ID: 1122936056

View in Genome Browser
Species Human (GRCh38)
Location 14:104956776-104956798
Sequence TTCTGGGCCCCTCTGAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122936056_1122936063 22 Left 1122936056 14:104956776-104956798 CCTCCCTTCAGAGGGGCCCAGAA 0: 1
1: 0
2: 0
3: 26
4: 201
Right 1122936063 14:104956821-104956843 AGAGGCAGCCGAGTTCCTCCAGG 0: 1
1: 0
2: 1
3: 14
4: 187
1122936056_1122936062 4 Left 1122936056 14:104956776-104956798 CCTCCCTTCAGAGGGGCCCAGAA 0: 1
1: 0
2: 0
3: 26
4: 201
Right 1122936062 14:104956803-104956825 CAACACACAGCTGTGTGCAGAGG 0: 1
1: 0
2: 2
3: 73
4: 573

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122936056 Original CRISPR TTCTGGGCCCCTCTGAAGGG AGG (reversed) Intronic
900484932 1:2918084-2918106 GCCTGGGGTCCTCTGAAGGGTGG + Intergenic
901625482 1:10622220-10622242 TTCTAGGCCCCTGTGAGGGGTGG + Intronic
902191162 1:14764250-14764272 CTGTGGGGGCCTCTGAAGGGAGG - Intronic
902754165 1:18538081-18538103 AGCTGGGCCCCTCAGCAGGGAGG - Intergenic
904319299 1:29686188-29686210 TTCGGGACCCCACAGAAGGGAGG + Intergenic
904410225 1:30320589-30320611 CACTGGTCCCCTCTGGAGGGAGG + Intergenic
904609508 1:31717401-31717423 TTCTGTGCCCATGTGCAGGGAGG + Intergenic
904938469 1:34148595-34148617 GTCTGTGCCCCACTGAAGGAGGG - Intronic
905339192 1:37266649-37266671 TTCTGAGTCTCTCTGAAGGATGG - Intergenic
905907029 1:41626079-41626101 TTCAGGCCCCTTCTGAAGAGTGG + Intronic
906640148 1:47436931-47436953 TTCTGGGCCCCACCGACAGGCGG - Exonic
912797443 1:112701490-112701512 TTCTGTACCCCTGTGAAGGGAGG + Exonic
913318669 1:117573995-117574017 TTCTGGGAGCCTCTGTAGGCTGG + Intergenic
914450654 1:147788442-147788464 TTCTGGGCAGCTCAGAAGGATGG + Intergenic
916013861 1:160730930-160730952 TTCTTAGCCACTCAGAAGGGTGG - Intergenic
916601579 1:166298297-166298319 TTGTGGGCTCCTCTGTAGAGAGG - Intergenic
921130302 1:212214170-212214192 TTCAGAGCCCCTGTGAAGGAGGG - Intergenic
922483791 1:225957770-225957792 TTCTTGGTCCTTCTGAAGAGAGG - Intergenic
922695410 1:227728677-227728699 TTCTGGGACCCTGTGAGGGCAGG - Intronic
1067016443 10:42759122-42759144 TTCAGGTCCCCTCTGAATGTGGG + Intergenic
1070775550 10:79107812-79107834 TTCTGGGCTCTGCTGTAGGGTGG + Intronic
1075086636 10:119418296-119418318 TTCTGGTCCCCCCTGAAGCTGGG - Intronic
1076717727 10:132374883-132374905 TGCTGGGCCCCATTGCAGGGGGG + Intronic
1078464777 11:11541983-11542005 CTCTGGGGTCTTCTGAAGGGTGG - Intronic
1078490978 11:11768388-11768410 TCCTGGACACCTCTGAAGGAAGG - Intergenic
1082794469 11:57369519-57369541 TTCTGAGGCCTTCTGAAGGGGGG + Intronic
1082922623 11:58512050-58512072 ATTTGGGAGCCTCTGAAGGGGGG + Intergenic
1084085558 11:66853496-66853518 TTCTGGGCCTCCCTGCAGAGGGG + Intronic
1084121266 11:67070414-67070436 TTCTGGGTACCACTGCAGGGGGG - Exonic
1084454812 11:69262337-69262359 TCCTGGGCTCCTCTCTAGGGAGG + Intergenic
1084488964 11:69467876-69467898 CTCGGGGCCTCCCTGAAGGGCGG - Intergenic
1086583086 11:88421822-88421844 TTCTGAGCCTCACTGATGGGGGG - Intergenic
1089402392 11:118171752-118171774 TGCAGGGCCCCGCTGCAGGGTGG - Intronic
1090853113 11:130587853-130587875 ATCTGGACCCCTCTCAAGGCTGG + Intergenic
1091033691 11:132214192-132214214 CCCTGGGCCCTTCTGAAGGAGGG + Intronic
1092903364 12:13080467-13080489 TTCTGGGCCTTTCTGGAAGGAGG + Intronic
1097052260 12:56230597-56230619 TGCTGGGCCCCTGGGTAGGGAGG - Intronic
1098326010 12:69302018-69302040 ATATGGGTCCCTCTGAAGTGTGG - Intergenic
1101748812 12:107565710-107565732 TTCTGGGGCCGGCTGTAGGGTGG - Intronic
1102487277 12:113266783-113266805 TTCTGGCCCCCACTGAATGATGG - Intronic
1105716510 13:23070832-23070854 TTTTGGGCCCCTGTTAAGAGTGG - Intergenic
1105941703 13:25153314-25153336 TTCTGAACCCCTCTGGAGGTGGG - Intergenic
1106121718 13:26865161-26865183 TTCTGGGCCCCTTTGGAGGTAGG + Intergenic
1107809837 13:44189619-44189641 TTCTAGGCTCCTCAGATGGGTGG + Intergenic
1107962848 13:45574483-45574505 TTCTGTGTCTCTCTGCAGGGTGG + Intronic
1113990850 14:16025829-16025851 TTCTGGGCCCTTCGGAGGGCGGG - Intergenic
1115653378 14:35419955-35419977 TTCTGGGGCCCACTCAAGGCTGG - Intergenic
1117884947 14:60350613-60350635 TCCTGGGCGGCTCTAAAGGGAGG + Intergenic
1118166685 14:63343229-63343251 TTCTAGTCCCGTCTCAAGGGTGG - Intergenic
1119398671 14:74347778-74347800 TACTGAGCCCCACTGAAAGGTGG - Intronic
1120031486 14:79646307-79646329 CTCTGGGCCCCTCAGCAAGGAGG + Intronic
1120719776 14:87878338-87878360 TCCTGGGTCCCTCTGAGGTGAGG + Intronic
1120819876 14:88902184-88902206 TTCTGGTCCTCTCTGAATAGAGG + Intergenic
1122583171 14:102784509-102784531 TACTGGGCCCCTCTGATGCTTGG + Intronic
1122936056 14:104956776-104956798 TTCTGGGCCCCTCTGAAGGGAGG - Intronic
1123201654 14:106671712-106671734 TTCTGAGCTCCCCTGCAGGGAGG + Intergenic
1124338215 15:28873097-28873119 TTCAGGGCCCCCCCGAAAGGAGG + Intergenic
1124706823 15:31973485-31973507 TTCTGGGACCCAGTGCAGGGAGG - Intergenic
1125233491 15:37484340-37484362 CTCTGGGCCTCTGTGATGGGAGG + Intergenic
1126078984 15:44939929-44939951 TTCTGGGGACCTCTGTAGAGGGG - Intergenic
1126676100 15:51160381-51160403 CCCTGCCCCCCTCTGAAGGGTGG - Intergenic
1128444350 15:67743872-67743894 CTCTAAGCCCCACTGAAGGGAGG + Intronic
1129229818 15:74190959-74190981 TCCTGGGCCCCTTGGGAGGGAGG - Intronic
1132083086 15:98884135-98884157 TGCTAGGCCCCTGTGAACGGTGG + Intronic
1132559853 16:588677-588699 GTCGGGGCCCCTCTGGAGGAGGG + Intergenic
1133087261 16:3374699-3374721 ATATGGGCCTTTCTGAAGGGAGG - Intronic
1133203087 16:4216742-4216764 AGCTCGGCCCCTCTGAAGGGAGG - Intronic
1134622876 16:15702900-15702922 TACTGGGCCGCTCAGCAGGGAGG - Intronic
1135122357 16:19777361-19777383 TTTTGTGCCACTCTGAAGGTAGG - Intronic
1137668543 16:50266100-50266122 TCCTGGGCCCCTCTCAGAGGTGG + Intronic
1137697117 16:50468763-50468785 TTCTTGACCTCTCTGAAGTGAGG - Intergenic
1140287434 16:73617839-73617861 ATCTGGGTAGCTCTGAAGGGAGG - Intergenic
1142125086 16:88406177-88406199 CTCTGGGCCCCACGGAAGGGCGG - Intergenic
1142545664 17:700853-700875 TTCTGGCTACCTCTGATGGGAGG + Intronic
1143540510 17:7565638-7565660 GTCTGGGGCCCTCTGCATGGGGG + Intronic
1144495235 17:15741576-15741598 TTGTTGGCCCATCTGTAGGGAGG - Intronic
1144640905 17:16935962-16935984 CTCTGGGCCCATCTCAAAGGGGG + Intronic
1144823256 17:18090110-18090132 TTCTGAGCATCTCTGAAGGGAGG - Intronic
1147574854 17:41593275-41593297 TTCTGGGGCAGTCTGGAGGGAGG - Intergenic
1148074623 17:44928282-44928304 TGCTGGGCCCCTGTGAAGGTTGG + Exonic
1148478117 17:47942283-47942305 TGCTGGGCCTCCCTCAAGGGCGG + Intronic
1149157292 17:53647353-53647375 TTCTGGACCCATCTGAAGCCTGG - Intergenic
1150617463 17:66783428-66783450 CTCTGGGCCCCACTGAAGGCTGG - Intronic
1151531870 17:74711733-74711755 ATCTGGGACCCTCTTCAGGGGGG + Intronic
1151612712 17:75186844-75186866 TTTTGGGCCCCTTGGAAGGTTGG + Intergenic
1152901379 17:82942980-82943002 TTCTGGGCCCGTCTGCCTGGTGG + Intronic
1155684477 18:28531820-28531842 TACTGGGCACCTCTGGAGGGGGG + Intergenic
1160688770 19:450553-450575 CTCTGGGGACCTCTGATGGGTGG + Intronic
1160952332 19:1673762-1673784 TGCTGGGCCCGGCTGAAGGACGG - Intergenic
1161911666 19:7198571-7198593 TTCTGGACCCCTCCCGAGGGAGG - Intronic
1162950881 19:14071826-14071848 TTCTGGGCACCCCAGAATGGTGG + Intergenic
1163155240 19:15436752-15436774 CTCTGGGCCCCTGGGAAGGATGG + Intronic
1165007733 19:32820176-32820198 TTCTGGGCCCCTCAGAAGACAGG + Intronic
1165428035 19:35756351-35756373 TTCCCGGCCACTCTGAAGTGGGG - Intronic
1166978622 19:46619956-46619978 TCCTGGGCCTCTCTGAGGGCAGG + Intergenic
1166985673 19:46659107-46659129 TCCTGGGTCCCTCTGAAGAGTGG - Intronic
1167093502 19:47360573-47360595 GTATGGGCCTCTCTGACGGGTGG - Intronic
1167410493 19:49341160-49341182 TTGGGGGCCCCTCTAATGGGGGG + Exonic
1167693490 19:51001278-51001300 TTCTGGGCTTCTCTGGAGGAAGG + Intronic
1167741737 19:51327963-51327985 TTCAGGGCCAGCCTGAAGGGCGG - Intronic
1168059524 19:53883216-53883238 TCCTGGGACCCTCAGGAGGGTGG + Intronic
924994210 2:341854-341876 ATCTGGGGCCCACTGCAGGGGGG + Intergenic
926075363 2:9938356-9938378 CTCTGGGCACCACTGGAGGGGGG + Intergenic
926408910 2:12581610-12581632 TTCTGGGCCCCACTCAAGGCTGG - Intergenic
926690242 2:15728217-15728239 TTCTGGGCAGCTCTGAACAGAGG + Intronic
930864040 2:56105497-56105519 TTCTGTGCCCCTCTGACAGTGGG - Intergenic
931819531 2:65937262-65937284 TCCTGGGCCTCTCTGAAGAAAGG + Intergenic
934300298 2:91772734-91772756 CTCTGAGCCACTCTGGAGGGGGG + Intergenic
934586866 2:95507927-95507949 TTCTGGGGAGCTCTGAAGTGTGG - Intergenic
935621110 2:105130383-105130405 TTCTGGGCCCCACTCAAAGCTGG + Intergenic
935827908 2:106969663-106969685 TTTTGGGCCCCACTGAAAGGTGG + Intergenic
937017134 2:118616597-118616619 GCCTGGCCCCCTGTGAAGGGAGG - Intergenic
937597269 2:123686991-123687013 TTGGGTGGCCCTCTGAAGGGTGG + Intergenic
937712592 2:124995392-124995414 TTCTGAGCCACACTGAGGGGTGG + Intergenic
939820462 2:146950564-146950586 TCCAGGGCCTCTCTGAAGTGGGG + Intergenic
942172072 2:173298600-173298622 CTCTGGGTCACTCTGAAAGGAGG - Intergenic
943251847 2:185532290-185532312 TTCTGAACCCCTCTGAAGTTAGG - Intergenic
944194253 2:197035847-197035869 CCCTGGGATCCTCTGAAGGGAGG - Intronic
944752311 2:202722656-202722678 TTCTGGGGCCTTCTAGAGGGTGG + Intronic
947792071 2:232874075-232874097 TTCTGGGCCTCTCTCAAGCCTGG - Intronic
948006265 2:234610333-234610355 TTCTGGGCTCCTCTAGAGGAAGG - Intergenic
948132496 2:235610920-235610942 TTTTCAGCCCCTCTGAAGAGCGG + Intronic
948514375 2:238494499-238494521 TTCTGGGCCGCACAGGAGGGAGG + Intergenic
948610465 2:239163381-239163403 TGCTCGGTCCCTCTGCAGGGGGG + Intronic
1169195281 20:3679452-3679474 TTCAGGGCCCCTGTGGAGGGCGG + Intronic
1170374295 20:15683526-15683548 CTCTGGGTCCCTCAGATGGGTGG - Intronic
1171111027 20:22482716-22482738 TCCTTGGGCCCTCTGAAGGTGGG - Intergenic
1173403185 20:42742627-42742649 CTCTGGCCCCATCTGAATGGAGG + Intronic
1173864922 20:46307640-46307662 TTCTGGTCCCCTCTGAGCCGGGG - Intronic
1175121490 20:56719400-56719422 TTCTGGGCACCACTGAAGGTTGG + Intergenic
1175401383 20:58701546-58701568 TTCCAGACCCTTCTGAAGGGTGG - Intronic
1175534187 20:59696366-59696388 TACTGAGAGCCTCTGAAGGGTGG + Intronic
1175894102 20:62328488-62328510 TTCTGGGCCTCTGAGAGGGGCGG - Intronic
1175927718 20:62479244-62479266 CTCTGGGCCCCTCAGGAAGGAGG + Intergenic
1176115368 20:63429752-63429774 TTCTGGACAGCTCTGGAGGGAGG - Intronic
1176143996 20:63557469-63557491 TTCTGGGCATCTGTGGAGGGAGG - Intergenic
1176268014 20:64220788-64220810 GGCTAGGCCCCTATGAAGGGTGG + Intronic
1178275255 21:31231004-31231026 TTCTGGCCCCCTCTGAAGCCAGG + Intronic
1178425363 21:32474706-32474728 ATCAGAGCCCCTCTGAAGTGAGG + Intronic
1179499725 21:41800370-41800392 ATCTGGGCAGCTGTGAAGGGTGG + Intronic
1179780212 21:43694747-43694769 TCCTGGGGCCCTCTGCTGGGAGG - Exonic
1180316420 22:11281697-11281719 TTCTGGGCCCTTCGGAGGGCGGG + Intergenic
1180943906 22:19679219-19679241 CTCCGGGCCCCTCTGATGAGGGG - Intergenic
1182076292 22:27497671-27497693 TTCTGGGCCTCTCTTAAGAGAGG + Intergenic
1182345682 22:29662787-29662809 CTCTGGGCCTCCCTGAAAGGCGG - Intronic
1182710745 22:32321624-32321646 CACTGGGGCCCACTGAAGGGCGG - Intergenic
1183334542 22:37239119-37239141 GCCTGTGCCCCTGTGAAGGGAGG - Intronic
1183384029 22:37504683-37504705 TTCTGGGCCTCCCAGAGGGGAGG + Exonic
1184403196 22:44285868-44285890 TACTGAGCCCCTCTGGAGGGCGG + Intronic
1184478556 22:44734719-44734741 TACAGGGCCCCTCCGAGGGGTGG + Intronic
1185126601 22:49014674-49014696 GTCTGGCCCCCTCTGAGGGTCGG + Intergenic
1185340545 22:50288969-50288991 TTCTGGGCACCTCTGATGGCCGG - Exonic
949506855 3:4736745-4736767 TTCTGGGCTCCTGTGTTGGGAGG + Intronic
950028343 3:9835504-9835526 TTCTGGGCCTCGCTGCACGGAGG - Intronic
950495938 3:13334723-13334745 CTCTGGGCCCCTCTGCAAGGTGG - Intronic
955977037 3:64489501-64489523 CCCTGGGCCGCTCCGAAGGGAGG - Intergenic
960587596 3:119334520-119334542 TTCTGGGCCCATCTTCAGGTAGG + Intronic
960857224 3:122114515-122114537 GTCCAGGCCCCTCTGAAGGCAGG + Intronic
961315526 3:126032881-126032903 TTCTGGGCCTCTCTGAGTTGGGG - Intronic
963009403 3:140755108-140755130 TTCTGTGCCAACCTGAAGGGTGG + Intergenic
964329369 3:155585168-155585190 TTCTGTGACCCTTTTAAGGGTGG - Intronic
966151536 3:176872591-176872613 TTTTGGGTCCCTGTGAAGTGGGG - Intergenic
968967104 4:3774287-3774309 CTCTGGGCCTCTCTGCAGAGTGG - Intergenic
969890384 4:10254789-10254811 TTGTGGTCCCCTCTGAAGCATGG + Intergenic
971196596 4:24475957-24475979 TTCTGGGCCCCGGTGAGGGTAGG - Intergenic
978130934 4:105196409-105196431 TTCAGGGCCACTCTGAAAAGGGG - Intronic
980867766 4:138573450-138573472 TTCTGGGATACCCTGAAGGGAGG - Intergenic
981137106 4:141222913-141222935 TTCTGGGCTGCTTTGAATGGTGG + Intronic
983053071 4:163070979-163071001 TACTGGGGCCCACTGGAGGGTGG - Intergenic
983139814 4:164136347-164136369 AGCTGGGCCCCTCTGCAGGAAGG - Intronic
984704482 4:182837846-182837868 TTCTGGGCCCTTCTGAGAAGGGG + Intergenic
985024522 4:185727223-185727245 TTCTCATCCCCTCTGAAGAGTGG + Intronic
986735763 5:10666217-10666239 GTCTGGGGCCCTCTGAGAGGAGG + Intergenic
988676552 5:33439381-33439403 TTCTGAAGCCCTCTGAGGGGTGG - Intergenic
989812514 5:45695620-45695642 TTCAGGGCGCGCCTGAAGGGAGG + Intronic
992379340 5:76221588-76221610 ATCTGGGCCCATTTGAAGGTAGG + Intronic
996496641 5:124164621-124164643 TTGTCAGCCCCTCTGAAGAGTGG - Intergenic
997241210 5:132309461-132309483 TCTTGGGCCCCTCTTCAGGGAGG + Intronic
999169650 5:149582362-149582384 TTCTTTGCTCCTTTGAAGGGAGG + Intronic
1002494424 5:179602135-179602157 TGCTGGGCCCCTCTGAGGCCGGG - Intronic
1003147154 6:3518224-3518246 TTCTGTGCCCCTCCCAAAGGTGG + Intergenic
1006015127 6:31074634-31074656 GTCTGTGCCCCTCAGAAGGGCGG - Intergenic
1007178434 6:39912034-39912056 TTCAGGGCCCCACAGAAGGAAGG + Intronic
1007211246 6:40194911-40194933 CTGTGGGGCCCTCAGAAGGGAGG + Intergenic
1007781391 6:44256927-44256949 GTGTGGTCCCCTCTGGAGGGCGG - Intronic
1017495238 6:154977894-154977916 TTCTGGGCTGGACTGAAGGGTGG + Intronic
1019225555 6:170504729-170504751 TTCAGAGGCCCCCTGAAGGGAGG + Intergenic
1019450882 7:1097224-1097246 TCCTGGGCCCTTCTGGAGGGTGG - Intronic
1019575966 7:1737797-1737819 CTCTGGGCCTGTCTGGAGGGTGG - Intronic
1019996318 7:4726710-4726732 TTCTTCTCCCCTCTGCAGGGCGG + Intronic
1021995452 7:26175449-26175471 TTCTGGTTCTCTCTGAAGGTTGG - Intronic
1024540138 7:50469365-50469387 TGCTGGGCCCCACTGCAGGCCGG + Intronic
1029405600 7:100372756-100372778 GTCTGGGCCTGGCTGAAGGGTGG - Intronic
1029471191 7:100755296-100755318 CTGTGGGCCCCTCTGTCGGGAGG + Exonic
1029550938 7:101236801-101236823 TAAAGGGCCCCTGTGAAGGGAGG - Intronic
1029968600 7:104766689-104766711 TTCTGGGACCCTCAGATGAGTGG + Intronic
1032439996 7:131935299-131935321 TTGAGGGGCCCTCTGAAGGTAGG + Intergenic
1032729999 7:134631394-134631416 CTCAGGCCCACTCTGAAGGGAGG - Intergenic
1034192586 7:149223618-149223640 TTCTGGGCTCCACAGCAGGGTGG + Intronic
1036056396 8:5259730-5259752 CTCTGGGACCTTTTGAAGGGTGG + Intergenic
1036710454 8:11075101-11075123 TTATGGGAGCCTCTGCAGGGCGG - Intronic
1039057421 8:33548040-33548062 TTGTGGGCCCCTCTAGAGGAGGG - Exonic
1040832665 8:51694996-51695018 TTCAGAGCCTCTCTGAAGGCTGG + Intronic
1041694168 8:60718078-60718100 TTCTGTGCCACTCTGAAGACTGG - Intronic
1047564024 8:126021776-126021798 GTTTGGGCCCCTCTCCAGGGTGG + Intergenic
1049351994 8:142169578-142169600 TGCTGGTCCCCTCTCCAGGGAGG - Intergenic
1049855210 8:144857398-144857420 TTCTGGCCCCCCCAGAAGGTGGG - Intergenic
1050766603 9:9142259-9142281 TACTGGGCCTCTCAGGAGGGAGG - Intronic
1053482766 9:38428231-38428253 TTCCAGGCCACTCTGCAGGGAGG + Intergenic
1057857010 9:98609679-98609701 TTTCGGCCCCCTCAGAAGGGTGG + Intronic
1059436999 9:114282996-114283018 TGCTGGGCTGCTCTGAAGGAAGG + Intronic
1059905830 9:118984784-118984806 TTCTGAGGCCCTCTGAATGGTGG + Intergenic
1060767719 9:126307525-126307547 GTCTGGGCCCCTGTGAATGTGGG + Intergenic
1060822926 9:126671865-126671887 CTCTCTGCCCCTCTGGAGGGAGG - Intronic
1061592274 9:131605370-131605392 CTCAGGGCCCTTCTCAAGGGAGG - Intronic
1062038333 9:134392601-134392623 TTCTGGGTCCCTGGGATGGGTGG + Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1062167053 9:135113142-135113164 CTCTGGGCCTCTCTGAAGTGGGG + Intronic
1203783734 EBV:115609-115631 TCCTGGGCCCCCCGGAGGGGCGG - Intergenic
1203364717 Un_KI270442v1:247645-247667 TTCTGGGCCCTTCGGAGGGCAGG + Intergenic
1187686042 X:21816474-21816496 TTCTGGTCCCCAGTAAAGGGCGG - Intergenic
1188724963 X:33571709-33571731 TACTGGGCCCTACTTAAGGGTGG - Intergenic
1189315355 X:40052148-40052170 TGCTGGGCTCCTCTGTAGAGTGG - Exonic
1189381283 X:40504203-40504225 TTCTGGGAGGTTCTGAAGGGAGG - Intergenic
1195869591 X:109472315-109472337 TTCTAGGCCCCTCCAAAGGAAGG + Intronic
1200047650 X:153411298-153411320 GTCTGGGCTGCTCTGAAGGCTGG - Intergenic
1200071477 X:153531463-153531485 TGATGGGCCCTTCTGAAAGGCGG + Intronic
1201384475 Y:13423941-13423963 TTCTGGGCTCTTCTGATGGAAGG - Intronic