ID: 1122933901

View in Genome Browser
Species Human (GRCh38)
Location 14:104947164-104947186
Sequence GGCCTTTCAGGTCCACGTTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 15, 3: 6, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122933888_1122933901 28 Left 1122933888 14:104947113-104947135 CCATGCTGGACAGAGACATCTTC 0: 4
1: 1
2: 1
3: 15
4: 223
Right 1122933901 14:104947164-104947186 GGCCTTTCAGGTCCACGTTGGGG 0: 1
1: 0
2: 15
3: 6
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122933901 Original CRISPR GGCCTTTCAGGTCCACGTTG GGG Exonic