ID: 1122937317

View in Genome Browser
Species Human (GRCh38)
Location 14:104966229-104966251
Sequence GCCACCTTCCTACTGCTCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122937309_1122937317 -5 Left 1122937309 14:104966211-104966233 CCACGTCATCCCGGCCCCGCCAC 0: 1
1: 0
2: 1
3: 20
4: 248
Right 1122937317 14:104966229-104966251 GCCACCTTCCTACTGCTCCGGGG 0: 1
1: 0
2: 2
3: 5
4: 125
1122937307_1122937317 -3 Left 1122937307 14:104966209-104966231 CCCCACGTCATCCCGGCCCCGCC 0: 1
1: 0
2: 5
3: 17
4: 233
Right 1122937317 14:104966229-104966251 GCCACCTTCCTACTGCTCCGGGG 0: 1
1: 0
2: 2
3: 5
4: 125
1122937306_1122937317 -2 Left 1122937306 14:104966208-104966230 CCCCCACGTCATCCCGGCCCCGC 0: 1
1: 0
2: 1
3: 23
4: 192
Right 1122937317 14:104966229-104966251 GCCACCTTCCTACTGCTCCGGGG 0: 1
1: 0
2: 2
3: 5
4: 125
1122937304_1122937317 18 Left 1122937304 14:104966188-104966210 CCAGGAGGCATCAACACTCACCC 0: 1
1: 0
2: 2
3: 16
4: 127
Right 1122937317 14:104966229-104966251 GCCACCTTCCTACTGCTCCGGGG 0: 1
1: 0
2: 2
3: 5
4: 125
1122937308_1122937317 -4 Left 1122937308 14:104966210-104966232 CCCACGTCATCCCGGCCCCGCCA 0: 1
1: 0
2: 2
3: 9
4: 122
Right 1122937317 14:104966229-104966251 GCCACCTTCCTACTGCTCCGGGG 0: 1
1: 0
2: 2
3: 5
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122937317 Original CRISPR GCCACCTTCCTACTGCTCCG GGG Intronic
900347208 1:2215463-2215485 GCCACCTTCCCGCTACTCAGAGG - Intergenic
902081381 1:13823350-13823372 GCCCCCTTCCTGCCGCCCCGGGG - Exonic
903287332 1:22285364-22285386 GACATCTTCCTACACCTCCGCGG - Intergenic
903350502 1:22713659-22713681 GCCACCCTCCTACTGCTCCACGG - Intronic
904493575 1:30874644-30874666 ACCACCATCCTACTGCCCTGGGG + Intronic
904628932 1:31827079-31827101 GCCACCTTACTCCTGCTTCCTGG - Intergenic
905656678 1:39690433-39690455 CCCACCTTCCTGCTGCTCCGTGG - Intronic
912237487 1:107867653-107867675 GCAAGCCTCCTACTGCTCAGGGG + Intronic
915334917 1:155135639-155135661 GTCCCCTTCCTAGGGCTCCGCGG - Intronic
915483674 1:156204988-156205010 TCCACCTCCCTACTTCTCCCTGG + Intronic
915561898 1:156692612-156692634 GCCACTTTCCTGCAGCCCCGAGG - Intergenic
916059361 1:161088244-161088266 GCTCCCTTGCTACTGCTCCTGGG + Intronic
916842698 1:168615969-168615991 TCCACCATCCTACTGCTTCCAGG - Intergenic
917254056 1:173095631-173095653 GCCGACTTCCTACGGCTCCTGGG + Intergenic
921571562 1:216785502-216785524 GCAAAATTCCTACTGCTCAGAGG - Intronic
921593260 1:217027700-217027722 TCCACCTTCCTTCTGATCTGTGG - Intronic
922380673 1:225020965-225020987 CCAACCTTCCTACTTCTCCATGG - Intronic
922538420 1:226400833-226400855 GCTCCCTTCCTCCTGCTCCGAGG + Intronic
922994581 1:229945466-229945488 GCCACCTACATACTGCTGCCGGG + Intergenic
923505838 1:234606575-234606597 TCCACTTTCCTACTCCTCTGAGG + Exonic
924536535 1:244940336-244940358 GGCACCATCCTACTGCCCCAAGG - Intergenic
1067141968 10:43665950-43665972 GCCCTCTTCCTAGTGCTCTGTGG + Intergenic
1067562252 10:47312265-47312287 GCCTGCTTCCTGGTGCTCCGCGG + Intronic
1070956202 10:80465145-80465167 GCCACCTGCCCACTGCTTTGGGG + Intronic
1075399515 10:122150886-122150908 GCCACCTTCCGAATAGTCCGTGG - Intronic
1075658210 10:124175548-124175570 GCTACCCTCCTACTGCCCAGGGG + Intergenic
1077271961 11:1685592-1685614 GCCACCCTCCTCCTGCTCCCAGG + Intergenic
1077976496 11:7252688-7252710 TCCCCCTTCCCACGGCTCCGAGG - Intronic
1078609338 11:12806522-12806544 GCCATCTTCCTCCTCCTCCCAGG - Intronic
1079097879 11:17522672-17522694 GCCAACTTCCTCCTCCTCCCTGG - Intronic
1079111155 11:17605973-17605995 GCCTCCTTCTTGCTGCACCGGGG + Exonic
1083413810 11:62512436-62512458 ACCAGCTTCCTACTGCCCCTGGG + Intronic
1087385093 11:97461206-97461228 GCCAGCTTCCGACAGTTCCGTGG - Intergenic
1088596661 11:111446088-111446110 GAAAGCTTCCTACTGCTCTGAGG - Intronic
1089576561 11:119448470-119448492 GCCACCTTTCTACTGGGCTGTGG + Intergenic
1090076337 11:123582142-123582164 CGCACCTTCCTACTGCTGGGAGG + Intronic
1091273280 11:134332492-134332514 GCCCCGTCCCCACTGCTCCGCGG + Intronic
1095767487 12:45913295-45913317 GCCATCTTCCTAGTGCTTAGTGG + Intergenic
1096564543 12:52467698-52467720 GCAACCTCCCTCCTGCTCCTGGG + Intergenic
1104414265 12:128584867-128584889 GCCAGCTTCTAACTGCCCCGAGG - Intronic
1104755127 12:131264486-131264508 GCCACCTTCCTAAAGCACTGGGG - Intergenic
1104916396 12:132267064-132267086 GCCACCTCCTCACTGCTCCTCGG - Intronic
1113910275 13:113838396-113838418 GGTCCCTTCCTCCTGCTCCGGGG - Intronic
1113910339 13:113838558-113838580 GGTCCCTTCCTCCTGCTCCGGGG - Intronic
1114537879 14:23434303-23434325 CCCACCTTCCTGCTTCTCCCTGG + Intronic
1117169242 14:53075024-53075046 CCAACCTTTCTCCTGCTCCGAGG + Intronic
1117545851 14:56794546-56794568 GCCCTCTTCCTACTCCTCTGTGG - Intergenic
1118749871 14:68797598-68797620 GCCATCTTCCTCCTACTCCGGGG + Intergenic
1122937317 14:104966229-104966251 GCCACCTTCCTACTGCTCCGGGG + Intronic
1124630261 15:31332461-31332483 GCCCCCATCCTACTGCTCCAGGG - Intronic
1128285919 15:66436977-66436999 GCTACCTCCCTGCTGCTCCTGGG + Intronic
1129293355 15:74585225-74585247 GCCTCCTTCCTGGTGCTCTGTGG + Intronic
1133342507 16:5045810-5045832 ACCAGCTGCCTCCTGCTCCGTGG + Intronic
1138553094 16:57757755-57757777 GCCACCTTCCTCCAGTGCCGAGG - Intergenic
1138879278 16:60991104-60991126 GCCAGTTGCCTCCTGCTCCGTGG + Intergenic
1141312115 16:82924636-82924658 CTCACCTTCCTAGTGCTCCCGGG - Intronic
1141869828 16:86777503-86777525 GCCACCTGCCTCCTGCTCTCAGG - Intergenic
1147275845 17:39315739-39315761 GCCACCTTCCTCCTGTTGCACGG - Intronic
1148336970 17:46848453-46848475 GCCACCTTCCCTCTGCCCTGTGG - Intronic
1154107371 18:11534223-11534245 GCCGCCCTCCTACCGCTCCTGGG - Intergenic
1156213476 18:34973363-34973385 ACTACCTTCCTGCTGCTCCTAGG - Intergenic
1157904608 18:51558356-51558378 GCCACCCACCTACTGCTGTGCGG - Intergenic
1158568307 18:58574546-58574568 GCCACCCACCTCCTGCTGCGTGG - Intronic
1159816631 18:73082113-73082135 CCCACCTTCCGTCTGCTCCATGG - Intergenic
1159874764 18:73798317-73798339 GCCAGCTTCCTACTGCTTTTAGG + Intergenic
1160854100 19:1208218-1208240 CTCACCTTCCTCCTGCTCAGGGG + Intronic
1161709288 19:5838765-5838787 TCCTCCTTCCTTCTGCTGCGTGG - Exonic
1162197600 19:8997703-8997725 GCCAGCTTCCTAGGGCTCCAGGG + Intergenic
1162647083 19:12057643-12057665 GCCCCCTTCCTTCTCCTCCTGGG - Intergenic
1162806391 19:13139943-13139965 CCCACCTACCCACTGCTCCCAGG + Exonic
1164459864 19:28437505-28437527 TCCTCCTTCCTACTTCTCCCAGG - Intergenic
1164498668 19:28793543-28793565 CGCACCTTCCTCCTCCTCCGCGG + Intergenic
1165610392 19:37146587-37146609 GCCACATTCCTCTTGCTCCTGGG + Intronic
925751190 2:7091474-7091496 TCCACCTTCCTCCTCCTCCAGGG - Intergenic
925751859 2:7096334-7096356 GCCACCTCCCTCCTTCTCCTTGG - Intergenic
926729644 2:16026541-16026563 GCCCCCTTCCCACTGGTCGGAGG + Intergenic
928326925 2:30326626-30326648 CCCACCTTCCCACTGCCCCAAGG + Intergenic
937071419 2:119066633-119066655 GCCAGCTCCCTCCTGCTCCCTGG + Intergenic
937972731 2:127563194-127563216 CACAACTTCCTACTGCTCTGTGG + Intronic
938285285 2:130108971-130108993 GTCAGCTTGCTACTTCTCCGTGG - Intronic
938312598 2:130302673-130302695 GTAGCCCTCCTACTGCTCCGGGG - Intergenic
938335934 2:130497512-130497534 GTCAGCTTGCTACTTCTCCGTGG - Intronic
938353890 2:130623153-130623175 GTCAGCTTGCTACTTCTCCGTGG + Intronic
938475131 2:131603105-131603127 GTCAGCTTGCTACTTCTCCGTGG + Intergenic
938667501 2:133553677-133553699 GTCCCCTTACTACTGCTCCAGGG - Intronic
947668638 2:231923080-231923102 GCCACCTTCCTTGGGCCCCGGGG - Intronic
947871361 2:233440658-233440680 GCCACCTTTCTGCTGCTGCCTGG - Intronic
948056528 2:235012817-235012839 GTCTCCTTCCTCCTGCTCCTTGG - Intronic
948076996 2:235172602-235172624 GTCACCTTCCTACTGCAATGTGG - Intergenic
1171142518 20:22755307-22755329 GCCACCTTGCTTCTGTTCTGTGG - Intergenic
1172230612 20:33333354-33333376 GCCTCCATCCTGCTGCTCCCAGG - Intergenic
1176122841 20:63461835-63461857 GCCTCCTCCCTGCTGCCCCGGGG - Intronic
1176122852 20:63461866-63461888 GCCTCCTCCCTGCTGCCCCGGGG - Intronic
1176122938 20:63462137-63462159 GCCTCCTCCCTGCTGCCCCGGGG - Intronic
1180006051 21:45021191-45021213 GCCACCTTCCTGCTACTCCCAGG - Intergenic
1180037929 21:45259493-45259515 GCCCCCTTCCTAGGGCTCTGTGG - Intergenic
1181149774 22:20874936-20874958 GCCAGCTTCCCACTCCTCCAAGG - Intronic
1182965102 22:34514062-34514084 GCCTTCTCCCCACTGCTCCGTGG + Intergenic
1184916087 22:47569949-47569971 GCCCCATTCCTACTGCACCAAGG - Intergenic
1184948020 22:47818093-47818115 GCCACCTTCTTTCTCCTGCGAGG + Intergenic
952161787 3:30701091-30701113 GGCACCTGCCTACTGTTCCATGG - Intergenic
953561219 3:43995275-43995297 GCCTCCTTCCTGCAGCGCCGCGG + Intergenic
956935325 3:74094445-74094467 GCCAGCATCCTACTGCCCCAGGG + Intergenic
959120373 3:102224973-102224995 CCCACCTTCCTTCAGCTCCCCGG - Intronic
964228098 3:154430236-154430258 TCCTCCTTCCTGCAGCTCCGAGG - Intergenic
970047795 4:11875873-11875895 GCCACCATCCTCCTGATCCCAGG - Intergenic
979350348 4:119637100-119637122 GCCACTTACCTCCTGCTCTGTGG + Intergenic
981173301 4:141650127-141650149 CCCATCTTCCTACTCCTCCAAGG + Intronic
987718457 5:21603511-21603533 ACCATCTTCCTATTGCTCCTAGG - Intergenic
991625216 5:68594096-68594118 GCCACTCTCCTCCTGCTCTGTGG - Intergenic
993176751 5:84496428-84496450 GCCTCAGTCCTACAGCTCCGAGG - Intergenic
1003224048 6:4188964-4188986 GCCCCCTTCCCACTGCGCCCTGG - Intergenic
1006480363 6:34288029-34288051 GCTACCTTCATAGTGCTCCCAGG - Exonic
1010550111 6:77211420-77211442 GCCACCATTCTACTGCTGTGTGG - Intergenic
1017435185 6:154409033-154409055 GCCACCTGCTGACTGCTCCATGG + Intronic
1017987922 6:159460699-159460721 GCCCCCTTGCTACTCCTCCAAGG + Intergenic
1018494631 6:164337240-164337262 GCCTCTCTCCAACTGCTCCGTGG + Intergenic
1019483602 7:1277351-1277373 GCCACCTTCCTACTGGGGGGGGG - Intergenic
1021842396 7:24731518-24731540 GCCTCCTTCCTGCAGCTCTGTGG + Intronic
1024634895 7:51278948-51278970 GCCACCTGCCGCCTGCTGCGTGG - Intronic
1032501687 7:132404454-132404476 GCCACCTGCCCACTGCCCCCTGG - Intronic
1034040395 7:147871334-147871356 GCCACATTCCTTCTCCTCCATGG + Intronic
1042876988 8:73449030-73449052 GGCACCTTGCTCCTGCGCCGGGG - Intronic
1043921338 8:85987254-85987276 GCAACCTTGCTGCAGCTCCGGGG - Intergenic
1051063833 9:13077450-13077472 GCCACTTACCTACTGCTGTGTGG + Intergenic
1052840532 9:33288808-33288830 CCCGCCTACCTACTGCTCCCAGG + Intergenic
1053282103 9:36827048-36827070 GCCACCCTCCCACTGCCCAGTGG - Intergenic
1056587704 9:87939084-87939106 GCCGCCCTCCTACTGGTCTGTGG + Intergenic
1056609166 9:88113855-88113877 GCCGCCCTCCTACTGGTCTGTGG - Intergenic
1060892712 9:127198782-127198804 GCTACCTTCCCACTGCCCCCGGG - Intronic
1061289235 9:129641529-129641551 CCCACCTTCACACTGCTCTGGGG + Intronic
1192095531 X:68206822-68206844 GCCACCTACCTACTGCACACAGG + Intronic
1195020983 X:100828260-100828282 GCCACATTCCAAGTGCTCAGTGG + Intronic