ID: 1122932702

View in Genome Browser
Species Human (GRCh38)
Location 14:104942018-104942040
Sequence GGGGACAACATCCCAAAGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 184}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122932695_1122932702 0 Left 1122932695 14:104941995-104942017 CCGAGACCTCGATGGACTTGCCT 0: 1
1: 8
2: 4
3: 11
4: 79
Right 1122932702 14:104942018-104942040 GGGGACAACATCCCAAAGGATGG 0: 1
1: 0
2: 1
3: 13
4: 184
1122932692_1122932702 24 Left 1122932692 14:104941971-104941993 CCATCTTTGGCGCAGACACATCC 0: 1
1: 1
2: 8
3: 14
4: 92
Right 1122932702 14:104942018-104942040 GGGGACAACATCCCAAAGGATGG 0: 1
1: 0
2: 1
3: 13
4: 184
1122932691_1122932702 27 Left 1122932691 14:104941968-104941990 CCTCCATCTTTGGCGCAGACACA 0: 1
1: 1
2: 7
3: 11
4: 114
Right 1122932702 14:104942018-104942040 GGGGACAACATCCCAAAGGATGG 0: 1
1: 0
2: 1
3: 13
4: 184
1122932694_1122932702 3 Left 1122932694 14:104941992-104942014 CCACCGAGACCTCGATGGACTTG 0: 1
1: 7
2: 7
3: 9
4: 42
Right 1122932702 14:104942018-104942040 GGGGACAACATCCCAAAGGATGG 0: 1
1: 0
2: 1
3: 13
4: 184
1122932699_1122932702 -6 Left 1122932699 14:104942001-104942023 CCTCGATGGACTTGCCTGGGGAC 0: 1
1: 2
2: 10
3: 17
4: 104
Right 1122932702 14:104942018-104942040 GGGGACAACATCCCAAAGGATGG 0: 1
1: 0
2: 1
3: 13
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122932702 Original CRISPR GGGGACAACATCCCAAAGGA TGG Exonic
900844593 1:5086853-5086875 GGATACTAGATCCCAAAGGAAGG + Intergenic
901952511 1:12760109-12760131 GGGGAGGACATTCCAGAGGAAGG + Intronic
902257553 1:15199842-15199864 GGGCACAACAGCTCACAGGAGGG - Intronic
902481488 1:16714352-16714374 GGGGACCACAGCCCGGAGGAGGG + Intergenic
902652296 1:17844710-17844732 GGCGCCACCATCTCAAAGGAGGG - Intergenic
903590996 1:24455912-24455934 GCTGACTACATCCTAAAGGAGGG - Intronic
904538941 1:31219679-31219701 GGAGACACATTCCCAAAGGAAGG + Intronic
905036343 1:34920354-34920376 GGTGACAAGATCCAAAAGGAAGG + Intronic
905352515 1:37357391-37357413 TGGGAAAGCATCCCAAGGGAGGG - Intergenic
907195038 1:52679615-52679637 GGTGACAAAATCCGAAAAGAGGG + Intergenic
907408198 1:54266933-54266955 GGGGACACCATCAGCAAGGAGGG - Intronic
907721085 1:56972876-56972898 GGCGAGCACATCCCAAATGATGG - Intergenic
908516381 1:64897092-64897114 GAGGACAACATTCCAAATAAGGG + Intronic
911465459 1:98247131-98247153 TGTGACAATATCACAAAGGATGG - Intergenic
912437430 1:109671628-109671650 TGGGAAAGCATCACAAAGGAGGG - Intronic
915478486 1:156168962-156168984 GGGGACACCATCCTGAAAGAGGG - Intronic
916475678 1:165166382-165166404 AGGGACAACTTCCCAAAGGAGGG + Intergenic
918798618 1:188940440-188940462 GGGGACAACATTCTAAGGGTTGG - Intergenic
920709491 1:208281486-208281508 GGGAGAAAGATCCCAAAGGATGG - Intergenic
923270113 1:232347856-232347878 GGGGACGATATCCCAGAAGATGG + Intergenic
924430132 1:243989593-243989615 GGGGACAGCATCTCAAGGGATGG - Intergenic
924640132 1:245825567-245825589 GGGGACAAGATGCCCAGGGAGGG - Intronic
1063231127 10:4066798-4066820 GGGGACAACTGCCCAGAAGAAGG - Intergenic
1063553657 10:7057374-7057396 GGGGACATGATACCTAAGGATGG - Intergenic
1066593534 10:37022689-37022711 CTGAACATCATCCCAAAGGAAGG - Intergenic
1067294246 10:44965722-44965744 GGGCACACCATCCCAGGGGAGGG - Intronic
1069134634 10:64748736-64748758 GTGGACAACCTCCAAAATGAGGG + Intergenic
1071432807 10:85619514-85619536 TGGGAGAACTTCCCAGAGGAGGG - Intronic
1074222412 10:111450992-111451014 AGGGAGAACATGCCAAGGGAGGG - Intergenic
1076177694 10:128381075-128381097 GAGGACATCATCCCAGTGGAGGG - Intergenic
1076215950 10:128693549-128693571 TGGGAGAACATCCCCGAGGAGGG + Intergenic
1077638521 11:3860313-3860335 GGGGACAATATAACACAGGATGG - Intronic
1078521600 11:12068374-12068396 GTGGACAACAGCCAAAAGTAGGG + Intergenic
1079419333 11:20271394-20271416 AAGGTCTACATCCCAAAGGAAGG - Intergenic
1081501376 11:43669984-43670006 GGGAACAACATCCTTAAGGGAGG + Intronic
1081906764 11:46675164-46675186 GGAGACAACATCCCGGAGGTAGG + Intergenic
1083802419 11:65054169-65054191 GGGAACATCATCACAAGGGAAGG + Intronic
1083804322 11:65065043-65065065 GGAGACAACAGCCAAGAGGATGG - Intergenic
1084350209 11:68592054-68592076 ATGGAAAACTTCCCAAAGGAAGG + Intronic
1084798587 11:71526201-71526223 GGAGAAATCAGCCCAAAGGAAGG - Intergenic
1086874834 11:92083106-92083128 GGGGGCAACAACACAGAGGAAGG + Intergenic
1089640971 11:119847012-119847034 GGGGAAGGCTTCCCAAAGGATGG + Intergenic
1091704711 12:2685972-2685994 GGAGACAACATTCCAAAGGCAGG + Intronic
1091711284 12:2742311-2742333 GGAGACAACATTCCAAAGGCAGG + Intergenic
1094439197 12:30456451-30456473 CGGGACTCCATCTCAAAGGAAGG - Intergenic
1096956047 12:55527343-55527365 GGAGGCAACACCCAAAAGGATGG + Intergenic
1097030912 12:56088639-56088661 GGGGACTATGTCCCAAAGGTGGG + Exonic
1097689361 12:62719941-62719963 GGGTCCAATATCCCCAAGGAGGG + Intronic
1100575455 12:95887958-95887980 GGGTACACCAGCCCAGAGGAAGG - Intronic
1100930851 12:99608090-99608112 GAGGACAACATCCCATAGTTGGG + Intronic
1101054260 12:100896040-100896062 GTGCATAACATCCCCAAGGATGG + Intronic
1102341519 12:112125675-112125697 GGGTCCAGCATCCCAAGGGAGGG + Exonic
1105419486 13:20239794-20239816 GGGGACAATTTCCAGAAGGATGG + Intergenic
1106044789 13:26128943-26128965 AGGGACAACAGCACAAAGTAGGG + Intergenic
1107780246 13:43892992-43893014 GGGGACTACATCTTCAAGGAAGG + Exonic
1107965658 13:45596246-45596268 GAGGAGGGCATCCCAAAGGATGG - Intronic
1108557986 13:51614518-51614540 AGGGACAAGATCACTAAGGATGG - Intronic
1111140592 13:84113319-84113341 GGGGGCAATTCCCCAAAGGAAGG + Intergenic
1111233186 13:85372117-85372139 GGGGACAACATGGGAAAGAATGG - Intergenic
1114571279 14:23670758-23670780 GGGGACAACATTTTATAGGATGG + Intergenic
1116450873 14:45063911-45063933 GGTGATAACATATCAAAGGAAGG - Intronic
1116625449 14:47256978-47257000 GGGGACAAGATGAAAAAGGAAGG + Intronic
1116752885 14:48909114-48909136 GGGAACAAAATCCTGAAGGAGGG - Intergenic
1116801947 14:49452683-49452705 GGGCACAACCTCCCAAACAAGGG - Intergenic
1118028991 14:61800858-61800880 GATGACAATATCTCAAAGGATGG - Intergenic
1118324981 14:64774575-64774597 GGGCACAACTTGCCAAGGGAGGG - Intronic
1119776809 14:77254064-77254086 GGTGAAAGCATCCCAGAGGAGGG + Intronic
1119866262 14:77977784-77977806 TGGGACAAAATCCAAAAGAATGG + Intergenic
1120975183 14:90242104-90242126 GGGCAAAAGACCCCAAAGGAAGG + Intergenic
1121629002 14:95409041-95409063 GAGGGCAACATTCCAAAGCAGGG - Intronic
1122932702 14:104942018-104942040 GGGGACAACATCCCAAAGGATGG + Exonic
1122933395 14:104944988-104945010 GGGGCCGACACCCCGAAGGAGGG + Exonic
1122934675 14:104950433-104950455 GGGGCCGACACCCCAAATGATGG + Exonic
1123056131 14:105571641-105571663 GGTAACAACATCCCAGAGGGAGG + Intergenic
1202891705 14_KI270722v1_random:165216-165238 GGGTACTGCATCCCATAGGAGGG - Intergenic
1125736374 15:41929205-41929227 TTGGACAAAATCCCAAAGGAAGG - Intronic
1125759555 15:42087569-42087591 GAGGACCAGATCCCATAGGAAGG - Intronic
1126684852 15:51239870-51239892 GGGTACCACATCCCAGAGCAGGG - Intronic
1127112221 15:55686895-55686917 GGAAACCACTTCCCAAAGGATGG - Intronic
1129893391 15:79086823-79086845 GGGGACTCCATGCCAAAGAAGGG + Intronic
1130240455 15:82183377-82183399 GAGATTAACATCCCAAAGGAGGG - Intronic
1132110713 15:99100169-99100191 GGGGAGAAAATCCTGAAGGAAGG - Intronic
1133517419 16:6522935-6522957 CTGGACAACATCCCAAAGCCAGG - Intronic
1133866499 16:9648772-9648794 TGGGTCAATATCCAAAAGGAAGG + Intergenic
1135284956 16:21185461-21185483 TGGGAGAGCATCCCAAATGAAGG - Intergenic
1135955752 16:26955088-26955110 GGGGATTAGACCCCAAAGGAAGG - Intergenic
1137608206 16:49801038-49801060 GAAGACAACATCGCAAAGGCAGG + Intronic
1137733308 16:50705917-50705939 AGGGACAATAAGCCAAAGGAAGG + Intronic
1138466773 16:57198733-57198755 GGGGAAAACATACCTGAGGAAGG - Intronic
1138496420 16:57411876-57411898 GGTGCCAACATCCCAGAGAAAGG - Intronic
1141725929 16:85788293-85788315 GGCGACAACAGCCCAAAGGGTGG - Intronic
1143916754 17:10299407-10299429 GCTGAAAACATCCAAAAGGAAGG - Intronic
1144489965 17:15700102-15700124 GGGGACAGCATCCCTGAGGCTGG - Exonic
1144910996 17:18681857-18681879 GGGGACAGCATCCCTGAGGCTGG + Intronic
1144945239 17:18966346-18966368 GGGAACAGCATCCCCGAGGAAGG - Intronic
1145046226 17:19618957-19618979 GAGGACAACCACACAAAGGAAGG - Intergenic
1148938624 17:51186858-51186880 TGGGATAAAAACCCAAAGGAAGG + Intronic
1149055733 17:52362617-52362639 TGAGACAAAATCCCAAATGAGGG + Intergenic
1151449275 17:74187763-74187785 GGGGAGAATATCACAACGGAAGG + Intergenic
1151758519 17:76088085-76088107 GAGTACAACATGCCGAAGGACGG - Exonic
1152632520 17:81416971-81416993 GGGGACAACACGGCAACGGATGG - Intronic
1153180334 18:2425826-2425848 GGGGAAGACATCCCATTGGATGG - Intergenic
1156510792 18:37634901-37634923 GAGGACAGAAGCCCAAAGGAGGG - Intergenic
1158541985 18:58365470-58365492 GGGGAAAGCAGCCCAAAGCATGG - Intronic
1158825035 18:61209018-61209040 GATGACAACACCGCAAAGGATGG + Intergenic
1162123926 19:8489282-8489304 GGGGATTACAGCCCACAGGAAGG - Intergenic
1164676818 19:30106706-30106728 GGGGACATCATCCCAGTTGATGG + Intergenic
1165553214 19:36605738-36605760 GGCCACAACATCCCAAAGAGAGG - Intronic
1167135147 19:47611191-47611213 GGGGACAAAATGCCAAAGGGTGG - Intronic
1168290988 19:55357482-55357504 GGGGAAAGCATCCCAGCGGAAGG - Intronic
1202715528 1_KI270714v1_random:40263-40285 GGGGACCACAGCCCGGAGGAGGG + Intergenic
926500666 2:13649122-13649144 GGGGAATACATCCCAGGGGAGGG + Intergenic
928250290 2:29671456-29671478 GGGAAAAATATCCCTAAGGATGG - Intronic
929608718 2:43253940-43253962 GGGGACAGCTATCCAAAGGAGGG - Intronic
930715873 2:54593699-54593721 GGAGACACCATCCCAACAGATGG + Intronic
937026147 2:118699460-118699482 GGGGAAAGCATGCCAGAGGATGG - Intergenic
942857276 2:180564180-180564202 GGGGACAACAGACCAAAGAAGGG - Intergenic
946043775 2:216804133-216804155 GGGGAAAACAACACAAAGCAAGG + Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947421966 2:229949176-229949198 TGAGACAACATCCAAAAGGGTGG - Intronic
948301608 2:236911858-236911880 GGGCACAGCATCCGAAATGAAGG - Intergenic
1169424050 20:5482707-5482729 GAGGAGTACATCACAAAGGAGGG - Intergenic
1169519567 20:6356499-6356521 GGAGACAAAATCCCAAAAAAGGG - Intergenic
1170810839 20:19673065-19673087 TGGGAAAACATTCCACAGGAAGG - Intronic
1175715172 20:61250820-61250842 GGGGGCGTCTTCCCAAAGGACGG + Intergenic
1177638736 21:23819023-23819045 AGGGACAACATGTGAAAGGAGGG + Intergenic
1178921471 21:36741651-36741673 GGGGGCAGCATCCCAGAGGTGGG + Intronic
1179615170 21:42578997-42579019 TGGGACATCAGCCCACAGGAGGG - Intronic
1180032463 21:45221889-45221911 GGGGAAAGCAACCCAGAGGAAGG - Intronic
1184377616 22:44124586-44124608 GGGGAGACCCTCCCACAGGATGG - Intronic
1184822338 22:46918585-46918607 GGGGACAACTTCAGGAAGGAGGG + Intronic
949925218 3:9035821-9035843 GAGGTCAACATCCCAAATGGTGG + Intronic
950898819 3:16478128-16478150 GGGGACAATTTTCCAGAGGAAGG - Intronic
951595294 3:24312153-24312175 CAGGAAAACTTCCCAAAGGAAGG - Intronic
951602334 3:24390128-24390150 GATGACAACATGCCAGAGGAAGG + Intronic
955387790 3:58492646-58492668 GGGCAGAAAATCCCAAAGGCAGG - Intronic
956771932 3:72534388-72534410 GTGGAAAAAATCCCAAAGGGAGG - Intergenic
959426178 3:106191839-106191861 GGTGACAACAGCCCAAGGTAAGG + Intergenic
959642039 3:108651239-108651261 TGAGAAAACTTCCCAAAGGAAGG - Intronic
963016346 3:140827945-140827967 GGGGGCAGAACCCCAAAGGATGG - Intergenic
965612301 3:170557259-170557281 GGGCTCCACATTCCAAAGGATGG - Intronic
969519372 4:7666924-7666946 GAAGACAACTTCCCAGAGGAGGG + Intronic
976407999 4:84681164-84681186 AGGGAGAACAGCCCACAGGAAGG - Intronic
977170300 4:93753282-93753304 GGGGAGAACATCTCAGAGTATGG - Intronic
981074364 4:140576777-140576799 GTGGAGATCATGCCAAAGGATGG - Intergenic
981586429 4:146308221-146308243 GGGGACGAAATCCCCCAGGATGG + Intronic
981752173 4:148103066-148103088 GGAGTTAACATCCCAAGGGAGGG - Intronic
981941877 4:150290036-150290058 AGTGACAACATCCCACAGAAAGG + Intronic
984586686 4:181572293-181572315 AGGGAGAAAATCCCAAAGGTAGG + Intergenic
984757699 4:183339394-183339416 AAGGACAACAACCCAAAGGATGG + Intergenic
985825208 5:2186159-2186181 CTGGACAAAATCCCACAGGAGGG + Intergenic
989235718 5:39146244-39146266 AGGGACAACTTCACAAAGGAAGG - Intronic
991141930 5:63254527-63254549 GAGAACAAGATCCCAAAGTATGG + Intergenic
991975032 5:72177131-72177153 GAGGACATGATCCCAAAGCAGGG - Intronic
994314497 5:98316586-98316608 GGGAACAACATCCGTAAGGGAGG + Intergenic
995007153 5:107213365-107213387 GGGGTCAACATCCCAGGGCAGGG + Intergenic
997910600 5:137868835-137868857 GGGAAAAACATCCTGAAGGAGGG - Intronic
1003996810 6:11549957-11549979 TGGGATAACATACCAAATGAAGG - Intronic
1004162817 6:13229765-13229787 GCAGGCAACATCACAAAGGAGGG - Intronic
1005576703 6:27196474-27196496 GAGGAGAGCATCCCAAAAGAAGG - Intergenic
1006184141 6:32170822-32170844 GGGGGCAATGTCCCAGAGGAAGG + Exonic
1007510733 6:42372647-42372669 CCAGACAACATCCCAAGGGATGG + Intronic
1007695837 6:43733923-43733945 GGGGACAACACCCCAAGGACAGG - Intergenic
1007985130 6:46199765-46199787 GTGGACAGCATCCCAAAAGACGG - Intergenic
1010369050 6:75086393-75086415 CGGGTCGACATCACAAAGGAGGG - Exonic
1013388310 6:109655132-109655154 GTGGACAACCTGTCAAAGGATGG + Intronic
1014183023 6:118406301-118406323 GGGGAACAGAACCCAAAGGATGG - Intergenic
1016888402 6:148981101-148981123 AGGGAGAACATCTCAAAGGCTGG - Intronic
1018784271 6:167095950-167095972 GTGGACCACATCCCAGAGGATGG - Intergenic
1018913511 6:168118180-168118202 AGGGACACCAACCCAAAGAAAGG - Intergenic
1021788489 7:24176221-24176243 GGGGACAAAATGCCCATGGATGG + Intergenic
1022132961 7:27421055-27421077 GTGGCCAACATACCAAAGGCAGG - Intergenic
1022389976 7:29935041-29935063 GGGGAAAACTTCACAGAGGAAGG - Intronic
1023131402 7:37006558-37006580 GGGGACATCATCCTTAGGGAGGG + Intronic
1024349557 7:48349721-48349743 GGGGACAAATGCCCACAGGATGG + Intronic
1027487837 7:78784237-78784259 GGAAACAATATCCCAAAGTATGG + Intronic
1030967413 7:116009958-116009980 AGGGAAGACTTCCCAAAGGATGG + Intronic
1032313948 7:130816480-130816502 GGGGAAAATATCACAGAGGATGG + Intergenic
1034203581 7:149297139-149297161 CAGGACAACGTCCCAAAGAAAGG + Intronic
1034466258 7:151231715-151231737 GGGGAGAACAGCCCAAGGTAAGG - Intergenic
1035450551 7:158974408-158974430 GGGGAGAACATTCCAGAGCAAGG + Intergenic
1036206828 8:6811715-6811737 GGGGAGGGCACCCCAAAGGAAGG - Exonic
1036482680 8:9151814-9151836 GGGGGCAACTTCCTACAGGAGGG + Exonic
1036632207 8:10523896-10523918 GGGGACCTGAGCCCAAAGGAGGG + Intergenic
1036747578 8:11420710-11420732 GGGGATATCATCTCAAGGGATGG + Intronic
1038176815 8:25187784-25187806 GGGAGCAAAGTCCCAAAGGAGGG - Intronic
1040729008 8:50419899-50419921 GGGCACAACAGCACAATGGACGG + Intronic
1042551393 8:69996870-69996892 GAGGACAACATAGCTAAGGAGGG - Intergenic
1045305763 8:100955294-100955316 TGGGAAAACATCTCCAAGGATGG + Intergenic
1062117054 9:134815172-134815194 GGGGGCAACTTCCCAAAGCCTGG - Intronic
1062199830 9:135296676-135296698 GGGGCCACCTTCCCAAAGCAAGG + Intergenic
1186426458 X:9466580-9466602 GAGGAAAACATCCAAAAGGCAGG - Intronic
1187824599 X:23322183-23322205 AGTGACAAAATCCCACAGGAAGG - Intergenic
1195061030 X:101194810-101194832 GGTAACAACAGCACAAAGGAGGG - Intergenic
1195968973 X:110454032-110454054 GGGGTCAACATTCCGAAGGATGG - Exonic
1199253778 X:145695339-145695361 AGGGAGAACATCCTGAAGGAGGG - Intergenic
1201858609 Y:18571671-18571693 CTGGACAACCTCCAAAAGGAGGG + Intronic
1201874712 Y:18748710-18748732 CTGGACAACCTCCAAAAGGAGGG - Intronic
1202129705 Y:21598541-21598563 GGGGACAACAACCCACAACATGG + Intergenic