ID: 1122937405

View in Genome Browser
Species Human (GRCh38)
Location 14:104966549-104966571
Sequence CAACCTGCACAGACAGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 199}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122937395_1122937405 6 Left 1122937395 14:104966520-104966542 CCCCTGCTGCTCCCACCTGGACG 0: 1
1: 1
2: 0
3: 21
4: 365
Right 1122937405 14:104966549-104966571 CAACCTGCACAGACAGAACTTGG 0: 1
1: 0
2: 0
3: 12
4: 199
1122937397_1122937405 4 Left 1122937397 14:104966522-104966544 CCTGCTGCTCCCACCTGGACGCA 0: 1
1: 1
2: 1
3: 26
4: 235
Right 1122937405 14:104966549-104966571 CAACCTGCACAGACAGAACTTGG 0: 1
1: 0
2: 0
3: 12
4: 199
1122937390_1122937405 23 Left 1122937390 14:104966503-104966525 CCCACCACCTGACAGGGCCCCTG 0: 1
1: 0
2: 2
3: 39
4: 404
Right 1122937405 14:104966549-104966571 CAACCTGCACAGACAGAACTTGG 0: 1
1: 0
2: 0
3: 12
4: 199
1122937389_1122937405 24 Left 1122937389 14:104966502-104966524 CCCCACCACCTGACAGGGCCCCT 0: 1
1: 0
2: 4
3: 97
4: 1040
Right 1122937405 14:104966549-104966571 CAACCTGCACAGACAGAACTTGG 0: 1
1: 0
2: 0
3: 12
4: 199
1122937399_1122937405 -6 Left 1122937399 14:104966532-104966554 CCACCTGGACGCACCCCCAACCT 0: 1
1: 0
2: 1
3: 26
4: 301
Right 1122937405 14:104966549-104966571 CAACCTGCACAGACAGAACTTGG 0: 1
1: 0
2: 0
3: 12
4: 199
1122937400_1122937405 -9 Left 1122937400 14:104966535-104966557 CCTGGACGCACCCCCAACCTGCA 0: 1
1: 0
2: 1
3: 20
4: 184
Right 1122937405 14:104966549-104966571 CAACCTGCACAGACAGAACTTGG 0: 1
1: 0
2: 0
3: 12
4: 199
1122937398_1122937405 -5 Left 1122937398 14:104966531-104966553 CCCACCTGGACGCACCCCCAACC 0: 1
1: 0
2: 0
3: 26
4: 350
Right 1122937405 14:104966549-104966571 CAACCTGCACAGACAGAACTTGG 0: 1
1: 0
2: 0
3: 12
4: 199
1122937393_1122937405 16 Left 1122937393 14:104966510-104966532 CCTGACAGGGCCCCTGCTGCTCC 0: 1
1: 0
2: 3
3: 44
4: 418
Right 1122937405 14:104966549-104966571 CAACCTGCACAGACAGAACTTGG 0: 1
1: 0
2: 0
3: 12
4: 199
1122937392_1122937405 19 Left 1122937392 14:104966507-104966529 CCACCTGACAGGGCCCCTGCTGC 0: 1
1: 0
2: 5
3: 36
4: 424
Right 1122937405 14:104966549-104966571 CAACCTGCACAGACAGAACTTGG 0: 1
1: 0
2: 0
3: 12
4: 199
1122937391_1122937405 22 Left 1122937391 14:104966504-104966526 CCACCACCTGACAGGGCCCCTGC 0: 1
1: 0
2: 5
3: 37
4: 397
Right 1122937405 14:104966549-104966571 CAACCTGCACAGACAGAACTTGG 0: 1
1: 0
2: 0
3: 12
4: 199
1122937396_1122937405 5 Left 1122937396 14:104966521-104966543 CCCTGCTGCTCCCACCTGGACGC 0: 1
1: 1
2: 2
3: 17
4: 234
Right 1122937405 14:104966549-104966571 CAACCTGCACAGACAGAACTTGG 0: 1
1: 0
2: 0
3: 12
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122937405 Original CRISPR CAACCTGCACAGACAGAACT TGG Intronic
901275996 1:7991309-7991331 CAACCTCCAGACACAAAACTTGG + Intergenic
901475053 1:9483604-9483626 CAAACAGGACAGACAGAAATTGG - Intergenic
902255338 1:15185435-15185457 CCACCTGTACAGTAAGAACTTGG - Intronic
905305060 1:37012021-37012043 GCACCTGCCCAGACAGGACTTGG - Intronic
906560579 1:46753944-46753966 CACCCTGCCCAGGCAGATCTGGG - Intergenic
906598354 1:47100969-47100991 CAACCTACCCAGACTGAACTGGG - Intronic
911270492 1:95795862-95795884 CAACATGCACTGACAGGAGTAGG - Intergenic
911942665 1:104068088-104068110 CAACCTACCAAAACAGAACTAGG - Intergenic
915212908 1:154323627-154323649 CATCCTGGACAGACGGAACAAGG + Exonic
915602991 1:156933994-156934016 CCAGCTGCAGAGACAGAGCTGGG - Intergenic
917611035 1:176689239-176689261 CAAGCTACACAGATAGAAGTTGG + Intronic
918117599 1:181510366-181510388 CAAACTGCACAGACACAATGCGG + Intronic
922386710 1:225092951-225092973 CAACCTCCAAAGACTGATCTAGG + Intronic
922679144 1:227576455-227576477 CACCCTCCCCAGACTGAACTAGG - Intronic
922924797 1:229339661-229339683 CAGCCAGCCCAGACAGAAGTAGG + Intronic
924752334 1:246905852-246905874 CATCCCCCAGAGACAGAACTGGG + Intronic
1063013611 10:2051381-2051403 CATCCTGCACAACCAAAACTTGG - Intergenic
1066663062 10:37755417-37755439 CGACCTCCACAGATAGAATTTGG + Intergenic
1071999634 10:91182004-91182026 CACCCTCCAAAGACTGAACTAGG - Intronic
1072407850 10:95171133-95171155 CACCCAGCACTGACAGAACAAGG + Intergenic
1072509767 10:96108414-96108436 CAACCTCCCAAGGCAGAACTAGG - Intergenic
1072805899 10:98423967-98423989 CACCCAGGACAGACAGACCTGGG + Intronic
1073964242 10:108970159-108970181 GAAAGTGCAGAGACAGAACTGGG + Intergenic
1074032946 10:109707042-109707064 CAACAGGTACAGACAGACCTCGG + Intergenic
1075391386 10:122095090-122095112 CTAGCTGCAGAGACAGACCTGGG + Intronic
1076324429 10:129609947-129609969 CAAACTGCACAGACGTCACTGGG - Intronic
1076377858 10:130003466-130003488 CTGCCTGCAAAGACAGAGCTGGG + Intergenic
1077482627 11:2823518-2823540 GACCCTACACAGACAGAACAGGG + Intronic
1079402472 11:20116997-20117019 CCATCTGCACAGCCATAACTAGG - Intronic
1083017762 11:59474020-59474042 CAACCTGTAGTGACTGAACTTGG + Intergenic
1085527828 11:77174325-77174347 TCACCTGCACAGCCATAACTTGG + Intronic
1087065200 11:94021413-94021435 CAACCAGCCCAGACAGACCCAGG - Exonic
1087817094 11:102671255-102671277 CAACCTGCCAAGACTGAACCGGG - Intergenic
1088312576 11:108475755-108475777 CACCCTGCCCAGACATAAATTGG + Intronic
1090714805 11:129421045-129421067 CAACCTTCATAGACAGGATTTGG + Intronic
1091655744 12:2345693-2345715 CAACCTGCAGAGACAGTAACAGG - Intronic
1095174138 12:39071268-39071290 CAACCTGAAAAGACAGATCCAGG - Intergenic
1098558846 12:71850389-71850411 CAACCTGCTCAGAAGGAGCTGGG - Intronic
1099696176 12:86022420-86022442 CACCAGGCACAGACAGAACATGG - Intronic
1101650404 12:106672352-106672374 CAGCCTGGGCAGACAGAGCTGGG - Intronic
1101856546 12:108448251-108448273 CACCCTGGACAAACAGAAATCGG - Intergenic
1103074686 12:117972596-117972618 CTGGCTGCACAGACAGAACCTGG + Intergenic
1103175685 12:118861366-118861388 CAGCCTGCACAGATAGCCCTTGG + Intergenic
1103843222 12:123882331-123882353 CAGCCTGCACACACAGATCTGGG + Intronic
1103944376 12:124517959-124517981 CCACCTCCAGCGACAGAACTGGG + Intronic
1105244247 13:18634253-18634275 CACCCTCCCAAGACAGAACTAGG + Intergenic
1107301897 13:38974822-38974844 GAAGCAGAACAGACAGAACTTGG - Intronic
1108697024 13:52911428-52911450 CATCCTGCTCAGACAGAGCCAGG - Intergenic
1109819114 13:67628562-67628584 CAAACTGGAAAGACAAAACTTGG - Intergenic
1110555617 13:76856118-76856140 CAACATGCACAGACAAAGCAAGG + Intergenic
1111064858 13:83076729-83076751 CAACCTCCTAAGACTGAACTAGG + Intergenic
1111673181 13:91354443-91354465 CAAACTGTAAATACAGAACTAGG - Intergenic
1112185681 13:97125831-97125853 CAAACAGGACAGACAGAATTTGG - Intergenic
1112343194 13:98569143-98569165 CAGCCTGCACACACAGAAGCCGG + Intronic
1112604158 13:100887774-100887796 CAATCTGCACAGACCAACCTTGG - Intergenic
1112608525 13:100931827-100931849 CAACCTACAAAGACAGCATTCGG + Intergenic
1113098740 13:106694570-106694592 GAACCTGCACAGGCAGAAGAAGG - Intergenic
1117069207 14:52041643-52041665 GAACCTGCACACACATCACTTGG - Intronic
1117100214 14:52338253-52338275 CAACCTGCACAGATGCAACAAGG + Intergenic
1118916704 14:70113730-70113752 CAACATGCACAGATAGAGCCAGG + Intronic
1120829468 14:88985345-88985367 CAACCTGACCAGATAGAAATTGG + Intergenic
1121594188 14:95147068-95147090 CAACTTGAACACACAGAATTGGG + Intronic
1122711584 14:103662549-103662571 CTGCCTGCCCAGACAGTACTAGG + Intronic
1122937405 14:104966549-104966571 CAACCTGCACAGACAGAACTTGG + Intronic
1124200510 15:27674942-27674964 CAACCTGCAGATCCCGAACTCGG + Intergenic
1124556634 15:30731874-30731896 CAGCCTTCACAGACAGAAGAAGG + Intronic
1125401117 15:39304231-39304253 ATACATGCCCAGACAGAACTCGG - Intergenic
1125545568 15:40501731-40501753 CAATCAGCAAAGAGAGAACTTGG + Intergenic
1128551284 15:68599609-68599631 CACGCTGCCCAGACAGATCTGGG + Intronic
1128862924 15:71089787-71089809 CAACCTCCACAGACAGTATTGGG - Intergenic
1130039699 15:80395754-80395776 CAACCTGCCCAGAGAGGCCTGGG + Intronic
1130744734 15:86638938-86638960 CTACCAGCACGGAGAGAACTCGG - Intronic
1131071887 15:89471267-89471289 CAGGCTGAACAGGCAGAACTTGG - Intergenic
1131959751 15:97777063-97777085 CAACCTGCCTAGATAGAACCAGG + Intergenic
1133004272 16:2869433-2869455 CAACGTGGAGAGACAGAACAAGG + Intergenic
1133714973 16:8439264-8439286 CAACTTGGACAGACAGAGCAGGG - Intergenic
1133787682 16:8985872-8985894 CAACCATCCCAGACAGAAATGGG - Intergenic
1134896288 16:17889780-17889802 CAAGATGCACAGACAGAGCTTGG - Intergenic
1135035835 16:19076041-19076063 CATACAGCACAGACAGAGCTGGG + Intronic
1136095944 16:27956698-27956720 CTACCTGAACAGACACAAGTGGG + Intronic
1136677831 16:31929412-31929434 CAACCTCCCAAGACTGAACTGGG + Intergenic
1137819756 16:51432792-51432814 CTACCTTCACACACAGAACTGGG + Intergenic
1139389484 16:66597512-66597534 CAAACTGCCCAGAGAGACCTTGG + Intergenic
1141488052 16:84354149-84354171 CAACCTGCCCAAACACACCTGGG + Intergenic
1143651541 17:8266748-8266770 CGAACAGCACAGACAGGACTGGG - Exonic
1144161576 17:12565710-12565732 CAGCCTGCACAGACAGGCCGGGG - Intergenic
1144209720 17:13003873-13003895 CAACCTGCAAAGCCAGACCCAGG + Intronic
1145412265 17:22678521-22678543 CAACCTGCCCAGTCAAAACAAGG + Intergenic
1148702581 17:49598490-49598512 CAGCCAGCACATGCAGAACTGGG + Intergenic
1150116238 17:62552376-62552398 CATCCAGCACAGACAGACCCAGG + Exonic
1151178127 17:72305903-72305925 CTACATGCACAAAAAGAACTGGG + Intergenic
1151665927 17:75545132-75545154 TCAGCTGCACAGACAGAACTTGG - Intronic
1154444694 18:14425649-14425671 CACCCTCCCAAGACAGAACTAGG - Intergenic
1156732855 18:40216210-40216232 CAGCCTGCAGGCACAGAACTCGG - Intergenic
1161102528 19:2428321-2428343 CAACCTGCAAAAACGGAGCTGGG - Exonic
1161241759 19:3226915-3226937 CAACCTGTAAAAAAAGAACTGGG - Intronic
1162732618 19:12728091-12728113 CAACCTGCACAGACTGCATCTGG + Intergenic
1163805570 19:19394968-19394990 CCACCTCCAGAGTCAGAACTTGG - Intronic
1164526196 19:29015290-29015312 CAGCCTGGAGATACAGAACTGGG - Intergenic
1164927612 19:32142573-32142595 AAATGTGCATAGACAGAACTGGG - Intergenic
1166630194 19:44399973-44399995 AATCCTGCAGAGAGAGAACTGGG + Intronic
1166637266 19:44461463-44461485 AATCCTGCAGAGAGAGAACTGGG - Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
925035749 2:684206-684228 CACTGAGCACAGACAGAACTTGG + Intergenic
925812728 2:7716968-7716990 CAAACCTCCCAGACAGAACTGGG + Intergenic
925855715 2:8127225-8127247 CAAACCTCCCAGACAGAACTGGG + Intergenic
927162607 2:20282108-20282130 CCAGCTGCACCGATAGAACTGGG + Intronic
928862982 2:35882624-35882646 CACCCTGAAGAGAAAGAACTAGG + Intergenic
930543358 2:52735532-52735554 CAACCTGCAGAGACAAAAAGTGG - Intergenic
931722388 2:65076783-65076805 CACCGTGCCCAGCCAGAACTTGG - Intronic
935532902 2:104256970-104256992 CAACCTGCCAAGATAGAACCAGG + Intergenic
935689358 2:105716381-105716403 CATGCTGAAAAGACAGAACTGGG + Intergenic
937720228 2:125086457-125086479 CAACCTACAAAGCCAGAATTTGG - Intergenic
938543568 2:132306531-132306553 AATCCTGCAGAGAGAGAACTGGG - Intergenic
941015170 2:160347662-160347684 CAACTTCCACAGATAGAAATTGG - Intronic
943425121 2:187721954-187721976 CATACTGAACAGACAAAACTTGG - Intergenic
944431405 2:199637681-199637703 CAAAGTACAAAGACAGAACTAGG - Intergenic
945279465 2:208022541-208022563 CAACCAGCATAGAAAGAAATGGG - Intronic
945685732 2:212967172-212967194 GAAACTGCACAGAAAGAAATGGG + Intergenic
946933835 2:224699050-224699072 CAATGAGAACAGACAGAACTGGG + Intergenic
948019654 2:234720055-234720077 AAAACTGCTCAGACTGAACTAGG - Intergenic
1171872432 20:30539236-30539258 AATCCTGCAGAGAGAGAACTGGG - Intergenic
1172356398 20:34283241-34283263 CACCTTGGACAGACAGAGCTAGG + Intronic
1173149696 20:40556148-40556170 CACCCTCCAAAGACTGAACTAGG + Intergenic
1173333911 20:42097994-42098016 CAGCCTGTACAGACAGAGCCTGG - Intronic
1175497497 20:59424606-59424628 CAACCTGCTCAGTCACAGCTGGG + Intergenic
1176451292 21:6864214-6864236 CACCCTCCCAAGACAGAACTAGG + Intergenic
1176829461 21:13729265-13729287 CACCCTCCCAAGACAGAACTAGG + Intergenic
1177736671 21:25099043-25099065 CAAACTTGACAAACAGAACTCGG - Intergenic
1178270173 21:31182403-31182425 CACCCTGCACAGCCATACCTGGG + Exonic
1178926857 21:36783269-36783291 CAACCTCCAGAGCCAGAGCTTGG + Intronic
1180031507 21:45211805-45211827 CAGCCTGCAAAGAGGGAACTAGG - Intronic
1183283752 22:36949663-36949685 CAACCTTAACCGACAAAACTTGG - Intergenic
1184516770 22:44966962-44966984 CAACCTGCACACAGGGGACTTGG - Intronic
952999109 3:38915185-38915207 CACCCTGCCAAGACTGAACTGGG - Intronic
957257600 3:77858205-77858227 CAACCGGAATAGAAAGAACTTGG - Intergenic
957900755 3:86486081-86486103 CATCCTAGACAGCCAGAACTCGG - Intergenic
959988980 3:112609858-112609880 AAACCTGAACAGTCTGAACTAGG + Intronic
960081000 3:113540115-113540137 CAACCTGCACAGAGATCACATGG + Intronic
961782484 3:129328786-129328808 CAAGCAGCACAGTCAGACCTGGG + Intergenic
962143612 3:132817245-132817267 GAACCTGCAGTGACAGAACATGG + Intergenic
963509589 3:146230376-146230398 AAACCTGCACAGACACACATAGG - Intronic
963576166 3:147063069-147063091 CAGTCTGCACAGACAGAAAGAGG - Intergenic
966971206 3:185047099-185047121 CAACGTGCACAGGCAAAACTGGG - Intronic
967789318 3:193530333-193530355 AAACCTCCTCAGTCAGAACTAGG + Intronic
972625746 4:40797048-40797070 CAACTGCCACAGACAGACCTAGG - Intronic
972904927 4:43733802-43733824 CAACCTACAAAGACTGAACTAGG + Intergenic
973655896 4:53047490-53047512 CAACCTGCAAAGAAAATACTTGG - Intronic
974086503 4:57266440-57266462 CATCTTGAGCAGACAGAACTTGG - Intergenic
975140660 4:70915311-70915333 CAAAATGCACAGACAAAACAAGG + Intronic
977947632 4:102931703-102931725 CAACCTAAACATACAGAGCTGGG - Intronic
980535590 4:134117214-134117236 CAGCCTGCTCAGACACAACAGGG - Intergenic
982710986 4:158758598-158758620 CAACCTGGATAGATAGAAATAGG - Intergenic
986325517 5:6670360-6670382 CACCCAACACTGACAGAACTTGG + Intergenic
988069016 5:26263241-26263263 CAACCTCCAAAGACAGAATCAGG - Intergenic
991206226 5:64052981-64053003 CAACCTGGTCAGTCAGAGCTGGG - Intergenic
991768270 5:70013749-70013771 CAAAGTGCTCAGACAGAAATGGG - Intergenic
991847508 5:70888831-70888853 CAAAGTGCTCAGACAGAAATGGG - Intergenic
992332867 5:75735598-75735620 CAACAGGTACAGACAGAAATAGG + Intergenic
992352691 5:75947289-75947311 CAACCTCCAAAGACATAATTTGG - Intergenic
993268052 5:85753297-85753319 GCATATGCACAGACAGAACTAGG - Intergenic
994536920 5:101043024-101043046 CAAGAGGCACAGACAGAGCTGGG - Intergenic
999374208 5:151075683-151075705 GCACCTGCAGAGACAGAAGTGGG + Intronic
999552194 5:152701555-152701577 CAATCTGCAGAGGCAGAGCTGGG - Intergenic
999699896 5:154218705-154218727 CAAGCAGCCCAGACAGAATTGGG + Intronic
1000597501 5:163232605-163232627 CACCATGCACAGCCAGAAGTCGG + Intergenic
1001746121 5:174093657-174093679 GAACCTCCAGAGACAGAATTAGG - Intronic
1001960366 5:175876894-175876916 CAACCTGCAAACTCAGAATTCGG + Intronic
1003637417 6:7845403-7845425 CACCCTGCACAGACATAGCTGGG - Intronic
1005664290 6:28034952-28034974 AAACCTACAGAGGCAGAACTTGG + Intergenic
1006719392 6:36140288-36140310 CGAGCTGCACAGGCAGAAATGGG + Intronic
1007260963 6:40562727-40562749 CTCCATGCACAGACAGAAATAGG - Intronic
1009645705 6:66398279-66398301 TAACCTGCCAAGACTGAACTAGG + Intergenic
1015042396 6:128738146-128738168 GAACCTGAACAGACAGGCCTTGG - Intergenic
1016498866 6:144694949-144694971 CCACCTGCAGAGAGAGAATTTGG - Intronic
1019758683 7:2792417-2792439 CACCCTGCACTGACGGAACAGGG + Intronic
1021922107 7:25495781-25495803 CAAGCTGCAGAGACAGAGCGAGG + Intergenic
1023912497 7:44565892-44565914 CAGCCTGAACAGACAGTTCTGGG - Exonic
1024326647 7:48114363-48114385 GAACCTGCCCAGACAGGCCTGGG - Intergenic
1024511925 7:50211597-50211619 CCCCTTCCACAGACAGAACTTGG + Intergenic
1024710466 7:52009700-52009722 TAAGCTGCACAGTAAGAACTGGG + Intergenic
1026503408 7:70961948-70961970 CTTCCTTCACAGACAGAACACGG - Intergenic
1026616717 7:71911623-71911645 CCACCTGCACAGACATACTTAGG - Intronic
1029939292 7:104462953-104462975 CACCCTCCAAAGACTGAACTGGG - Intronic
1032045971 7:128608192-128608214 CATCCAGCACAGACAGACCCAGG + Intergenic
1032408284 7:131673692-131673714 CCACATGCAGACACAGAACTGGG + Intergenic
1034071568 7:148190987-148191009 CAACCAGTACAGACTGAACAAGG + Intronic
1035662189 8:1356488-1356510 CCACCAGCACAGACAGAACCAGG - Intergenic
1036026572 8:4915633-4915655 CAACCTTCACACCCAGACCTCGG + Intronic
1039093602 8:33858720-33858742 CAACCTCAACACCCAGAACTAGG - Intergenic
1043252572 8:78093595-78093617 CAAACTACACACACAGAATTTGG + Intergenic
1043313165 8:78886979-78887001 CAACAAGCACAGTCAGAAATAGG - Intergenic
1045479970 8:102584023-102584045 CAACCTCCACAGACAAAAGTAGG + Intergenic
1052558176 9:30047889-30047911 CAACCTGCAGACACATACCTAGG - Intergenic
1055640494 9:78315600-78315622 CTACCTCCCCAGACAGCACTGGG - Intronic
1056822839 9:89855536-89855558 CAACCTGCCCAGGCAGCATTTGG - Intergenic
1058949255 9:109888243-109888265 CAACTTGTAAATACAGAACTAGG - Intronic
1062191735 9:135251396-135251418 CAGCCTGCACAGCAAGAAGTGGG + Intergenic
1203517889 Un_GL000213v1:20303-20325 CACCCTCCCAAGACAGAACTAGG - Intergenic
1186719681 X:12289884-12289906 CAATCTGCACACCCAGACCTTGG + Intronic
1187170437 X:16846478-16846500 CAACGTACACAGACAGCACCAGG + Intronic
1187641023 X:21289872-21289894 TAACCTCCACAGATTGAACTAGG - Intergenic
1189652043 X:43200541-43200563 CAACCTCCCCAGACTGAACCAGG - Intergenic
1191045215 X:56129187-56129209 CCACTTGGACAGACAGAACAGGG + Intergenic
1194183390 X:90740670-90740692 CAACCTCCCAAGACAGAACCAGG + Intergenic
1194587512 X:95754099-95754121 CACCCTCCCCAGACTGAACTAGG - Intergenic
1194612911 X:96065141-96065163 CAACCTACACAGATTGAACCAGG - Intergenic
1196949632 X:120864150-120864172 CACCCTCCACAGACTGAACCAGG - Intergenic
1197602304 X:128544374-128544396 CAACCTACCCAGATTGAACTAGG - Intergenic
1199878769 X:151956115-151956137 CAACCTGCAGAGACAGACATTGG - Intronic
1200114231 X:153763148-153763170 CAACCTGCATGGAGAGAAATGGG - Intergenic
1200530004 Y:4322616-4322638 CAACCTCCCAAGACAGAACCAGG + Intergenic