAGGGTGGGAGG + Intergenic
1167455210 19:49594269-49594291 ATGAATGAGGGGAGGGAAGGGGG - Intronic
1167584484 19:50365889-50365911 CTGAAGGATGGGGGGGTGGGAGG - Intronic
1167588880 19:50391682-50391704 CTGAGAGGGGGGAGGGGGAGGGG + Intronic
1167597434 19:50435061-50435083 CTGAGGGAGGAGGGGCTGGGGGG + Intronic
1167627982 19:50605007-50605029 CTCAGGGAGGCGAGGGTGTGAGG + Intergenic
1167631022 19:50626242-50626264 ATGAGTGAGGGGAGAGAGAGAGG + Intronic
1167668971 19:50838919-50838941 CTGAGAGAGGAGGGGCTGGGGGG + Intergenic
1167669024 19:50839066-50839088 CTGAGAGAGGTGGGGCTGGGGGG + Intergenic
1167678765 19:50906598-50906620 CTGAGGGAGGAGGGGCTGGGGGG + Exonic
1167678790 19:50906665-50906687 CTGAGGGAGGAGGGGCTGGGGGG + Exonic
1167678815 19:50906732-50906754 CTGAGGGAGGAGGGGCTGGGGGG + Exonic
1167689151 19:50974965-50974987 CTGAGGGAGGAGGGGCTGGGGGG + Intergenic
1167689181 19:50975052-50975074 CTGAGGGAGGAGGGGCTGGGGGG + Intergenic
1167689243 19:50975218-50975240 CTGAGGGAGGAGGGGCTGGGGGG + Intergenic
1167689259 19:50975259-50975281 CTGAGGGAGGAGGGGCTGGGGGG + Intergenic
1167689320 19:50975426-50975448 CTGAGGGAGGAGGGGCTGGGGGG + Intergenic
1167689364 19:50975550-50975572 CTGAGGGAGGAGGGGCTGGGGGG + Intergenic
1167689392 19:50975627-50975649 CTGAGGGAGGAGGGGCTGGGGGG + Intergenic
1167689407 19:50975667-50975689 CTGAGGGAGGAGGGGCTGGGGGG + Intergenic
1167697526 19:51024104-51024126 CAGCGTGAGGAGAGGGTGAGGGG + Exonic
1167792212 19:51689589-51689611 CTGCGGAAAGGGAGGGTGGGGGG + Intergenic
1167799476 19:51730648-51730670 CTGAGGGAGGAGGGGGTGGGGGG + Intergenic
1167915187 19:52734651-52734673 CTGAGGAGGGGGAGGCTGGGAGG + Intronic
1167916176 19:52741814-52741836 CTTAGTGAGGGGAGTGTAGCAGG - Intergenic
1167991428 19:53364571-53364593 CTTTGTGAGGGGAGTGTGGCAGG - Intergenic
1167992737 19:53374214-53374236 TTGAGAGTGGGGAGAGTGGGAGG - Intronic
1168000792 19:53444540-53444562 CTCAGTGAGGGGAATGTGGCAGG - Intronic
1168095049 19:54109795-54109817 CTGAGGGAGGGCCGGGTGGAGGG - Intronic
1168105143 19:54161977-54161999 CTGAGAGAGGAGGGGGTTGGAGG - Intronic
1168155522 19:54471871-54471893 CTGAGGGAGGAGGGGCTGGGGGG - Intronic
1168155637 19:54472168-54472190 CTGAGGGAGGAGGGGCTGGGGGG - Intronic
1168155692 19:54472317-54472339 CTGAGGGAGGAGGGGCTGGGGGG - Intronic
1168155745 19:54472465-54472487 CTGAGGGAGGAGGGGCTGGGGGG - Intronic
1168155771 19:54472544-54472566 CTGAGGGAGGAGGGGCTGGGGGG - Intronic
1168155883 19:54472840-54472862 CTGAGGGAGGAGGGGCTGGGGGG - Intronic
1168155911 19:54472914-54472936 CTGAGGGAGGAGGGGCTGGGGGG - Intronic
1168252260 19:55147578-55147600 CTGAGGGAGGAGGGGCTGGGGGG + Intronic
1168274447 19:55269398-55269420 GTGAATGCGGCGAGGGTGGGTGG - Intronic
1168295257 19:55374917-55374939 CTGAGGGAGGAGGGGCTGGGGGG - Intergenic
1168295352 19:55375151-55375173 CTGAGGGAGGAGGGGCTGGGGGG - Intergenic
1168398007 19:56065351-56065373 CTGAGGGTGGGATGGGTGGGCGG + Intergenic
1168614888 19:57829733-57829755 CTTGGTGAGGGGAGTGTGGCAGG - Intronic
925017597 2:543661-543683 CAGGGAGGGGGGAGGGTGGGAGG + Intergenic
925025730 2:605902-605924 GTGAGCAAGTGGAGGGTGGGCGG - Intergenic
925306045 2:2848918-2848940 GGGAGGGAGGGGAGGGAGGGAGG + Intergenic
925904953 2:8534841-8534863 CTGAGTCAGGGGTGCTTGGGGGG + Intergenic
926189943 2:10721247-10721269 CTCTGTGAGGCGAGAGTGGGTGG + Intergenic
926693186 2:15751460-15751482 GTGAGTGTGTGGGGGGTGGGGGG + Intergenic
926696535 2:15773071-15773093 CTGGGTGAGGTGGGGGTGGCTGG + Intergenic
926726712 2:16004371-16004393 CTGTGTGTGGTGAGGATGGGAGG + Intergenic
926734000 2:16058581-16058603 TGGGGTGAGGTGAGGGTGGGAGG + Intergenic
926906945 2:17814834-17814856 CTCAGAAGGGGGAGGGTGGGAGG + Intergenic
927048516 2:19303990-19304012 CGGAGTGAGGGGACAGTGAGGGG - Intergenic
927338293 2:21950993-21951015 CAGAGGAAGGGGAGGGGGGGTGG - Intergenic
927469942 2:23366165-23366187 CTCAGAAGGGGGAGGGTGGGAGG + Intergenic
927601177 2:24442901-24442923 CTTTGTGAGGGGAAGGTGGGAGG + Intergenic
927706257 2:25298277-25298299 CCGAGTGAGGGGAGAGGGGCCGG - Intronic
927772201 2:25873088-25873110 CTGGGTGGGGAAAGGGTGGGAGG - Intronic
928025585 2:27736197-27736219 CTGAGGGAGGGCAGGTCGGGTGG - Intergenic
928028141 2:27756315-27756337 CTGACTGTGGGGAGGGAGAGGGG - Intergenic
928104375 2:28458379-28458401 CTCAGAGGGTGGAGGGTGGGAGG + Intronic
928104433 2:28458868-28458890 CTCAGAGGGTGGAGGGTGGGAGG + Intronic
928175065 2:29027898-29027920 GTGAGTGAGGGGTGGGGGTGAGG + Intronic
928885994 2:36149161-36149183 ATTAGAGCGGGGAGGGTGGGAGG - Intergenic
929456384 2:42069055-42069077 CTGAGTGCGGGGAGGGCTGGTGG - Intergenic
929749653 2:44696663-44696685 GTGAGTGGGGTGAGGGTGTGGGG - Intronic
929892228 2:45927920-45927942 CGGAGGCAGGAGAGGGTGGGGGG + Intronic
929932450 2:46269462-46269484 GTGTGTGAGGTGGGGGTGGGTGG - Intergenic
930027554 2:47038631-47038653 GTGGGTGGGGGGAGGGTGGGTGG - Intronic
930027563 2:47038646-47038668 CTGTGTGTCGGGGGGGTGGGTGG - Intronic
930032269 2:47065755-47065777 CTGAGGGCAGGGAGAGTGGGTGG - Intronic
930136369 2:47906557-47906579 CGGGGGGAGGGGTGGGTGGGCGG + Intergenic
930673839 2:54179233-54179255 TGGTGTGAGGGGTGGGTGGGTGG + Intronic
930926658 2:56826459-56826481 CTGAGAGAGAGGAGTGTGGAAGG + Intergenic
931372006 2:61672298-61672320 CTGGGTGAGGGAAGGGTGGATGG + Intergenic
931405047 2:61968561-61968583 TTGATGGAGGGGAGGGAGGGAGG + Intronic
932501941 2:72190137-72190159 CTCAGGGAGGTGAAGGTGGGAGG - Intronic
932703000 2:74003547-74003569 CGGTGTGCGGGGAGGGGGGGTGG + Intronic
932871445 2:75403279-75403301 CTGAGCGGGGGGAGGGGGTGGGG + Intergenic
933078145 2:77954960-77954982 CTCAGGGAGGCGAGGGTGCGAGG - Intergenic
933504744 2:83162496-83162518 CTGAGTGAGAGAAGGCAGGGTGG + Intergenic
933624332 2:84581819-84581841 CTGAATGAGGGGACAGTGAGAGG + Intronic
933660440 2:84923127-84923149 GGGAGGGAGGGGAGGGAGGGAGG + Intergenic
933703515 2:85273149-85273171 GTGAGTGAGGAGGAGGTGGGAGG - Intronic
933709583 2:85315573-85315595 CTGGGTGAGGGGGTGGAGGGAGG + Intergenic
933716162 2:85362394-85362416 GGGAGTGAGGGGAGGGTGTATGG + Intronic
933763574 2:85692412-85692434 CTGAGTTAGGGTAGGGCTGGGGG + Intronic
934299558 2:91769019-91769041 CTGGGGGAGGGGCGGGGGGGAGG - Intergenic
934768606 2:96894401-96894423 GTGAGTGGGTGGGGGGTGGGAGG - Intronic
935270403 2:101429646-101429668 CTGAGTGACGGGGACGTGGGAGG - Intronic
935821291 2:106895502-106895524 CTGAGTGACCAGGGGGTGGGTGG - Intergenic
936007564 2:108904804-108904826 CTAGGTGAGGGTGGGGTGGGTGG + Intronic
936164371 2:110107068-110107090 GTGAGGGAGGGCAGGGTAGGGGG + Intronic
936454879 2:112665408-112665430 TTGAGGGAAGGGAGGGTAGGGGG + Intergenic
936461976 2:112720992-112721014 CTGAGGGAGAGGAGAGTGGCTGG + Intergenic
936780898 2:116030794-116030816 CTGAAAGAGGGGAGGGAGGTAGG - Intergenic
937027039 2:118707516-118707538 CTGAGGGAGGGGAGAATGAGAGG + Intergenic
937110430 2:119363032-119363054 CTGAGGGAGGTGAGAGTTGGTGG - Intronic
937309488 2:120893327-120893349 GTGGGGGAGGGGAGGCTGGGGGG - Intronic
937428596 2:121819636-121819658 CTGAGCGGGAGGAGGCTGGGAGG - Intergenic
937515506 2:122650645-122650667 GAGAGTGAGGGCAAGGTGGGTGG + Intergenic
937628209 2:124068054-124068076 AAGAGGGTGGGGAGGGTGGGAGG - Intronic
938072590 2:128316449-128316471 CTGACTGGTGGAAGGGTGGGTGG + Intronic
938090244 2:128426509-128426531 TGGAGTGTGGGGAGGATGGGAGG - Intergenic
938293806 2:130164241-130164263 CTGAGTGACAGGTGGGTGGTGGG + Intronic
938384131 2:130852572-130852594 CTGACTGTGGGGTGGGTTGGGGG + Intronic
938462739 2:131508721-131508743 CTGAGTGACAGGTGGGTGGTGGG - Intergenic
940062196 2:149584803-149584825 CTTAGGGAGGCGAAGGTGGGTGG + Intronic
940168725 2:150803705-150803727 CTGAGTGAGGCCTGGGTTGGGGG - Intergenic
940194639 2:151080195-151080217 CTGAGAGAGAGGACGGTGGGTGG + Intergenic
940602434 2:155878627-155878649 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
940854250 2:158717471-158717493 CTGGGTGAGGTGAGGCTGCGGGG - Intergenic
941238690 2:163010119-163010141 CTGGGAGAATGGAGGGTGGGTGG - Intergenic
941720031 2:168802701-168802723 CTGCGTGTGAGGAGGGTGGAGGG + Intronic
942042644 2:172081166-172081188 GTGCGTGTGGGGTGGGTGGGGGG - Exonic
942080419 2:172394897-172394919 CTGGGTGGGGGGAGGGGGGAGGG + Intergenic
942097948 2:172551209-172551231 CTGAGTGGTGGTGGGGTGGGGGG - Intergenic
942226992 2:173825741-173825763 CTGGGTGAGGGCAGGATGGAAGG + Intergenic
942328867 2:174800637-174800659 CAGAGTGAAGGGAGGGTGGGTGG - Intronic
942665101 2:178309108-178309130 CTGGTTGAGAGGAGGGTGGTGGG - Intronic
942964845 2:181879506-181879528 CTGGGTGAGGAGAGAGTGGTAGG - Intergenic
943391101 2:187268901-187268923 CTGAAACAGGGAAGGGTGGGAGG - Intergenic
944531314 2:200670308-200670330 CAGTGTGAGTGGAGGATGGGAGG - Intronic
944633653 2:201653384-201653406 CTGAGTGTGGGAAGAGTGTGTGG - Intronic
944637674 2:201690566-201690588 CAGAGTGAGGGTAGGGTGTCTGG + Intronic
944663448 2:201939935-201939957 AAGGGTGAGGGGAGGGTGAGTGG + Intergenic
944925426 2:204459093-204459115 ATGGGAGAGGAGAGGGTGGGAGG - Intergenic
945333502 2:208565621-208565643 CTTTGGGAGGCGAGGGTGGGTGG + Intronic
945349248 2:208758240-208758262 TGGGGTGAGGGGAGGGTGGAGGG - Intronic
945574280 2:211510307-211510329 CTAAAAGAGGAGAGGGTGGGAGG + Intronic
945918121 2:215726151-215726173 CAGGGAGAGGGGAGGGAGGGAGG + Intergenic
945929762 2:215843037-215843059 CAGAGTGAGAGGAGGGAGAGTGG - Intergenic
945948419 2:216015866-216015888 CTGAGATAGAGGAGTGTGGGAGG + Intronic
945977748 2:216283782-216283804 GTGAGTGATGGGCGGGAGGGTGG + Intronic
946011056 2:216563828-216563850 CTGGGTGGGGGGTGGGTAGGCGG - Intronic
946108531 2:217393484-217393506 CTGAGTGGGGGGGGGGGGTGAGG - Intronic
946313517 2:218895757-218895779 CAGAGAGAGGGGTGGGTGGTTGG + Intronic
946788836 2:223277797-223277819 CAGAGACAGGGAAGGGTGGGTGG - Intergenic
947232674 2:227903647-227903669 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947232682 2:227903664-227903686 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947232690 2:227903681-227903703 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947745117 2:232503367-232503389 CTGAGTGCGGGGACGGGAGGAGG + Intergenic
948211481 2:236196435-236196457 CTCAGTGGGGAAAGGGTGGGGGG + Intronic
948386839 2:237585843-237585865 GTGCGTGAGGGGAGGGGGTGAGG - Intronic
948481238 2:238251842-238251864 ATGAGTGGGGTGAGGGTGGAGGG + Intronic
948529852 2:238597479-238597501 GAGAGAGAGGGGTGGGTGGGAGG - Intergenic
948657781 2:239487312-239487334 CTGAGTGAGGCCAGGGCGGCAGG + Intergenic
948667486 2:239545664-239545686 CTGAGGGAGGGGAAAGTGTGAGG - Intergenic
948765578 2:240217089-240217111 CAGGGTGAGGGGTGGGGGGGTGG + Intergenic
948892556 2:240914600-240914622 CTGAGTGAGGGGTGGGATGGAGG - Intergenic
948897587 2:240934520-240934542 GTCAGTGAGGCCAGGGTGGGTGG - Intronic
949001922 2:241619832-241619854 GTGAGTGAGGGGTGAGTGAGGGG + Intronic
949001930 2:241619869-241619891 GTGAGTGAGGGGTGAGTGAGGGG + Intronic
949001965 2:241620044-241620066 GTGAGTGAGGGGTGAGTGAGGGG + Intronic
949066802 2:241995943-241995965 CTGTGGGAGGCCAGGGTGGGTGG - Intergenic
1168749658 20:273448-273470 CTGAGTGAGGCCAGAGTGGTTGG - Intronic
1168762019 20:355848-355870 CTGAGTCCAGGGAGGTTGGGAGG - Intronic
1168764219 20:371095-371117 CTGAGTCAGGGCAGGGAGAGAGG - Intronic
1168809490 20:695086-695108 CTCAGTGGGGAGAGGGTGCGTGG - Intergenic
1168852795 20:988155-988177 GTGACTGAGGGGAGAGTGGTGGG + Intronic
1168928795 20:1604668-1604690 CTGGATGAGTGGAGGGTGGTGGG + Intronic
1168969584 20:1921764-1921786 CTGGATGAGTGGAGGGTGGTGGG - Intronic
1169073552 20:2748674-2748696 CTGATGGAGGGGAGGGGAGGGGG + Intronic
1169109514 20:3022836-3022858 GTGGGTCAGGTGAGGGTGGGGGG + Intronic
1169141374 20:3229063-3229085 GTGGGTGAGGGTGGGGTGGGCGG - Intronic
1170062289 20:12271926-12271948 GTCAGAGAGTGGAGGGTGGGAGG - Intergenic
1170096254 20:12648896-12648918 CTCAGAGGGGGGAGTGTGGGAGG - Intergenic
1170126091 20:12965699-12965721 TGAAGTGAGGGGAGGGAGGGTGG + Intergenic
1170594143 20:17792845-17792867 CTGAGGGAGGGGAGGTTGGGTGG - Intergenic
1170881043 20:20296515-20296537 TTGAGTGAGGGGAGGAAGGAAGG - Intronic
1171084939 20:22229456-22229478 GTGAGTTAAGGGTGGGTGGGAGG + Intergenic
1171163563 20:22950758-22950780 TTGAGTGACGTAAGGGTGGGAGG + Intergenic
1171274915 20:23848236-23848258 GTGGGTGAGAGGAGGGTGTGGGG + Intergenic
1171290495 20:23980279-23980301 GTGAGTGTGGGGGGCGTGGGTGG - Intergenic
1171462950 20:25309141-25309163 CTGAGGGAGGGCACAGTGGGTGG - Intronic
1171986634 20:31665487-31665509 GTTAGTGTGGGGAGAGTGGGGGG + Exonic
1172298233 20:33829188-33829210 CTGGGAGAGAGGAGGGTGTGTGG + Intronic
1172578735 20:36030274-36030296 CTTAGGGAGGGGAGAGTGGCAGG + Intronic
1172625256 20:36343008-36343030 CTGAGTGAGGGGGAGGGGAGAGG + Intronic
1172643366 20:36455147-36455169 CAGAGTAAGAGGAGGGAGGGAGG - Intronic
1172646701 20:36474731-36474753 CAGTGTGTGGGAAGGGTGGGGGG + Intronic
1172840309 20:37898965-37898987 CTCAAGGAGGGGAGGGAGGGTGG + Intergenic
1172854943 20:37994467-37994489 TGGAGAGAGGGGTGGGTGGGTGG - Intronic
1172963225 20:38813454-38813476 CTGATGGAAGGGAAGGTGGGAGG + Intronic
1173334701 20:42102938-42102960 CTGAATGAGGGAAGGATGGAGGG - Intronic
1173346393 20:42204674-42204696 CTGAGGGAGGGGTAGGTGGCAGG + Intronic
1173825272 20:46044025-46044047 CTGTGTGAGGGGCCTGTGGGAGG + Intronic
1173860861 20:46282749-46282771 CCGGGGGAGGGAAGGGTGGGTGG + Intronic
1173941263 20:46913337-46913359 CTGAGTGAGAGGAGAGGGGCAGG + Intronic
1174023641 20:47553540-47553562 GTGGGTGGGGGGAGGGGGGGAGG - Intronic
1174200290 20:48802342-48802364 GTGAGTGAGGGGAGAATGGGTGG - Intronic
1174302101 20:49589859-49589881 GTGAGTTGGGGGAGAGTGGGAGG - Intergenic
1174318061 20:49718184-49718206 CAGAGTGAGGGCAGGGAGGAAGG - Intergenic
1174396225 20:50248345-50248367 CTGGGTGAGGGGCAGATGGGTGG - Intergenic
1174418167 20:50381144-50381166 GGGAGGGAGGGGAGGGAGGGAGG + Intergenic
1174448908 20:50608234-50608256 CTGACTGAGGGGTGGGAGTGAGG + Intronic
1174701980 20:52618104-52618126 CTGAGTGGGGGGATTGGGGGCGG + Intergenic
1174926620 20:54767313-54767335 CAGAGTGAGGGCAGGGAGGCAGG - Intergenic
1175074040 20:56358936-56358958 CGGAGGCCGGGGAGGGTGGGCGG - Exonic
1175230373 20:57469934-57469956 CTGGGGGTGGGGTGGGTGGGGGG + Intergenic
1175380152 20:58557297-58557319 CTGAGTGGAGGGAGGGTGTTGGG + Intergenic
1175426546 20:58870905-58870927 CAGGGTGAGGGTAGGCTGGGGGG - Intronic
1175439219 20:58979206-58979228 CTGAATGGGGGGAGGGGGTGGGG - Intergenic
1175573874 20:60045730-60045752 CAGAGGCAGGGGAGGGTAGGAGG + Intergenic
1175671174 20:60903715-60903737 CTGAGTGTGGGGTGGGGGTGGGG + Intergenic
1175691897 20:61071521-61071543 CTGAGTAAGTGGAGGGTGAGAGG + Intergenic
1175854260 20:62111918-62111940 CTGGGGGAGGTGAGGGTGGGAGG + Intergenic
1176018937 20:62952897-62952919 GGGGGTGAGGGGAGGGGGGGTGG + Intronic
1176027529 20:62993557-62993579 GGGAGGCAGGGGAGGGTGGGAGG + Intergenic
1176042042 20:63070980-63071002 CTGAGTGTGGGCAGGGGTGGAGG + Intergenic
1176060488 20:63170361-63170383 CTGAGGGAGGGGAGGATGTGAGG - Intergenic
1176112133 20:63415557-63415579 GGGAGGGAGGGGAGGCTGGGTGG + Intronic
1176132893 20:63503729-63503751 CTGTGGGAGGCGATGGTGGGCGG - Intergenic
1176234769 20:64049140-64049162 CTGGGTGAGCGGCGGGAGGGCGG - Exonic
1176245236 20:64094067-64094089 CAGAGTGGGGGCAGTGTGGGGGG + Intronic
1176292342 21:5052802-5052824 CGGAGGGAGGGATGGGTGGGTGG - Intergenic
1176723788 21:10413788-10413810 CTGAGTGGTAGGAGGGTGGCTGG + Intergenic
1176742547 21:10617246-10617268 ATGAGAGAAGGGAGGGAGGGAGG + Intergenic
1177210293 21:18062450-18062472 TTGAGAGAGGCCAGGGTGGGAGG - Intronic
1177650947 21:23961663-23961685 GAGAGTGAGAGGGGGGTGGGGGG - Intergenic
1177914200 21:27067983-27068005 CTATTTGAGGGGAGGGTGGGGGG + Intergenic
1178618631 21:34155117-34155139 CTGAGCTGGGGGAGGGTGTGGGG + Intergenic
1179102732 21:38368762-38368784 TTCAGAGCGGGGAGGGTGGGAGG - Intergenic
1179151885 21:38816049-38816071 GGGAGGGAGGGGAGGGAGGGAGG + Intronic
1179151898 21:38816074-38816096 GGGAGGGAGGGGAGGGAGGGAGG + Intronic
1179174883 21:39001080-39001102 CTGAGGCAGTAGAGGGTGGGTGG - Intergenic
1179353161 21:40632353-40632375 TTGGGTGGGGGGAGGGTGAGAGG + Intronic
1179396998 21:41049704-41049726 CTCAGAAAGGAGAGGGTGGGAGG - Intergenic
1179452305 21:41474879-41474901 GTGGGTGAGGGGTGGGTGAGGGG + Intronic
1179489727 21:41733528-41733550 CTGATGGAGTGGAGAGTGGGAGG + Intergenic
1179649526 21:42798423-42798445 GGGTGGGAGGGGAGGGTGGGGGG + Intergenic
1179682575 21:43034586-43034608 CTTTGTGAGGCCAGGGTGGGCGG + Intergenic
1179732277 21:43374547-43374569 CAGAGTGCGGGCAGGGTGGCGGG - Intergenic
1179822882 21:43947059-43947081 GTAGGTGACGGGAGGGTGGGGGG + Intronic
1179864918 21:44210856-44210878 CGGAGGGAGGGATGGGTGGGTGG + Intergenic
1179881887 21:44296477-44296499 CTGAGGCAGGGGAGGGGGAGTGG - Intronic
1179925449 21:44531699-44531721 CTCAGTGGAGGGAGGGTGAGTGG - Intronic
1180129069 21:45814261-45814283 GTGAGTGAGTGGTGGGTGAGTGG + Intronic
1180130087 21:45821561-45821583 ATGAGTTAGGGGAGGGGGCGGGG - Intronic
1181084607 22:20433762-20433784 CTGGGTCAGGGCTGGGTGGGTGG - Intronic
1181462803 22:23095313-23095335 CTGAGTGGCTGGAGGGTTGGAGG - Exonic
1181484574 22:23222605-23222627 CTGGGAGAGGGGAGCGTGGCAGG + Intronic
1181529489 22:23508829-23508851 CTGAGGGTGGGGAGCCTGGGAGG - Intergenic
1181625059 22:24117602-24117624 CTGAGAGAGGGGCGGCTGAGCGG + Intronic
1181999763 22:26910904-26910926 GAGAGAGAGGAGAGGGTGGGAGG - Intergenic
1182288330 22:29260688-29260710 CGGAGTGAGGTGAGGGTGATGGG - Exonic
1182711313 22:32325118-32325140 CTGAGTGAGGGGAGCACTGGTGG - Intergenic
1182727084 22:32456447-32456469 ATGAGGGAAGGGAGGGAGGGAGG - Intronic
1183042594 22:35193517-35193539 GGGAGGGAGGGGAGGGAGGGAGG + Intergenic
1183098509 22:35569026-35569048 CTGCATGCGGGGAAGGTGGGAGG + Intergenic
1183188211 22:36304624-36304646 CTGGGAGTGGGGAGGGAGGGAGG + Intronic
1183209727 22:36443400-36443422 AGGAGTGAAGGGAGGGAGGGAGG - Intergenic
1183279504 22:36924400-36924422 CTGGGAGAGGGCATGGTGGGTGG - Intronic
1183330255 22:37216190-37216212 CTGTGGGATGGGGGGGTGGGAGG - Intergenic
1183404708 22:37624772-37624794 GTGAATGAGGGAAGGGTGGGAGG + Intronic
1183470943 22:38006427-38006449 CTGAGTGAGCGGCTGGAGGGTGG - Intronic
1183507883 22:38219646-38219668 CTGTTTGCGTGGAGGGTGGGGGG - Exonic
1183538007 22:38414246-38414268 CAGATGGACGGGAGGGTGGGAGG - Intergenic
1183667013 22:39252048-39252070 CTGATTGTGGGGAGTGTGTGCGG + Intergenic
1183697296 22:39430623-39430645 GTGAGGGAGGTGATGGTGGGAGG - Exonic
1183733838 22:39632580-39632602 GTGTGTGGGGGGAGGGTTGGGGG + Intronic
1183744105 22:39683699-39683721 CTGGGTGTGGGGGGCGTGGGGGG - Intronic
1184110005 22:42389012-42389034 CTGGGTGGGTGGAGGGTTGGGGG - Intronic
1184135000 22:42542893-42542915 CTGAATTTGGGGGGGGTGGGGGG + Intergenic
1184275042 22:43405227-43405249 CTGAGGGTGGGGAGGGCCGGAGG + Intergenic
1184286460 22:43474479-43474501 CTGAGAGAGGGGCGGGCAGGAGG - Intronic
1184286484 22:43474646-43474668 CTGAGAGAGGGGCGGGCAGGAGG - Intronic
1184398831 22:44261897-44261919 CTGAGTGAGGGGAGCACTGGTGG - Intronic
1184646275 22:45897108-45897130 CTGTGTGGGGCTAGGGTGGGTGG - Intergenic
1184742998 22:46439924-46439946 CTGTGTGAGGGGTGGGAGGGCGG - Intronic
1184764492 22:46564438-46564460 CTGATTCAGGGGCTGGTGGGCGG - Intergenic
1184783187 22:46659220-46659242 CTGAGGGAGTGGAGGCTGAGAGG - Intronic
1184852342 22:47128055-47128077 ATGGGTGAGGGGAGGGGGGATGG - Intronic
1185051199 22:48555177-48555199 CCGAGTGAAGGGAGGGAGGATGG + Intronic
1185068019 22:48641635-48641657 GTGTGTGAGGGGAGGGTGTGCGG - Intronic
1185069953 22:48650793-48650815 CTGGGGGAGGGGAGGCTCGGTGG - Intronic
1185326092 22:50226540-50226562 TGGAGTGGGGGCAGGGTGGGGGG + Intronic
1185326104 22:50226565-50226587 TGGAGTGGGGGCAGGGTGGGGGG + Intronic
1185340451 22:50288591-50288613 CTGGATGAGGGGTGGCTGGGTGG - Intronic
1185381188 22:50508086-50508108 CTCCGGGAGGGGGGGGTGGGCGG - Intergenic
1185399334 22:50607850-50607872 CAGGGTGAGGGGAGGAGGGGAGG + Intronic
1203322947 22_KI270737v1_random:86267-86289 ATGAGGGAAGGGAGGGAGGGAGG - Intergenic
949677042 3:6467377-6467399 ATGAAGGAGGGGAGGGAGGGAGG + Intergenic
949970038 3:9396886-9396908 CGAAGGAAGGGGAGGGTGGGAGG + Intergenic
950007020 3:9697976-9697998 CTGAGAGAGGGGAGGGCAGGAGG - Intronic
950040104 3:9914836-9914858 CTCAGACAGGGGAGGGTGAGGGG - Intronic
950156272 3:10723765-10723787 CTGAGTGTTGGGAAGGAGGGTGG + Intergenic
950230242 3:11269921-11269943 CTTTGTGAGGTGAAGGTGGGAGG + Intergenic
950230397 3:11271060-11271082 CTGCCTTTGGGGAGGGTGGGGGG + Intergenic
950366400 3:12488149-12488171 CTGAGGGAGGGGAAGGTGAGTGG - Intronic
950762413 3:15243785-15243807 TGAAGTGGGGGGAGGGTGGGAGG + Intronic
950922222 3:16705959-16705981 GTGAGTGAGGGGAGGCTGAAGGG - Intergenic
951035798 3:17930608-17930630 CTGACTGTTGGGTGGGTGGGAGG + Intronic
951383192 3:22010899-22010921 GTGAGTGGTGGGAGGATGGGAGG - Intronic
952071068 3:29636478-29636500 ATGTGCGAGGGGAGGGTGGAAGG + Intronic
952088268 3:29853152-29853174 CTCAGAGAGTGGAGGGTGGGAGG + Intronic
952192967 3:31043197-31043219 GTCAGGGAGGGGAGGGTGGAGGG - Intergenic
952755699 3:36864631-36864653 CAGAATCAGGGGAGGGTGGAGGG - Intronic
952867077 3:37861682-37861704 CAGGGTGAGTGGAGGGCGGGAGG - Intergenic
953056575 3:39392251-39392273 CGGGGTGAGGATAGGGTGGGTGG + Intronic
953098147 3:39799105-39799127 GGGAGGGTGGGGAGGGTGGGAGG - Intergenic
953626923 3:44579350-44579372 CTGAATCAGGAGCGGGTGGGCGG - Intronic
953693803 3:45142217-45142239 CTGATTGAGGTCAGGGTGGGTGG - Intronic
954671191 3:52292155-52292177 CTGAGTTGGGGGAGGGTGTGTGG + Intronic
954842487 3:53524119-53524141 CATGGTGAGGGGAGGATGGGGGG + Intronic
955399174 3:58579096-58579118 CTGGGTGAGGTGAGAGCGGGTGG + Intronic
955680615 3:61497054-61497076 TTCAGAGAGCGGAGGGTGGGAGG + Intergenic
955895039 3:63689890-63689912 TTGGGTGAGGGGAGGGGGGAGGG + Intergenic
955902634 3:63773739-63773761 CTAAGTGTGGGGAGGGTGCTTGG + Intergenic
956126410 3:66015026-66015048 CTGGGTGAGGGGATGGTGGTGGG - Intronic
956379966 3:68654867-68654889 CTGAGTTTGGGGGGGGCGGGGGG + Intergenic
956426977 3:69145963-69145985 CTCTGTGGGGTGAGGGTGGGGGG - Intergenic
957078777 3:75620309-75620331 GTGGGTGGGGGGAGGGAGGGAGG - Intergenic
957315445 3:78570240-78570262 GTGAGGGTGGGGTGGGTGGGGGG + Intergenic
957442783 3:80272132-80272154 CTGAAGGAAGGGAGGGAGGGAGG + Intergenic
958054750 3:88394877-88394899 TTGAGAGAGGAGAGGGTGGGAGG + Intergenic
958094891 3:88931285-88931307 AGGAGGGAAGGGAGGGTGGGAGG - Intergenic
958193266 3:90210412-90210434 ATGAAAGATGGGAGGGTGGGAGG + Intergenic
958703343 3:97621261-97621283 CTCAGAGAGTGGAGGGTGGGAGG + Intronic
959099903 3:101998576-101998598 CTGAATGAGGGAATGGTGGCTGG - Intergenic
959189079 3:103086562-103086584 CTGAGGGATGGGAAGGTTGGAGG - Intergenic
959241650 3:103803743-103803765 GGGAGGGAGGGGAGGGAGGGAGG + Intergenic
960005435 3:112776687-112776709 CTTTGGGAGGTGAGGGTGGGCGG + Intronic
960137672 3:114122145-114122167 TTAATTGAGGTGAGGGTGGGTGG + Intergenic
960155430 3:114293202-114293224 ATGAATGAAGGGAGGGAGGGAGG + Intronic
960338356 3:116445594-116445616 CAGGGTGGGGGGAGGGTGGGGGG - Intronic
960435200 3:117618212-117618234 ATTAGAGAGGGGAGGGTGGGAGG + Intergenic
960711884 3:120538392-120538414 CAGAGTGAGGGCAGGCAGGGTGG - Intergenic
960788500 3:121400214-121400236 CTGGGTGAGAGGTAGGTGGGAGG - Intronic
961102235 3:124209538-124209560 CTCAGAGAGGTCAGGGTGGGTGG - Intronic
961371805 3:126435929-126435951 CGGAGTGTGGGTAGGGTGGTGGG - Intronic
961393536 3:126570608-126570630 CTGTGTGAGGGGAGGCAGTGAGG - Intergenic
961403182 3:126661595-126661617 GTGGGTCAGGGGAGGGTGGCTGG - Intergenic
961524440 3:127487647-127487669 AGGTGTGAGGGGAGGGTGGGGGG - Intergenic
961726780 3:128936049-128936071 CTGAGTGGGGGCAGGAAGGGGGG - Intronic
961739288 3:129022658-129022680 GGGTGTGAGGGGAGGGTGGGTGG + Intronic
961848839 3:129794544-129794566 GTGGGAGAGGGCAGGGTGGGTGG + Intronic
961849703 3:129803337-129803359 GAGAGTGAGGGGAGGGTAGAAGG + Intronic
961872229 3:129996832-129996854 GTGAATGAGGGGAGAGTAGGAGG - Intergenic
962072202 3:132044672-132044694 GGGAGGGAGGGGAGGGAGGGGGG + Intronic
962073527 3:132056610-132056632 TTGGGTGAGGGGAGGGGGGAGGG - Intronic
962103332 3:132365496-132365518 GTGAGTGAAGGGAGGGTGATAGG + Intronic
962170242 3:133094227-133094249 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
962244142 3:133777284-133777306 GTGAGTGCTGGGATGGTGGGTGG + Intronic
962317577 3:134368374-134368396 CTGGGTGAGTGGGGGGTGGGGGG - Intronic
962518092 3:136172357-136172379 CTGGGTGGGGGGAGTATGGGAGG - Intronic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963104970 3:141639141-141639163 CTGAGTGGGGGGGTGGGGGGGGG + Intergenic
964282383 3:155080231-155080253 AAGAGTGAGGGGAGGGAGAGGGG + Intronic
964791250 3:160454294-160454316 CTGCTTGGGCGGAGGGTGGGGGG + Intronic
965284225 3:166796576-166796598 TTGAGTGAGGGGAGAGTAGAGGG + Intergenic
965530930 3:169769274-169769296 CTGGGGCTGGGGAGGGTGGGTGG - Intronic
965576512 3:170222827-170222849 CTGGAGGAGGGGAGGGTGAGGGG + Intronic
965698954 3:171439838-171439860 TTGAGTGAGGGCCAGGTGGGTGG - Intronic
966192530 3:177284444-177284466 CAGAAAGAGGGAAGGGTGGGAGG - Intergenic
966469689 3:180275042-180275064 CTGGGTGAGGGCAGGCAGGGAGG + Intergenic
966850919 3:184164634-184164656 GAAAGTGAGGGGAGGGTGTGAGG - Intronic
966880116 3:184345316-184345338 CTGTGTGAGGGTGGGGTGGGAGG + Intronic
966919136 3:184601208-184601230 GCGAGTGAGGCGGGGGTGGGGGG - Intronic
967055310 3:185825048-185825070 CGGAGGGCGGGGAGGGGGGGCGG - Exonic
967070769 3:185960742-185960764 CGGAGTGAGAGGAGGGTGGCAGG - Intergenic
967072423 3:185973296-185973318 ATGAGGGAGGGGAGGGTAGTAGG + Intergenic
967568493 3:190999697-190999719 GAGAGTGAAGGGAGGGAGGGAGG + Intergenic
967799308 3:193638244-193638266 CTGAGTGAGGGGAGAGTGGTAGG + Intronic
968317377 3:197736441-197736463 CTTAGGGTGAGGAGGGTGGGTGG - Intronic
968345522 3:198001894-198001916 CTTAGTGAGGCCAAGGTGGGTGG - Intronic
968375203 4:34380-34402 CTTGATGGGGGGAGGGTGGGAGG - Intergenic
968434491 4:577374-577396 CTGAGTGAGGGGGACGAGGGCGG + Intergenic
968594696 4:1476355-1476377 GTGAATGATGGGTGGGTGGGTGG + Intergenic
968870422 4:3239235-3239257 CTGGGTGAGGGGAGCGAGGGTGG + Intronic
968882295 4:3307600-3307622 CCGAGTGAGGGGAGGAGGGAAGG - Intronic
968914271 4:3490374-3490396 CTGAATGAGCAGGGGGTGGGGGG - Intronic
969353923 4:6614179-6614201 CAGAGTGAGGAGAGGGTTTGGGG - Intronic
969443478 4:7231476-7231498 ATGAGTGATGGGTGGATGGGTGG - Intronic
969548664 4:7849226-7849248 CAGAGGGAGGGGAGAGTGAGAGG + Intronic
969758753 4:9167567-9167589 TTGAGCGTGGGGTGGGTGGGAGG - Intergenic
969880580 4:10170122-10170144 CTGGGGGGGGGGGGGGTGGGGGG + Intergenic
970193095 4:13533499-13533521 GTGGGTGGGGGGCGGGTGGGGGG - Intergenic
970566244 4:17334995-17335017 CTGAATGGGGGTGGGGTGGGTGG - Intergenic
970579741 4:17464408-17464430 CTGAGTGACTAGTGGGTGGGTGG - Intronic
970602328 4:17650243-17650265 CTGTGAGAGGGCAGGGAGGGTGG - Intronic
970833000 4:20365531-20365553 AGAAGTGACGGGAGGGTGGGGGG - Intronic
971531840 4:27698470-27698492 TTGGGTGGGGGGAGGGTGGAGGG - Intergenic
972254151 4:37335284-37335306 CTGACTGGGGGGTGGGCGGGGGG + Intronic
972278562 4:37581970-37581992 CTGTGTGTGGGTAGGCTGGGGGG + Intronic
973088499 4:46100317-46100339 ATCAGAGTGGGGAGGGTGGGAGG + Intronic
973224058 4:47762779-47762801 CTGGCAGATGGGAGGGTGGGAGG + Intronic
973330463 4:48906530-48906552 CCGAGTTAGGGGAGAGTGGGGGG + Intronic
973563978 4:52165348-52165370 GTGTGAGGGGGGAGGGTGGGGGG - Intergenic
973762604 4:54133359-54133381 GAGAGAGAGGGGAGGGAGGGAGG + Intronic
974000496 4:56506508-56506530 CTGCGTGTGGGGAGGGTTCGGGG - Intronic
974405283 4:61460525-61460547 CAGAGACAGGGAAGGGTGGGAGG + Intronic
974577418 4:63744748-63744770 CTGGCGGAGGGGCGGGTGGGAGG + Intergenic
974949044 4:68565468-68565490 CAGAGTGAGGGGAATATGGGAGG - Intronic
974958076 4:68667936-68667958 CAGAGTGAGGGGAATATGGGAGG - Intronic
975215009 4:71742971-71742993 CTTGGTGTGGGCAGGGTGGGGGG + Intronic
975372000 4:73599883-73599905 TGAAGTGAGGGAAGGGTGGGAGG - Intronic
975617998 4:76266591-76266613 TTGAGAGAGGGGAGCTTGGGTGG - Intronic
976324009 4:83750425-83750447 CTGAGGGAGGCCAAGGTGGGTGG + Intergenic
976612827 4:87047382-87047404 CTTTTTGAGGGGAGGGAGGGAGG - Exonic
977509530 4:97945207-97945229 CTTAGAAAGGGGAGGGTGGGAGG - Intronic
979768164 4:124488479-124488501 CGGAAGGAGGGGAGGGAGGGAGG + Intergenic
980355652 4:131729993-131730015 CTGAGTAAGGGGGGGTGGGGCGG + Intergenic
980963803 4:139501426-139501448 CTCAGAAGGGGGAGGGTGGGAGG + Intronic
981178417 4:141709918-141709940 TAGTGTGGGGGGAGGGTGGGAGG - Intronic
981531725 4:145760831-145760853 TTGGGTGAGGGGATGCTGGGAGG + Exonic
981554735 4:145980564-145980586 ATGACAGAGGGGAAGGTGGGGGG + Intergenic
981696747 4:147566589-147566611 CTCAGTGAGGCTAAGGTGGGAGG - Intergenic
981733292 4:147922233-147922255 GAGAGTGAAGGGAGGGAGGGAGG + Intronic
982181307 4:152751011-152751033 GTGAGTGGGGGGAGGGAGGAGGG + Intronic
983027422 4:162755549-162755571 CTGGGTGAGGGAAGGCAGGGTGG - Intergenic
983455511 4:167958271-167958293 GAGAGTGAGGCGAGGGTAGGGGG + Intergenic
983846877 4:172531684-172531706 CTGGCTGAGGGGAGAGAGGGTGG + Intronic
983851986 4:172592412-172592434 CCCAGTGTGGGGATGGTGGGAGG - Intronic
983957582 4:173715867-173715889 CTGGTTGGGGGGAGGCTGGGCGG + Intergenic
983996425 4:174188223-174188245 CTTGGAGAGTGGAGGGTGGGAGG + Intergenic
984222459 4:176994712-176994734 GGGAGTGAGGGGAGGGGAGGGGG - Intergenic
984248548 4:177305052-177305074 GTGAGTGAGTGGTGGGTGAGTGG - Intergenic
984296718 4:177862561-177862583 CGTGGTGAGCGGAGGGTGGGGGG - Intronic
984893553 4:184515200-184515222 CTGTCTGATGGGAGGATGGGAGG - Intergenic
985132033 4:186748441-186748463 TTTAGTGAGTGGAGGGTGGGAGG - Intergenic
985256150 4:188071875-188071897 AGGAGTGAGGTGAAGGTGGGAGG + Intergenic
985459840 4:190094664-190094686 CTTGATGGGGGGAGGGTGGGAGG + Intergenic
985761518 5:1751546-1751568 GTGAGGGAGGGGAGGGCGAGGGG - Intergenic
985808871 5:2068672-2068694 GTGAGTCAGTGGAGGGTGGGAGG + Intergenic
985905439 5:2831503-2831525 CTAAGTGTGCGGTGGGTGGGAGG + Intergenic
986310025 5:6544785-6544807 CTGAGGGTGGGGACGGTGGGGGG - Intergenic
986530101 5:8726991-8727013 GAGAGGGAGGGGAGGGAGGGAGG + Intergenic
986602069 5:9482460-9482482 CTGGGTGAGTGGAAGGTGGGAGG + Intronic
986687501 5:10287481-10287503 CTCAGAAGGGGGAGGGTGGGAGG + Intronic
987061678 5:14249380-14249402 CAGAGTGAGTGGAGTGGGGGAGG + Intronic
987132236 5:14871168-14871190 ATAATTGAGGGGAGGGAGGGAGG + Intronic
987132958 5:14875711-14875733 CTTGGTGAGGGGTCGGTGGGGGG - Intergenic
989011430 5:36876828-36876850 CGGAGGGAGGGGGGGGAGGGCGG - Exonic
989082286 5:37635814-37635836 ATGTGTCATGGGAGGGTGGGAGG + Intronic
989209968 5:38848551-38848573 CTGAGTGGGAGGAGGGAGGATGG - Intronic
989329149 5:40235329-40235351 CTGAGGGAGGGTAGGGGCGGTGG - Intergenic
990042432 5:51390122-51390144 CTGAGGGCGGGGAAGCTGGGAGG + Intronic
990287213 5:54311662-54311684 CTGAGGGTGGGGATGGGGGGGGG - Intergenic
992135113 5:73736836-73736858 GTTGGTGAGGGGAGGGAGGGAGG + Intronic
992187444 5:74257716-74257738 CTGAGTGTGGGAAGGGTCAGGGG + Intergenic
992403612 5:76434340-76434362 CTCAGAAAGAGGAGGGTGGGAGG - Intronic
992498935 5:77322518-77322540 GTGACTGAAGGGAGGGTGTGAGG - Intronic
992785150 5:80163096-80163118 CTTTGGGAGGGCAGGGTGGGTGG - Intronic
993384700 5:87251061-87251083 CTGTGTGGGGGGATGGGGGGTGG - Intergenic
995294419 5:110502672-110502694 GTGAGTGAGGGGAAAGTGGAAGG - Intronic
995815002 5:116158153-116158175 CGGAGGGAGAGGAGGGAGGGAGG - Intronic
996151493 5:120041439-120041461 ATCAGAGAGTGGAGGGTGGGAGG + Intergenic
996262238 5:121486359-121486381 CTCAGAGAGGAGAGAGTGGGAGG + Intergenic
996410522 5:123153945-123153967 TTGAGGGAAGGGAGGGTAGGGGG + Intronic
996595081 5:125191455-125191477 CGGATTGAGAGGAGGGAGGGAGG - Intergenic
996614366 5:125422725-125422747 CAGAGGGAGGTGGGGGTGGGAGG - Intergenic
997363540 5:133310909-133310931 CTCAGTGAGGGGAGGTGGGTGGG + Intronic
997424052 5:133791036-133791058 GTGAGTGAGGGGACTGTGGTAGG - Intergenic
997531279 5:134582740-134582762 CAGTTTGAGGGGACGGTGGGGGG + Exonic
998567781 5:143231472-143231494 GTGCCTGAGTGGAGGGTGGGAGG - Intergenic
999150440 5:149422931-149422953 CTGCCGGAGGGGAGGGTGAGGGG - Intergenic
999230948 5:150061468-150061490 GTGAGTGAGGGGAGGGGATGAGG - Intronic
999236915 5:150104014-150104036 CTGACTTAGGGGTGGGAGGGGGG + Intronic
999267401 5:150275909-150275931 CTCAGGGAGGGGAGGGGGGCTGG - Intronic
999269597 5:150289036-150289058 CTGAGAAAGGGGAGGTAGGGAGG + Intronic
999288283 5:150407097-150407119 CTGAGTTGAGGGATGGTGGGAGG + Intronic
999370508 5:151052318-151052340 CTGAGCTAGAGGATGGTGGGGGG + Intronic
999400273 5:151258893-151258915 CTGGGAGAGGTGAGAGTGGGTGG + Intronic
999982870 5:156974856-156974878 AAGAGTGGGGGGAGGGAGGGAGG + Intergenic
1001058622 5:168469687-168469709 ATGAGTGAGGGGAGGGCTGTGGG + Intronic
1001089464 5:168726530-168726552 GGGAGGGAGGGGAGGGAGGGAGG + Intronic
1001110690 5:168893712-168893734 GTGAGTGAGGGGGAGGTGGCAGG + Intronic
1001129580 5:169052869-169052891 CAGAGTGGGGTGAGGGAGGGTGG - Intronic
1001168742 5:169395972-169395994 TTTAGAGAGTGGAGGGTGGGAGG - Intergenic
1001273040 5:170330044-170330066 GTCAGTGAGGGGTGGGTAGGGGG + Intergenic
1001597658 5:172908316-172908338 GGGAGAGAGGGGAGGGGGGGAGG + Intronic
1001663463 5:173413474-173413496 CTGGGTGAGGGGATGGTGGGGGG + Intergenic
1001681253 5:173558542-173558564 CTGAGTCAGGGGTGGGAGGAAGG + Intergenic
1001842348 5:174889129-174889151 CTCGGAGAGCGGAGGGTGGGAGG - Intergenic
1001993679 5:176136582-176136604 ATCAGAGAGTGGAGGGTGGGAGG - Intergenic
1002077823 5:176719638-176719660 CTGAGGGAAGGGATGGTGGTGGG - Intergenic
1002210468 5:177595883-177595905 GTGTGTGAGTTGAGGGTGGGTGG + Exonic
1002273639 5:178089359-178089381 GTGAGAGAGGTGAGGGTGGTGGG - Intergenic
1002506387 5:179682005-179682027 CTTTGGGAGGGGAAGGTGGGTGG + Intronic
1002922866 6:1585575-1585597 CAGAATGTGGGGAGAGTGGGGGG - Intergenic
1003400885 6:5789904-5789926 ATCAGAGAGTGGAGGGTGGGAGG - Intergenic
1003571423 6:7258748-7258770 GTGAGTGAGGGCAGGAGGGGAGG + Intergenic
1003837559 6:10088029-10088051 CTCAGGAAGGGGTGGGTGGGAGG - Intronic
1003974714 6:11331368-11331390 CAGGGTGAGGCGGGGGTGGGGGG + Intronic
1003975165 6:11336078-11336100 CTGAGGGAGGTGAGGGCAGGAGG - Intronic
1004012449 6:11702661-11702683 CGCAGAGAGTGGAGGGTGGGAGG + Intergenic
1004030026 6:11859411-11859433 GTGAGAGAGGGGAGAGTGGAGGG + Intergenic
1004170674 6:13293330-13293352 CTCAGAAGGGGGAGGGTGGGAGG + Intronic
1004447058 6:15710145-15710167 GTGAGGGAGGGGAGGGAGGGAGG - Intergenic
1004447060 6:15710149-15710171 GTGAGTGAGGGAGGGGAGGGAGG - Intergenic
1004573403 6:16869716-16869738 CTGAAGGAGGGGTGGGTGGGAGG + Intergenic
1004939320 6:20539659-20539681 ATGACTGAGGGGAGCGTGGTAGG + Intronic
1005899393 6:30204825-30204847 CTGAGTAAAGGGAGTGGGGGTGG - Intronic
1006004094 6:30988776-30988798 CTGTGTGTGGGGGGGGAGGGGGG + Exonic
1006062944 6:31439168-31439190 CTGAGTGAGTGGGCAGTGGGTGG + Intergenic
1006322890 6:33330865-33330887 CTGAGGGAGGGGAGGGGGAACGG + Intergenic
1006384195 6:33720122-33720144 ATGGGTGAGGGGAGGGCGGGTGG - Intergenic
1006407476 6:33853557-33853579 CTGAGTGAGTGGTGGGTGCAGGG + Intergenic
1006441309 6:34055445-34055467 GTGAGTGTGATGAGGGTGGGTGG - Intronic
1006507515 6:34498976-34498998 CAGGGTTAGGGGAGGGTTGGGGG + Intronic
1006509141 6:34512347-34512369 CTGACGGAGGGGTGGGTGGGAGG + Intronic
1006510801 6:34520083-34520105 GTGAGTGATGGGAGGGAGGATGG + Intronic
1006731394 6:36238974-36238996 CTGATTGAGAGGATGGTGAGGGG + Intergenic
1006782940 6:36644333-36644355 CTGAGTGAGTGGAGTTTGGGAGG - Intergenic
1007060758 6:38938586-38938608 GTCAGAGAGTGGAGGGTGGGAGG + Intronic
1007163781 6:39813492-39813514 CTGAGTGAGCAGAGTGTGTGTGG + Intronic
1007224418 6:40302863-40302885 CTGTGTGAGGGGAGGGCTGGTGG + Intergenic
1007293092 6:40801801-40801823 CTAAGTGAAGAGAGGGTGGCAGG + Intergenic
1007371084 6:41427542-41427564 CTGGGAGAGGGGAAGCTGGGGGG + Intergenic
1007656952 6:43456125-43456147 TTGAGGGAGGGAAGGGTGGTGGG - Exonic
1007720567 6:43882796-43882818 CTGAGTGAGGAGAGGGTGGCAGG - Intergenic
1007722710 6:43894801-43894823 GTGAGTGAGAGGAGGGAGAGGGG + Intergenic
1007938848 6:45758022-45758044 CTGAGAGAGGAGAGGGTAAGGGG + Intergenic
1008273367 6:49515919-49515941 GAGAGGGAGGGGAGGGAGGGAGG - Intronic
1008436083 6:51478081-51478103 TTGACTCAGGGGATGGTGGGGGG + Intergenic
1008608702 6:53166211-53166233 CCAAAAGAGGGGAGGGTGGGAGG + Intergenic
1008709090 6:54201591-54201613 CTAAAAGAGTGGAGGGTGGGTGG - Intronic
1008876317 6:56333292-56333314 CCTAGGAAGGGGAGGGTGGGAGG - Intronic
1009951570 6:70402936-70402958 CTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1010708284 6:79140329-79140351 ATTAGAGAGTGGAGGGTGGGAGG + Intergenic
1011149096 6:84249343-84249365 GTAAGAGAGTGGAGGGTGGGAGG - Intergenic
1011241806 6:85279681-85279703 ATGTGTGGGGGGTGGGTGGGTGG - Intergenic
1011396849 6:86919291-86919313 CTGATTGACTGGAGGGTGGTGGG - Intergenic
1011493375 6:87915348-87915370 ATGTGTGTGTGGAGGGTGGGAGG + Intergenic
1011862492 6:91777128-91777150 ACTAGAGAGGGGAGGGTGGGAGG + Intergenic
1011870985 6:91892281-91892303 CTGAGTGAGGGAATGGGAGGAGG - Intergenic
1012467436 6:99531109-99531131 CTGAGTGATGGGGGTGGGGGGGG - Intergenic
1012565339 6:100642013-100642035 CGGAGTGGGGGGAGGGGGGAGGG + Intronic
1012806519 6:103901155-103901177 TTGAGTGAGGTGTGGGTGGTGGG + Intergenic
1012896719 6:104957382-104957404 CTGCGTGATGGGGGGTTGGGAGG - Intronic
1013044301 6:106469089-106469111 CAGAGTGAGGGGTGAGTGGTGGG - Intergenic
1013074103 6:106755244-106755266 CTGTGTGAGGGGATCCTGGGTGG + Intergenic
1013304816 6:108838369-108838391 CTGAGTGAGGGAGGTGTGCGAGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013403401 6:109820414-109820436 CTGAGTGATGGGAGACTTGGGGG - Intronic
1013836350 6:114341153-114341175 GGGAGAGAGGGGAGGGAGGGAGG + Intronic
1014903840 6:127002624-127002646 CAGAGTGAGAGGAGGGTGGTTGG - Intergenic
1015047625 6:128795314-128795336 ATGAGAGGGTGGAGGGTGGGAGG + Intergenic
1015093326 6:129385137-129385159 GGGAGGGAGGGGAGGGAGGGAGG + Intronic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015211191 6:130701140-130701162 CTGAAAGAGGGGAGGGAGGAAGG + Intergenic
1015319245 6:131853668-131853690 GTGTGTGAGGGTAAGGTGGGAGG + Intronic
1015480246 6:133700638-133700660 CTGGGATTGGGGAGGGTGGGAGG - Intergenic
1015592368 6:134834073-134834095 GTGGGTTAGGGGAGGGAGGGAGG + Intergenic
1015702431 6:136051121-136051143 GTGAGTGAGGGGAGTGGGGGCGG + Intronic
1015840653 6:137473415-137473437 CAGAGGGAGGGGAGGGGCGGAGG + Intergenic
1016038637 6:139409469-139409491 CTGAGTGAGGGATGAGTGAGGGG - Intergenic
1016385972 6:143531250-143531272 CTCAGAAAGGGGAGGGTGAGAGG + Intergenic
1016438694 6:144063116-144063138 CTGAGTGAGAGGAGTGTGGCAGG - Intronic
1017032724 6:150238372-150238394 AGGAGAGAGGAGAGGGTGGGAGG + Intronic
1017074686 6:150606888-150606910 CAGAGTTGGGAGAGGGTGGGAGG - Intronic
1017102620 6:150862218-150862240 CTTGGTGAGGGGAGTGTGGCAGG - Intergenic
1017147743 6:151249999-151250021 CTTCGGGAGGTGAGGGTGGGAGG + Intronic
1017643378 6:156515871-156515893 GTGAGTGAGGCAAAGGTGGGTGG - Intergenic
1017674223 6:156797010-156797032 GTGAGTCAGGGTTGGGTGGGTGG + Intronic
1017841170 6:158224188-158224210 CTGAGGCAGGGGAGGGCTGGAGG - Intergenic
1017884331 6:158586702-158586724 CTTTGGGAGGGTAGGGTGGGAGG + Intronic
1018036588 6:159887455-159887477 ATGATTGAGGGGAGGCTGGGGGG + Intergenic
1018315564 6:162553364-162553386 AAGAGGCAGGGGAGGGTGGGAGG + Intronic
1018326707 6:162677980-162678002 ATGGGTGAGTGGAGGGTGGGAGG - Intronic
1018625664 6:165776648-165776670 AGGAGAGAGGAGAGGGTGGGAGG - Intronic
1018813777 6:167316479-167316501 GGGAGTGGGGGAAGGGTGGGGGG - Intergenic
1018833253 6:167462561-167462583 CTGTGTGCTGGGAAGGTGGGAGG + Intergenic
1018861875 6:167716838-167716860 ATCAGAGAGTGGAGGGTGGGAGG + Intergenic
1018890132 6:167977067-167977089 CTGAGTGGGGGGAGGGAGGAGGG + Intergenic
1018906799 6:168080273-168080295 CTGAGCGGAGGGAGGGAGGGAGG - Intronic
1018910401 6:168098292-168098314 CTCGGTGGGGGGAGTGTGGGAGG - Intergenic
1018916715 6:168136722-168136744 CAGAGTGTGGGGAGGGTTGTAGG + Intergenic
1018935929 6:168274077-168274099 CTGGGTGCGGGGGGGGGGGGGGG + Intergenic
1019172470 6:170141118-170141140 ATGAGTGAGTGGAGAGTGAGTGG - Intergenic
1019172496 6:170141310-170141332 ATGAGTGAGTGGAGAGTGAGAGG - Intergenic
1019193083 6:170265098-170265120 ATGAGTGAGTGGAGAGTGAGTGG + Intergenic
1019202268 6:170327650-170327672 ATGAGTGAGTGGAGAGTGAGTGG + Intronic
1019360618 7:602539-602561 CTGGGAGAGGTGAGGGTGTGAGG - Intronic
1019557207 7:1638527-1638549 CTGAGAGGAGGGAGGGAGGGAGG + Intergenic
1019656087 7:2196878-2196900 CGAAGTGTGGGGAGGGTGGGCGG - Intronic
1019666395 7:2254130-2254152 GTGCGTGACGGGAGGCTGGGAGG + Exonic
1019703615 7:2487280-2487302 ATGGGTGGGGGGAGGGAGGGAGG + Intergenic
1019870292 7:3754668-3754690 CTAAGTAAGGGGAAGGGGGGTGG + Intronic
1019919999 7:4157383-4157405 AGGAATGAGGGGAGGGAGGGAGG + Intronic
1019935008 7:4249091-4249113 GTGAGTGTGGGGAGGGAGGGAGG + Intronic
1020177907 7:5897592-5897614 CTGATTGACGGGGGGGGGGGGGG + Intergenic
1020569772 7:9844744-9844766 CTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1021639941 7:22727331-22727353 CTGTGTGAGGGAGGGGTGTGTGG + Intronic
1021673948 7:23061690-23061712 CTGCTTGGGGGGGGGGTGGGAGG + Intergenic
1021911099 7:25386573-25386595 CTGAGAGAGGGGAGAGTGACTGG + Intergenic
1022090554 7:27105291-27105313 CTGAGGGAGGGGTGGTTTGGAGG - Intergenic
1022091985 7:27113873-27113895 GTGGGGGAGGGGTGGGTGGGTGG - Intronic
1022109434 7:27219504-27219526 CTGAGTTGGGGGAAGGGGGGAGG + Intergenic
1022508126 7:30919288-30919310 TTCAGTGAGGGCATGGTGGGTGG + Intronic
1022511222 7:30935880-30935902 CTGGGGAAGGGGAGGGTTGGTGG + Intergenic
1022694974 7:32696105-32696127 TGGAGTGAGGGGAGGGGGGAGGG - Intergenic
1022723737 7:32962872-32962894 AGGAGTGAGGGGTGGGAGGGTGG + Intronic
1022830323 7:34059387-34059409 CTGGGGGAGGGGATGGTGGGGGG + Intronic
1022909360 7:34885218-34885240 CTGAGTGAGGGTGGTGTGGGAGG - Intergenic
1023000563 7:35802785-35802807 ATGAGTAAGGGGTGGTTGGGTGG + Intronic
1023152202 7:37212766-37212788 CTGTGTGAGGGTAGAGTGAGAGG - Intronic
1023873523 7:44275134-44275156 CTGAGCCAGGGAAGGGAGGGAGG - Intronic
1023953307 7:44865396-44865418 TTTAGTGAGGGAAGGGTGAGGGG - Intergenic
1024061145 7:45699602-45699624 CTGGGGGACGGGAGGGTGGGAGG + Intronic
1024072563 7:45798749-45798771 ATGAGAGAGGGGAGGGAAGGGGG + Intergenic
1024232538 7:47373605-47373627 CTCAGTGAGGAAAGGGTGGTAGG - Intronic
1026019813 7:66698095-66698117 CTGAGGGTGGGGGGGGTGCGTGG - Intronic
1026166862 7:67917909-67917931 CTGAAAGGTGGGAGGGTGGGTGG - Intergenic
1026179785 7:68028789-68028811 CGGAGGGAAGGGAGGGAGGGAGG - Intergenic
1026338431 7:69414563-69414585 TTCAGAGAGTGGAGGGTGGGAGG - Intergenic
1026464856 7:70645226-70645248 ATGAATGAGGGGAGGTTGGGAGG - Intronic
1026785744 7:73300672-73300694 CTGTCTGAGGAGAGGTTGGGCGG + Intergenic
1027053150 7:75032215-75032237 CTGGGAGTGGGGACGGTGGGGGG + Intronic
1027108321 7:75419264-75419286 CTGTCTGAGGAGAGGTTGGGTGG - Intronic
1027923345 7:84426069-84426091 CTCAGGAAGGGAAGGGTGGGAGG + Intronic
1027988658 7:85329858-85329880 GTGGGTGGGGGGAGGGTGGAGGG - Intergenic
1028513437 7:91650216-91650238 TGGAGTGGGGGGAGGGGGGGAGG + Intergenic
1028581982 7:92418106-92418128 GAGAGGGAGGGGAGGCTGGGTGG - Intergenic
1028713181 7:93934394-93934416 TTGAGTTAGGGGTGGGTGGAAGG - Intergenic
1029131368 7:98333732-98333754 CTTAGTTTGGGGAGGGTGGGCGG - Intronic
1029200712 7:98837384-98837406 CTGTGTGGGGAGAGGGTGGCTGG + Intergenic
1029238392 7:99142669-99142691 GGGAGTGAGAAGAGGGTGGGTGG + Intronic
1029484096 7:100828794-100828816 CTAACTGATGGGAGGGTGAGGGG - Intronic
1029549742 7:101231457-101231479 CTGAGGCGGGGGAGGGGGGGTGG - Intergenic
1029609409 7:101618723-101618745 CTGCGTGAGAGGCTGGTGGGAGG - Intronic
1029930345 7:104364248-104364270 CACAGTGTGGTGAGGGTGGGGGG + Intronic
1029943831 7:104510895-104510917 ATCAGAGAGTGGAGGGTGGGAGG + Intronic
1030166762 7:106562978-106563000 GTGAGGGAGGGGAGGGAGTGAGG + Intergenic
1030238795 7:107296147-107296169 GAGAGAGAGGGGAGGGAGGGAGG - Intronic
1031003328 7:116443164-116443186 CTGAGAGAGGTGAAGGAGGGAGG + Intronic
1031567344 7:123317129-123317151 CAAAAGGAGGGGAGGGTGGGAGG + Intergenic
1031737944 7:125390380-125390402 CTCAGTGGGTGGAGAGTGGGAGG + Intergenic
1031898274 7:127379846-127379868 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
1032054367 7:128672642-128672664 CTGGGGGAGGGGGGGGCGGGGGG + Intronic
1032057204 7:128693357-128693379 CGGAGTGAGAGGAGGGATGGAGG - Intergenic
1032086433 7:128886379-128886401 CTGGCTGAGGGGAGGGAGGTGGG + Intronic
1032168786 7:129566908-129566930 CTGTGGTAGGGGATGGTGGGGGG - Intergenic
1032197960 7:129800043-129800065 ATGAGGGAGAGGAGTGTGGGTGG + Intergenic
1032268585 7:130384716-130384738 TGCAGTGAGGGGAGGGTTGGGGG + Intronic
1032437603 7:131913057-131913079 CAGTGTGAGGTGAGGGTGAGGGG + Intergenic
1032455537 7:132070674-132070696 GTGGCGGAGGGGAGGGTGGGCGG - Intergenic
1032464908 7:132137990-132138012 ATGAGTGGGGGATGGGTGGGAGG + Intronic
1032465938 7:132145096-132145118 GTGAGTGAAGGGAGGGCAGGGGG - Intronic
1032496824 7:132368979-132369001 CTGAATTAGGGGAGGGTGGATGG - Intronic
1032582554 7:133116863-133116885 GTGTGTGTGGGGAGGGGGGGCGG - Intergenic
1032689005 7:134263941-134263963 CTGAGGGATTGGAGGGAGGGTGG - Exonic
1032989819 7:137381300-137381322 CGAAGTGGAGGGAGGGTGGGTGG - Intronic
1033150509 7:138910794-138910816 CTGAGGCAGAGGAGGTTGGGAGG - Intronic
1033206590 7:139428383-139428405 CTGAGTGGGAGGGTGGTGGGTGG - Intergenic
1033551579 7:142452376-142452398 CTGAGTGAGTGATGAGTGGGTGG + Intergenic
1033556097 7:142489554-142489576 CTGAGTGAGTGATGAGTGGGTGG + Intergenic
1033558466 7:142509000-142509022 CTGAGTGAGTGATGAGTGGGTGG + Intergenic
1033563197 7:142553643-142553665 TTGAGAGAGTGGAGGCTGGGTGG - Intergenic
1033597054 7:142865870-142865892 AGGAGCCAGGGGAGGGTGGGTGG - Intronic
1033707903 7:143906362-143906384 GACAGTGAGGTGAGGGTGGGAGG + Intergenic
1034030900 7:147762718-147762740 ATAAGTGGGGGGAGGGAGGGAGG + Intronic
1034101395 7:148453696-148453718 ATCAGAGAGTGGAGGGTGGGAGG + Intergenic
1034277384 7:149829786-149829808 GTGACTGAGGGGACTGTGGGGGG - Intergenic
1034277412 7:149829865-149829887 GTGACTGAGGGGACTGTGGGGGG - Intergenic
1034277571 7:149830396-149830418 GTGACTGAGGGGACTGTGGGGGG - Intergenic
1034277659 7:149830701-149830723 GTGACTGAGGGGACTGTGGGAGG - Intergenic
1034277711 7:149830896-149830918 GTGACTGAGGGGACTGTGGGAGG - Intergenic
1034299005 7:149998890-149998912 CTGAGGGAGTGGTGGGAGGGAGG - Intergenic
1034450249 7:151133427-151133449 CCGAGTGCAGGGAGGGAGGGTGG - Intronic
1034807011 7:154097883-154097905 CTGAGGGAGTGGTGGGAGGGAGG + Intronic
1034981004 7:155476432-155476454 CTGAGTGAGGGAAGGGTGTGTGG - Intronic
1035239710 7:157521579-157521601 CTGAGTGTGGCGAGGGCTGGTGG + Intergenic
1035407614 7:158609832-158609854 GTGTGTGAGGGGAGTGTGAGGGG + Intergenic
1035453114 7:158991875-158991897 CTGAGGGAGGGGAGGGAGGGAGG + Intergenic
1035782512 8:2239655-2239677 CCCAGAGAGGGGAGGGTGGCAGG - Intergenic
1035809608 8:2479933-2479955 CCCAGAGAGGGGAGGGTGGCAGG + Intergenic
1036040695 8:5077090-5077112 CTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1036740315 8:11355202-11355224 CTGCCTGTAGGGAGGGTGGGGGG + Intergenic
1037062542 8:14532706-14532728 GTGTGTGGGGGGAGGGCGGGGGG + Intronic
1037703508 8:21296043-21296065 CTGGGTGAGATGAGGGAGGGAGG - Intergenic
1037734602 8:21556175-21556197 CTGAGTGGCAGGAGGGTGTGTGG - Intergenic
1037817825 8:22121042-22121064 GTGAGTGAGGGCACGGAGGGAGG - Intronic
1037883782 8:22585823-22585845 CTGAGTCAGAGGAGGAAGGGAGG - Intronic
1037949078 8:23007143-23007165 CTGAGTGAGGGGGAGCTGGGGGG + Exonic
1038008773 8:23457515-23457537 GTGGGTGAGGGGAGGGCGGGCGG - Intronic
1038040770 8:23722428-23722450 CTGGGTGGGGGCGGGGTGGGGGG + Intergenic
1038179218 8:25210868-25210890 CTGAATGAGGGGAGGGGGAAGGG + Intronic
1038476928 8:27875182-27875204 AGGAGTGAAGGGAGGGAGGGAGG - Intronic
1038543111 8:28405251-28405273 CAGAGTGAATGGAGGGTTGGAGG + Intronic
1038773748 8:30509259-30509281 CTGAGAGAGGGAAGGGAGGAGGG - Intronic
1038950480 8:32408884-32408906 CAGAAAGATGGGAGGGTGGGAGG - Intronic
1040656796 8:49519772-49519794 CTGTGGGAGGCCAGGGTGGGAGG - Intergenic
1040719856 8:50306044-50306066 CTCAGAAGGGGGAGGGTGGGAGG - Intronic
1040812830 8:51475769-51475791 GTGAGGGAAGGGAGGGAGGGGGG - Intronic
1040983556 8:53269523-53269545 CTCAGGGAGGAGAGGGTGGAAGG + Intergenic
1041030337 8:53729855-53729877 CTGAGTGAAGCCAGAGTGGGAGG - Intronic
1041274815 8:56146292-56146314 TTGAGTGGGGGGAGGGCGGAGGG - Intergenic
1041969085 8:63716204-63716226 ATGAGAGGGTGGAGGGTGGGAGG - Intergenic
1042175202 8:66031767-66031789 CACAGTGAGGGTGGGGTGGGGGG + Intronic
1042192266 8:66198916-66198938 ATGTGTGAGGTGGGGGTGGGTGG - Intergenic
1042339720 8:67666410-67666432 CTGAGAGAGGGGTGGGGAGGGGG + Intronic
1042859434 8:73297612-73297634 CTGAGTTAGGGGTGGCGGGGGGG - Intronic
1043387984 8:79767366-79767388 CTGAGTGCGGGGAGGGTGTGGGG - Intronic
1043508478 8:80926119-80926141 GTGAGGGAGGAGAGAGTGGGAGG - Intergenic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1043692605 8:83174381-83174403 CTGAGCGATGGGATGGTGGAGGG - Intergenic
1044192504 8:89335697-89335719 CTGGGTCAGGGGAGGGAGGTGGG - Intergenic
1044472777 8:92590032-92590054 CAGAGGGAGGGGAGGGTGTATGG - Intergenic
1045535925 8:103027835-103027857 GTGTGTGCAGGGAGGGTGGGAGG - Intronic
1045723293 8:105139674-105139696 ATGTGTGTGGGGAGGGTGGTGGG + Intronic
1046011805 8:108557501-108557523 CTGGGGGATGGGAGGGTGGTTGG + Intergenic
1046130103 8:109956117-109956139 CTGAGTGGGGGGAGGGGGGAGGG - Intergenic
1046388563 8:113537237-113537259 ATCAGAGAGTGGAGGGTGGGAGG - Intergenic
1046507446 8:115154361-115154383 CTGGGTGATGGTGGGGTGGGAGG - Intergenic
1046975838 8:120276352-120276374 CTCAGAGTGGGGAGGGTGGAAGG + Intronic
1047525938 8:125634089-125634111 CACAGTGAGGGGAGGGCGGGTGG - Intergenic
1047705295 8:127493178-127493200 CAGAGGGAGGTGAGTGTGGGAGG + Intergenic
1048517816 8:135126396-135126418 CTCAGGGAGGGGGAGGTGGGAGG - Intergenic
1048786966 8:138060850-138060872 CTGAATGTGGGGGGTGTGGGGGG + Intergenic
1048823640 8:138402021-138402043 GTGTGTGTGAGGAGGGTGGGAGG + Intronic
1048920022 8:139219672-139219694 CTGAATGAAGAGAGGGAGGGAGG - Intergenic
1049094600 8:140540935-140540957 CAGAGGGAGGGGAGGAGGGGCGG - Intronic
1049291374 8:141804374-141804396 CTAAGTGAGTGGATGCTGGGCGG - Intergenic
1049406966 8:142455896-142455918 CTCTGTGACAGGAGGGTGGGTGG + Intronic
1049554166 8:143274032-143274054 CTTGGTGGGGGCAGGGTGGGGGG - Intronic
1049698298 8:143994344-143994366 GTGAGGCAGGGGAGGTTGGGAGG - Intronic
1049706948 8:144047418-144047440 CTGGGTGAGGGGCGGGGAGGGGG + Intergenic
1049761668 8:144334474-144334496 GAGGGGGAGGGGAGGGTGGGTGG - Intronic
1049783469 8:144439492-144439514 CTGACTGAGTGGTGGGTGGCAGG - Intronic
1049794989 8:144493147-144493169 GGCAGTGAGGGGACGGTGGGTGG + Intronic
1050170423 9:2810088-2810110 GAGAGTGAGGGGGCGGTGGGGGG + Intronic
1050323096 9:4473636-4473658 ATCAGAGAGTGGAGGGTGGGAGG + Intergenic
1050366365 9:4877221-4877243 TCGAGGGAGGGGAGGGAGGGGGG + Intronic
1050624044 9:7484868-7484890 CTGTTGGAGGGTAGGGTGGGAGG + Intergenic
1050727856 9:8672839-8672861 CTCTGTGTGGGGGGGGTGGGTGG + Intronic
1051002957 9:12307401-12307423 CGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1051154231 9:14123003-14123025 CTGTGGGAGGTCAGGGTGGGTGG + Intronic
1051459321 9:17294773-17294795 GGGAGTGAGGGGAGGGAGGGGGG + Intronic
1051459387 9:17294894-17294916 GGGAGTGGGGGGAGGGCGGGGGG + Intronic
1051563890 9:18474076-18474098 CTGACCGAGGGGTGGGTGGGTGG - Exonic
1051664416 9:19455347-19455369 CTTTGGGAGGGGAAGGTGGGTGG + Intergenic
1051680554 9:19603490-19603512 CAGGGTGAGGGGAGGGAGGGGGG + Intronic
1051695225 9:19760913-19760935 CCGGGTGGGGGGAGGGTGGAGGG + Intronic
1051718076 9:20006331-20006353 GTGGGTGAGGGGAGGGGGGATGG + Intergenic
1052315633 9:27113819-27113841 ATAAGTGAGGGGAGGGTAGATGG - Intronic
1052793070 9:32895642-32895664 CTTAGAGGGTGGAGGGTGGGAGG - Intergenic
1053102245 9:35380773-35380795 CTGACTGTGGGGAGGGATGGGGG + Intronic
1053233283 9:36430057-36430079 CTGGGTGAGAGTAGGGTAGGAGG - Intronic
1053291474 9:36882312-36882334 CTGAGTGGAGCGAGGGTGGCTGG - Intronic
1053409115 9:37904201-37904223 CCGAGGGAGGGGAGGCGGGGCGG - Intronic
1053447559 9:38164668-38164690 ATGAGTGGGCGGGGGGTGGGGGG - Intergenic
1053533610 9:38905121-38905143 CTGAATGAGGGGAGCCTGGCAGG - Intergenic
1053664146 9:40305738-40305760 TAGAGTGGTGGGAGGGTGGGTGG + Intronic
1053665113 9:40311943-40311965 TAGAGTGGTGGGAGGGTGGGTGG + Intronic
1053946348 9:43312793-43312815 ATGAGAGAAGGGAGGGAGGGAGG + Intergenic
1054205834 9:62129550-62129572 CTGAATGAGGGGAGCCTGGCAGG - Intergenic
1054376274 9:64451973-64451995 TAGAGTGGTGGGAGGGTGGGTGG + Intergenic
1054519503 9:66064341-66064363 TAGAGTGGTGGGAGGGTGGGTGG - Intergenic
1054520469 9:66070547-66070569 TAGAGTGGTGGGAGGGTGGGTGG - Intergenic
1054632526 9:67458820-67458842 CTGAATGAGGGGAGCCTGGCAGG + Intergenic
1055152583 9:73020465-73020487 CTGAGTTAGGGGATGGTTGAAGG + Intronic
1055535989 9:77245021-77245043 ATGAGTGAGGGGAGAGTGGAGGG + Intronic
1055738918 9:79364372-79364394 ATGACTGAAGTGAGGGTGGGTGG - Intergenic
1055782527 9:79834737-79834759 GTGAGAGAGGGGAGGGAGGGAGG + Intergenic
1056110231 9:83388027-83388049 CTGAGTGAGACGAAGGTGGCAGG - Intronic
1056488100 9:87079084-87079106 CTGTCGGAGGGCAGGGTGGGTGG + Intergenic
1056992426 9:91423986-91424008 CTGAGGGCGGGGAGGCGGGGCGG - Intergenic
1057142939 9:92738508-92738530 TTGAGAGTGGGGAGGGAGGGGGG - Intronic
1057641780 9:96830583-96830605 CTGTGGCAGGGGAGGTTGGGGGG - Intronic
1057702886 9:97376379-97376401 CTGAGTTCAGTGAGGGTGGGAGG + Intronic
1058098371 9:100889291-100889313 CTGGGTGGGGGGATGGAGGGAGG - Intergenic
1058346530 9:103970190-103970212 GTGAGAGAGGGGAAGGTGGGGGG - Intergenic
1058445791 9:105053776-105053798 CTGAGTGAGGAGATGGGAGGAGG - Intergenic
1058657838 9:107240570-107240592 CTTTGTGAGGGGGAGGTGGGTGG + Intergenic
1058944172 9:109841541-109841563 GAGATGGAGGGGAGGGTGGGGGG + Intronic
1058944215 9:109841649-109841671 GGGAGAGAGGGGAGGGTGGGGGG + Intronic
1058944289 9:109841843-109841865 GGGAAAGAGGGGAGGGTGGGGGG + Intronic
1058989589 9:110242141-110242163 ATGAGTGAGGTGAGGATGGGAGG - Intergenic
1059027125 9:110646748-110646770 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
1059099733 9:111458633-111458655 GAGAGGGAGAGGAGGGTGGGGGG + Intronic
1059252177 9:112895613-112895635 ATGAATGATGGGTGGGTGGGTGG - Intergenic
1059341236 9:113598680-113598702 ATGAGTAAGGGGAGGCAGGGAGG - Intergenic
1059398806 9:114055571-114055593 CTGAGTGGGGGGTGGGGAGGAGG - Exonic
1059414293 9:114153930-114153952 CCGAGAGAGGGGAGGTAGGGGGG - Intergenic
1059423869 9:114208908-114208930 CAGAGTGAGGAAAGGCTGGGAGG + Intronic
1060756189 9:126215638-126215660 GTGAGTGAGGGGAAGGCCGGTGG - Intergenic
1061021778 9:128020386-128020408 CTAAGTTGGGGGTGGGTGGGTGG + Intergenic
1061237106 9:129349586-129349608 CTTCTTCAGGGGAGGGTGGGTGG + Intergenic
1061372983 9:130208214-130208236 GTGTGTGAGGTGGGGGTGGGGGG + Intronic
1061384841 9:130283413-130283435 CTGAGTGGGGGGTGGGTTGGGGG - Intergenic
1061389012 9:130306991-130307013 CTGATGGATGGGAGGGAGGGAGG - Intronic
1061390533 9:130315185-130315207 GGGAGGGAGGGGAGGGAGGGAGG - Intronic
1061526675 9:131170981-131171003 ATGACTGAGGGCAGGGAGGGTGG - Intronic
1061541096 9:131278100-131278122 CTGTGTGCGGGGAGCGAGGGTGG - Intergenic
1061716240 9:132520133-132520155 CTGAGTGAGAGGAGAGGGGAGGG - Intronic
1061919798 9:133776516-133776538 CCCAGTGAGGCCAGGGTGGGGGG - Intronic
1061923019 9:133792680-133792702 CTGGGTGGGGGGTGGGGGGGGGG - Intronic
1061999000 9:134206662-134206684 GAGAGGAAGGGGAGGGTGGGAGG + Intergenic
1062026289 9:134342219-134342241 CAGAGTGAGGGCAGGGGCGGGGG + Intronic
1062046167 9:134425530-134425552 CTGCGTGGCGGCAGGGTGGGGGG + Intronic
1062254278 9:135613819-135613841 CCGGGTGTGGGGAGGGTGGAGGG - Intergenic
1062352567 9:136146265-136146287 CTGAGTGAGGAGGGGGTCGGAGG - Intergenic
1062452779 9:136622524-136622546 CTGAGTGAGCCGAGGGCTGGGGG + Intergenic
1062566807 9:137167235-137167257 CAGAGGGAGGCGTGGGTGGGGGG + Intronic
1062594120 9:137290052-137290074 CTGAGGGAGGCCAAGGTGGGTGG - Intergenic
1062637384 9:137498681-137498703 CTGGGTGGGTGGAGGGTGGCTGG + Intronic
1062708729 9:137960190-137960212 CTGAGTGAGGGGGAGGGGGAGGG + Intronic
1203734798 Un_GL000216v2:126462-126484 CTTAGTGAGGCAAAGGTGGGAGG + Intergenic
1203574021 Un_KI270744v1:159770-159792 CTTGATGGGGGGAGGGTGGGAGG + Intergenic
1203589478 Un_KI270747v1:41351-41373 ATGAGAGAAGGGAGGGAGGGAGG + Intergenic
1185459495 X:328253-328275 CGGGGAGAGGGGAGGGGGGGCGG - Intergenic
1185511641 X:668258-668280 GGGAGGGAGGGGAGGATGGGAGG - Intergenic
1185547812 X:959679-959701 CTGAGTGAGGGAGGGGGGGAAGG - Intergenic
1185640771 X:1588404-1588426 CGAAGGGAGGGGAGGGGGGGAGG - Intergenic
1185749201 X:2597161-2597183 TTGTGTTTGGGGAGGGTGGGCGG + Intergenic
1185918126 X:4058855-4058877 AAGAATGAAGGGAGGGTGGGAGG + Intergenic
1185999191 X:4989229-4989251 CGGAGGGAGGGGAGGTAGGGAGG - Intergenic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186112089 X:6269200-6269222 GTGTGTGAGGGGAAGGTGAGCGG - Intergenic
1186137305 X:6533575-6533597 CTGATGGTGGGGAGGGAGGGAGG - Intergenic
1186216810 X:7309387-7309409 ATTTGAGAGGGGAGGGTGGGAGG + Intronic
1186267139 X:7844164-7844186 CTGATGGTGGGGAGGGAGGGAGG + Intergenic
1186298006 X:8169901-8169923 CTGATGGTGGGGAGGGAGGGAGG - Intergenic
1186324844 X:8466531-8466553 CTGATGGTGGGGAGGGAGGGAGG + Intergenic
1186325076 X:8467179-8467201 GTGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186481830 X:9901987-9902009 TGGAGGGTGGGGAGGGTGGGTGG + Intronic
1186583557 X:10847171-10847193 CTGAGTGTGGGGAGGCAGTGAGG - Intergenic
1186933070 X:14416056-14416078 CTGAAGGTTGGGAGGGTGGGAGG + Intergenic
1187029469 X:15470911-15470933 TTGAGTGTTGGGGGGGTGGGGGG - Intronic
1187483136 X:19676350-19676372 CTGGGTGGGGGCTGGGTGGGAGG + Intronic
1188158744 X:26774973-26774995 CTCAGAAAGGGGAAGGTGGGAGG + Intergenic
1188228014 X:27625854-27625876 ATTTGTGAGTGGAGGGTGGGAGG + Intronic
1188525574 X:31084335-31084357 CTACTGGAGGGGAGGGTGGGAGG + Intergenic
1188900542 X:35727762-35727784 ATCAGTGGGAGGAGGGTGGGAGG - Intergenic
1188976651 X:36683541-36683563 CTGAGTGAGCAGATGGTGGAAGG - Intergenic
1188992100 X:36833908-36833930 ATCAGAGAGTGGAGGGTGGGAGG + Intergenic
1189207831 X:39257025-39257047 CTGGGGGAGGGGTGGGGGGGAGG - Intergenic
1189241634 X:39529146-39529168 ATGAGGGAGGGGAGTGTGGTTGG - Intergenic
1189457650 X:41207846-41207868 ATGAGAGATGGGAGGGAGGGTGG - Intronic
1189667351 X:43370952-43370974 CAGAGAGTGGGGAGGGAGGGAGG + Intergenic
1189978448 X:46486098-46486120 CTTGGTGAGGGGAGGGGGGTTGG - Intronic
1190298023 X:49039963-49039985 CTGAGAGAGGGGAGGGGAGGGGG - Intronic
1190399204 X:50014722-50014744 CTATGACAGGGGAGGGTGGGAGG - Intronic
1190732364 X:53234344-53234366 GGGTGTGAGGGGAGGGTGGGGGG + Exonic
1191743216 X:64457742-64457764 ATTAGAGAGTGGAGGGTGGGAGG - Intergenic
1191968510 X:66787663-66787685 ATTAGAGAGTGGAGGGTGGGAGG + Intergenic
1192605776 X:72515582-72515604 GTGTGTGGGGGGGGGGTGGGGGG + Intronic
1193579539 X:83247183-83247205 GTGAGTGGGGGGAGGGGGGAGGG + Intergenic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1194089906 X:89572924-89572946 CTCAGAAGGGGGAGGGTGGGAGG - Intergenic
1194370971 X:93070922-93070944 ATGAGAGGGTGGAGGGTGGGAGG + Intergenic
1194583414 X:95704630-95704652 CTTTGTGAGGGGGGGTTGGGAGG - Intergenic
1194989929 X:100536615-100536637 CTGAGTCAGGGGTGTGGGGGTGG + Intergenic
1195346913 X:103960080-103960102 CTCAGGGGGTGGAGGGTGGGTGG + Intronic
1195360529 X:104078761-104078783 CTCAGGGGGTGGAGGGTGGGTGG - Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1196544003 X:116941421-116941443 GTGAGTGGGGGGAGGGAGGAGGG - Intergenic
1196655112 X:118209986-118210008 CGGTGTGAGGGGTGGGTGTGTGG + Intergenic
1196778102 X:119359620-119359642 CTCAGGGAGTGGAGGGTGGCAGG + Intergenic
1196830284 X:119770577-119770599 ATCAGAGAGTGGAGGGTGGGAGG - Intergenic
1197617110 X:128705517-128705539 CTGAGGCTGGGGAGGGTTGGGGG - Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1198037604 X:132817176-132817198 CTTATTGAGGGGAAGGTGGGGGG - Intronic
1198269464 X:135041627-135041649 ATGAGAGAAGGGAGGGAGGGAGG + Intergenic
1198676446 X:139136347-139136369 CTCAGAACGGGGAGGGTGGGGGG - Intronic
1198756654 X:139989145-139989167 TTGGGTGAGGGGAGGGGGGAGGG - Intergenic
1198772375 X:140144711-140144733 CTGGGTGGGGGGTGGGCGGGGGG - Intergenic
1198960145 X:142174783-142174805 CTGGGTGAGGGGTGGAGGGGAGG - Intergenic
1199435099 X:147804248-147804270 GTGAGTGAGGGGTGGGTGGAAGG + Intergenic
1199613246 X:149635176-149635198 CTGAGAGAGAAGAGGGAGGGAGG + Intergenic
1199680042 X:150217892-150217914 GGGGGTGGGGGGAGGGTGGGAGG + Intergenic
1199858110 X:151776911-151776933 CTGTGGGAGCAGAGGGTGGGTGG - Intergenic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200230198 X:154440136-154440158 ATGAGTGAGGGGAAGCTGGGTGG + Exonic
1200246978 X:154531651-154531673 CTGAGTGGGGCCAGGGTGGGAGG - Exonic
1200442557 Y:3228978-3229000 CTCAGAAGGGGGAGGGTGGGAGG - Intergenic
1200678765 Y:6182814-6182836 ATGAGAGGGTGGAGGGTGGGAGG + Intergenic
1200957535 Y:8967154-8967176 GTGAGGGACGGGAGGGAGGGAGG - Intergenic
1200984695 Y:9292642-9292664 CAGAGTGAAGGGAGGATGTGAGG - Intergenic
1200989435 Y:9335393-9335415 CTGAGGGACGGGAGGGGCGGGGG + Intergenic
1201189512 Y:11435409-11435431 CTCAGTGTGGGGTGGGTTGGGGG + Intergenic
1201307613 Y:12564075-12564097 GGGAATGAGGGGATGGTGGGAGG + Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic