ID: 1122933901 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:104947164-104947186 |
| Sequence | GGCCTTTCAGGTCCACGTTG GGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 116 | |||
| Summary | {0: 1, 1: 0, 2: 15, 3: 6, 4: 94} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1122933888_1122933901 | 28 | Left | 1122933888 | 14:104947113-104947135 | CCATGCTGGACAGAGACATCTTC | 0: 4 1: 1 2: 1 3: 15 4: 223 |
||
| Right | 1122933901 | 14:104947164-104947186 | GGCCTTTCAGGTCCACGTTGGGG | 0: 1 1: 0 2: 15 3: 6 4: 94 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1122933901 | Original CRISPR | GGCCTTTCAGGTCCACGTTG GGG | Exonic | ||