ID: 1122938137

View in Genome Browser
Species Human (GRCh38)
Location 14:104969338-104969360
Sequence GGGCTAGAGCAGGCACGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 260}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122938137_1122938148 22 Left 1122938137 14:104969338-104969360 CCTCTCCGTGCCTGCTCTAGCCC 0: 1
1: 0
2: 1
3: 31
4: 260
Right 1122938148 14:104969383-104969405 CAGCCCTCACTGTGCCTGCCTGG 0: 1
1: 0
2: 4
3: 47
4: 341
1122938137_1122938152 30 Left 1122938137 14:104969338-104969360 CCTCTCCGTGCCTGCTCTAGCCC 0: 1
1: 0
2: 1
3: 31
4: 260
Right 1122938152 14:104969391-104969413 ACTGTGCCTGCCTGGGCCACAGG 0: 1
1: 0
2: 4
3: 45
4: 335
1122938137_1122938149 23 Left 1122938137 14:104969338-104969360 CCTCTCCGTGCCTGCTCTAGCCC 0: 1
1: 0
2: 1
3: 31
4: 260
Right 1122938149 14:104969384-104969406 AGCCCTCACTGTGCCTGCCTGGG 0: 1
1: 0
2: 3
3: 30
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122938137 Original CRISPR GGGCTAGAGCAGGCACGGAG AGG (reversed) Intronic
900429305 1:2594351-2594373 GGGCCTGGGCAGGCAGGGAGGGG + Intronic
900645139 1:3705608-3705630 GGGCTGGAGCACACAGGGAGAGG + Intronic
900746052 1:4361459-4361481 GGCTGAGAGCAGGCACTGAGGGG - Intergenic
900752682 1:4408672-4408694 GGGCATGAGCTGGCTCGGAGAGG + Intergenic
901240228 1:7688601-7688623 GGGCTAGGGCAGCCTCTGAGGGG + Intronic
901667388 1:10834488-10834510 AGGCTAGAGCAGGGAAGGAGGGG + Intergenic
901791237 1:11654667-11654689 CGGCTAGGGGAGGCACGGAGAGG + Exonic
902456747 1:16538967-16538989 TGGCTATACCAGGCACAGAGAGG + Intergenic
902474259 1:16672904-16672926 TGGCTATACCAGGCACAGAGAGG + Intergenic
902484544 1:16734538-16734560 TGGCTATACCAGGCACAGAGAGG - Intergenic
902495422 1:16868945-16868967 TGGCTATACCAGGCACAGAGAGG - Intronic
902817331 1:18923819-18923841 GGGCTACAGATGGCACTGAGTGG + Intronic
903157093 1:21453245-21453267 GTGCCAGAGCAGGGAGGGAGAGG - Intronic
903229154 1:21911444-21911466 GCCCCAGAGCAGGCAGGGAGTGG + Intronic
903262800 1:22140450-22140472 GAGCCCGAGCAGGCACAGAGGGG - Intronic
903829309 1:26165031-26165053 GGGGAAGGGCAGTCACGGAGAGG + Intergenic
903986912 1:27235031-27235053 GGGCTGGAGCCGGCCCAGAGCGG - Intronic
904467757 1:30718416-30718438 GGGCCAGAGCAGGCAGGGGGCGG - Intronic
904565174 1:31424542-31424564 GGGCTGGACCAGACAGGGAGGGG - Intronic
904830614 1:33304181-33304203 GAGAAAGGGCAGGCACGGAGAGG + Intergenic
905453857 1:38074250-38074272 GGGTTAGAGCAGCCAGGCAGGGG - Intergenic
906113119 1:43337818-43337840 GGGCTAAGGCAGGCACACAGTGG + Exonic
906406162 1:45544029-45544051 GGGCTAGGGCAGGCAGGCAAGGG - Intergenic
906540237 1:46579750-46579772 GGGCAAGTGGAGGCACAGAGGGG + Intronic
907414894 1:54307370-54307392 GGGCTAGGGGAGACAGGGAGAGG - Intronic
907447643 1:54519217-54519239 GGGCAAGACCAGGAAAGGAGGGG + Intergenic
907824288 1:58000490-58000512 GAGATAGAGCAGGCAGAGAGAGG - Intronic
909486225 1:76177578-76177600 GGCCTAGGGAAGGCACGGATGGG - Intronic
909594204 1:77386833-77386855 GGGTGAGCGCAGGCAGGGAGAGG - Intronic
911151893 1:94604162-94604184 GGGCTAGTATAGGGACGGAGAGG + Intergenic
911231476 1:95366146-95366168 CTACTAGAGCAGGCAGGGAGGGG + Intergenic
912508404 1:110172227-110172249 GGGCTGGGGCAGGCACTGAGTGG + Intronic
912624741 1:111197648-111197670 TGGATAGAGCAGGCAGGGAGAGG + Intronic
913055708 1:115157289-115157311 GGGCTAGAGCAGGATGGAAGGGG + Intergenic
913545158 1:119860652-119860674 GTGCCAGAGCAGGGAGGGAGAGG + Intergenic
913601897 1:120429188-120429210 GTGCCAGAGCAGGGAGGGAGAGG - Intergenic
913661993 1:121012610-121012632 CGGCTATACCAGGCACAGAGAGG + Intergenic
913992527 1:143627829-143627851 GTGCCAGAGCAGGGAGGGAGAGG + Intergenic
914013367 1:143795795-143795817 CGGCTATACCAGGCACAGAGAGG + Intergenic
914085146 1:144447415-144447437 GTGCCAGAGCAGGGAGGGAGAGG + Intronic
914164458 1:145165390-145165412 CGGCTATACCAGGCACAGAGAGG - Intergenic
914363078 1:146952827-146952849 GTGCCAGAGCAGGGAGGGAGAGG - Intronic
914488600 1:148134312-148134334 GTGCCAGAGCAGGGAGGGAGAGG + Intronic
914588964 1:149089393-149089415 GTGCCAGAGCAGGGAGGGAGAGG + Intronic
914651991 1:149704404-149704426 CGGCTATACCAGGCACAGAGAGG + Exonic
915611262 1:156995157-156995179 GGGCTAGAGTAGACATGGGGAGG - Intronic
917968344 1:180192415-180192437 GGGCTACTGCAGGCAGGGGGAGG + Intronic
918791319 1:188834203-188834225 GGGCTAGAGGAGGCCGGGCGCGG + Intergenic
920564239 1:206960844-206960866 GGGCTAGAGCCAGCAAGGACAGG - Exonic
921569639 1:216763068-216763090 GGGTTAGTGCAGGCAAGAAGGGG + Intronic
924433951 1:244022115-244022137 GTGCCACAGCAGGCAAGGAGAGG - Intergenic
924624079 1:245685846-245685868 GGGCCAGAGCAGGCAAGCAGAGG + Exonic
1063009804 10:2011252-2011274 GGGCTGGAGCAGGCACAGCGTGG + Intergenic
1065562838 10:26980764-26980786 AGGCTAGAGCATGCAGGCAGAGG + Intergenic
1065635552 10:27729595-27729617 GGCCTAGTGCAGGCCAGGAGCGG - Intronic
1067224916 10:44369364-44369386 GGGTTAGAGCAGGCCGGGAAGGG - Intergenic
1067350899 10:45474749-45474771 CACCTAGAGCAGGCAAGGAGAGG + Intronic
1069990086 10:72309788-72309810 AGGCTACAGCAGGGACGGAAGGG - Intergenic
1071388875 10:85149872-85149894 AGGATAGAGCAGACACAGAGAGG + Intergenic
1072620587 10:97076517-97076539 TGGAGAGAGCAGGCAGGGAGGGG - Intronic
1073186776 10:101619774-101619796 GGGCTGGAACAGGGATGGAGGGG - Intronic
1073566225 10:104537857-104537879 GGGCTAGTGCAGGCAGTGGGTGG - Intergenic
1075092148 10:119449839-119449861 GAGCTTGAGCAGGCAGGGGGAGG + Intronic
1075123515 10:119681568-119681590 TGGCTAGAGAAGGCAAGGACAGG - Intergenic
1075687008 10:124371271-124371293 GGGGTAGAGGAAGCAGGGAGTGG - Intergenic
1075877063 10:125816362-125816384 GGCCTGGAGCAGGCAGGGATGGG - Intronic
1076149180 10:128149426-128149448 GGGGTGGAGCTGGCAGGGAGAGG + Intergenic
1077154574 11:1085643-1085665 TGGCCAGGGCAGGCAGGGAGGGG - Intergenic
1077327590 11:1970441-1970463 GGGCTGGAGCAGACCCGGGGTGG - Intronic
1077610925 11:3642636-3642658 GGCCCAGAGCAGGCAGGGAGTGG - Intergenic
1078195611 11:9134401-9134423 GAGCAAGAGTAGGCAGGGAGAGG - Intronic
1080387410 11:31818153-31818175 GGGCTAGAGCAGTCACAGGCCGG - Intronic
1081650193 11:44818604-44818626 GGGATAGGGCAGGCAGGCAGAGG - Intronic
1083324825 11:61867801-61867823 GGGCTGGAGAAGGCCGGGAGCGG + Intergenic
1083329213 11:61889703-61889725 AGACTAGAGCAGGCCGGGAGTGG + Intronic
1083477195 11:62922265-62922287 GGGGTGGAGCAGGCAGGTAGAGG - Intergenic
1083673613 11:64313799-64313821 GGCCATGAGCAGGCAGGGAGGGG - Intronic
1084162546 11:67357643-67357665 GGGCTAGAGGAGGCTCTGATGGG - Intronic
1084434696 11:69132054-69132076 GGGTTACAGCAGGGAGGGAGGGG - Intergenic
1084502786 11:69544709-69544731 GAGGAAGAGCAGCCACGGAGAGG + Intergenic
1084674207 11:70624689-70624711 GGGCTGGTGCTGGCATGGAGTGG + Intronic
1085389188 11:76173660-76173682 GAGACAGAGCAGGCCCGGAGGGG + Intergenic
1085788148 11:79473118-79473140 GGGGTAGAGCAGGGAAGAAGGGG + Intergenic
1086445955 11:86870467-86870489 GAGCTAGAACAGGCATGGAGGGG + Intronic
1088656428 11:112004383-112004405 TGCCTAGAGCAGGGACGGAGGGG - Intronic
1090086301 11:123654042-123654064 CGGCGAGAGCGGGCGCGGAGCGG - Exonic
1202810572 11_KI270721v1_random:25621-25643 GGGCTGGAGCAGACCCGGGGTGG - Intergenic
1091798103 12:3308772-3308794 GGGCTGGAGGGGGCAGGGAGAGG + Intergenic
1091923122 12:4321392-4321414 GGGCTGGAGCGAGCAGGGAGGGG - Intronic
1092529503 12:9332716-9332738 GGGTGAGAGCAGGCACAGAGGGG + Intergenic
1093117910 12:15234195-15234217 GGGTGAGAGTAGGCACCGAGTGG - Intronic
1093800476 12:23366364-23366386 GGGCAAGAGTGGGCATGGAGAGG - Intergenic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096760413 12:53836912-53836934 GGGCTAGTGCAGACACTGGGGGG + Intergenic
1097259685 12:57711116-57711138 GGGCTGGAGCAGGGATGGCGGGG - Intronic
1098138512 12:67428124-67428146 GGGGTAGAGCAGGAATGCAGGGG - Intergenic
1103698700 12:122836094-122836116 GGGCAGGAGCCGGCAAGGAGCGG - Intronic
1103731165 12:123028770-123028792 AGGCTAGAGCGGGCACAGACGGG + Intronic
1103944002 12:124516321-124516343 GGCCCAGGGCTGGCACGGAGGGG + Intronic
1104007732 12:124905896-124905918 GGGCTGGAGGAGGCCGGGAGTGG - Intergenic
1104588251 12:130064326-130064348 GGGCTAGAGCATGGACGTGGGGG + Intergenic
1104874751 12:132026224-132026246 GGGCCAAGGCAGGCACAGAGCGG - Intronic
1104990269 12:132620587-132620609 GGGCAAGCGCAGGCAGGGTGGGG + Intronic
1108601211 13:51996765-51996787 AGGATAAAGCAGGCACGAAGGGG - Intronic
1112384914 13:98930554-98930576 GGGCTAGATCAAGCACTTAGGGG - Intronic
1117054631 14:51899202-51899224 GGGCTGAAACAGGCAGGGAGAGG - Intronic
1117875683 14:60248823-60248845 GGCCAAGGGCCGGCACGGAGGGG + Intronic
1117877766 14:60273455-60273477 CGGCTAGAGAAGGTACGTAGGGG + Intronic
1118208245 14:63743321-63743343 GGGCTAGAGAAGACACAGAGAGG + Intergenic
1119703542 14:76770599-76770621 GGGCTAGAGCAGGGACACAGAGG - Intronic
1120630242 14:86881651-86881673 AGCCTAGAGCAGGCAGGGATGGG + Intergenic
1120789840 14:88569678-88569700 GTGCAAGAGGAGGCACTGAGTGG + Intronic
1121008800 14:90507774-90507796 GGACCAGGGCAGGCAGGGAGAGG - Intergenic
1121643487 14:95501860-95501882 GGCCTAGAGCAGGCAGGGGTTGG + Intergenic
1122119975 14:99547353-99547375 GGGCTGGTGCAGGCAAGGAGGGG + Intronic
1122324831 14:100875754-100875776 GGGGTAGACCAGGAAGGGAGCGG - Intergenic
1122694270 14:103545242-103545264 GGCCTAGAGATGGCACGGAGGGG + Intergenic
1122767564 14:104082482-104082504 TGGCCAGAGCAGCCACGGAGTGG - Intergenic
1122815557 14:104310446-104310468 GGGCCAGAGCAGGCAATCAGGGG - Intergenic
1122938137 14:104969338-104969360 GGGCTAGAGCAGGCACGGAGAGG - Intronic
1124176886 15:27434734-27434756 GGCATAGAGTAGGCAGGGAGTGG + Intronic
1124437963 15:29666608-29666630 GGGCTGGTGCAGGCACGGTGAGG - Intergenic
1124502016 15:30236721-30236743 GGCCTGGAGCATGCAGGGAGAGG + Intergenic
1124609950 15:31201399-31201421 GGGACAGAGCAGGCAGGCAGGGG - Intergenic
1124741548 15:32301931-32301953 GGCCTGGAGCATGCAGGGAGAGG - Intergenic
1125584887 15:40813168-40813190 GGGCTGGGGCAGGCAGGGACAGG + Intronic
1127357888 15:58218474-58218496 GTACTAGAGGAGGCAGGGAGGGG - Intronic
1130856269 15:87842328-87842350 GGGCTTGACCAGGGACTGAGAGG - Intergenic
1130908887 15:88257534-88257556 GGCCTTGAGCAGGCATGGATCGG + Intergenic
1132527971 16:426709-426731 GGGGCAGAGCAGGTACGGAGCGG + Exonic
1132567390 16:629807-629829 GGGCTGGAGCTGCCAGGGAGGGG - Intronic
1132670079 16:1098936-1098958 GGGCTGGAGCAGACACGGCACGG + Intergenic
1132677375 16:1126383-1126405 GGGCCAGAGCTGGAACTGAGAGG + Intergenic
1134443097 16:14310934-14310956 CAGCTAGAGCAGGCACTGAGAGG + Intergenic
1138287395 16:55820801-55820823 GGGCTAGGGGAGGCAGGCAGAGG - Intronic
1138591013 16:58000001-58000023 GGGAGAGAGGAGGCAAGGAGAGG + Intronic
1139345448 16:66300251-66300273 GGCCTGGAGCAGCCATGGAGGGG - Intergenic
1139476686 16:67206388-67206410 AGGCCAGAGCTGGCACTGAGGGG - Intergenic
1139593757 16:67946869-67946891 GGACTGCAGCTGGCACGGAGGGG - Intronic
1141205187 16:81927989-81928011 GGGGTGGTGCAGGCAAGGAGTGG + Intronic
1143020170 17:3913491-3913513 GGGCAAGTGCAGGCAGTGAGTGG - Intronic
1144219361 17:13086113-13086135 GGGCACCAGCAGGCACGGGGAGG - Intergenic
1144679316 17:17182449-17182471 GGGCTACAGGAGGCACTCAGTGG + Intronic
1144698565 17:17322117-17322139 GTGATAGAGCAGGAATGGAGAGG + Intronic
1145772339 17:27502509-27502531 GGGCTAGAGAATGGAAGGAGAGG - Intronic
1147257043 17:39187599-39187621 GGTCTAGAGGAGGCACACAGGGG + Exonic
1148911694 17:50946452-50946474 GGCCCAGAGAAGGCAAGGAGTGG - Intergenic
1151685263 17:75642445-75642467 TGGCAATAGCAGGCAGGGAGGGG + Intronic
1151759676 17:76093455-76093477 GGGCATGAGCAGGCAGGGACTGG + Intronic
1151828246 17:76535493-76535515 GGGCTTGGGCTGGCAGGGAGTGG + Intronic
1156579882 18:38362671-38362693 GCCCTAGAACAGGCACAGAGTGG - Intergenic
1158793913 18:60818187-60818209 GGGTTAGAGCAGGAATGGGGAGG + Intergenic
1159922653 18:74239916-74239938 GGCCAAGAGCAGGCACAGGGAGG - Intergenic
1161220260 19:3115082-3115104 GGGCCACAGCAGGCGGGGAGGGG + Intronic
1161267169 19:3369719-3369741 GGCCCAGAGCAGGCGCGGGGAGG - Intronic
1162412216 19:10513365-10513387 TGCCTGGAGCAGGGACGGAGGGG - Exonic
1163129044 19:15260614-15260636 GGCCTAGTGCAGGCAAGGGGTGG - Intronic
1163477301 19:17533832-17533854 GGGCTGCTGCAGGCAGGGAGTGG - Intronic
1163830926 19:19546854-19546876 GGGCTACAGCAGGCAGGGAGGGG + Intergenic
1164813388 19:31175778-31175800 GGCCAGGAGCAGGCAGGGAGTGG + Intergenic
1167116776 19:47493091-47493113 GGGCTGGGGCAGGCAGGAAGGGG + Intronic
1167529902 19:50008693-50008715 AGGCTGCAGCAGGCACGGGGGGG + Intronic
1202707637 1_KI270713v1_random:35308-35330 TGGCTATACCAGGCACAGAGAGG + Intergenic
925104752 2:1281894-1281916 GGGCTTGAGGAGACACGGACGGG - Intronic
925959379 2:9001830-9001852 GGGCTATGGCAGACATGGAGCGG + Intronic
927930315 2:27039649-27039671 GGCCCAGAGCAGGCACAGCGAGG - Intronic
929086855 2:38176527-38176549 TGGCCAGAGCAGGCTCTGAGAGG + Intergenic
929596283 2:43178405-43178427 GGGCCAGAGGAGGAATGGAGTGG + Intergenic
929904665 2:46035465-46035487 GGGATGGAGCAGGCAGGGACTGG - Intronic
930186819 2:48419461-48419483 GGCCTAGAGCAGGGAGGGACTGG + Intergenic
931905764 2:66841807-66841829 GGGCTAGATCAGGCCTGCAGAGG - Intergenic
932412501 2:71555603-71555625 GAACCAGAGCAGGCTCGGAGAGG + Intronic
932453068 2:71828146-71828168 GGTGTAGAGCAGGGATGGAGGGG - Intergenic
932691286 2:73915870-73915892 GGGCTGGGGCAGGGATGGAGGGG + Intronic
932758684 2:74425831-74425853 GGTCTAGACCAGGCAGAGAGAGG + Intronic
938114297 2:128592661-128592683 GGGGTAGAGCAGACAGGGACAGG - Intergenic
938139046 2:128781772-128781794 GGGGGAGACCAGGCATGGAGGGG + Intergenic
938901882 2:135805334-135805356 GGGCCAGAGCAGGCTCCCAGAGG - Intronic
939877896 2:147598756-147598778 GGTCTAGGGCAGGAACAGAGTGG - Intergenic
941266853 2:163373073-163373095 GGGCAAGAGCAGAAACAGAGAGG + Intergenic
942895434 2:181047751-181047773 GGTCTGGAGGAGGCCCGGAGGGG - Intronic
944504625 2:200397926-200397948 CAGCCAGAGCAGGCAGGGAGAGG + Intronic
947501971 2:230677422-230677444 GGGCAAATGCAGGCAGGGAGAGG + Intergenic
948112062 2:235464189-235464211 GGGCCAGGGCAGGCAGGGAAGGG - Intergenic
948675566 2:239594684-239594706 GGGCCTGAGCAAGGACGGAGGGG + Intergenic
948778597 2:240303187-240303209 GGGCTAGAGAAGGCAATAAGGGG - Intergenic
948894740 2:240922818-240922840 GGGCTGGAGAAGGCACGGCTGGG + Intronic
1169265011 20:4162171-4162193 GGGCTGGGGCAGGCCCTGAGCGG + Intronic
1172078059 20:32314903-32314925 AGGCAAGAGCAGGCTCTGAGTGG - Intronic
1173682487 20:44895134-44895156 GGGCTAGGGCAGTCAGGGAAGGG + Intronic
1175992724 20:62797420-62797442 GGACCCCAGCAGGCACGGAGGGG - Intronic
1179676802 21:42988758-42988780 GGGCTGGCCCAGGAACGGAGTGG + Intronic
1180095176 21:45553086-45553108 GGGCTGGGGCAGGACCGGAGCGG + Intergenic
1182430683 22:30297225-30297247 GCCCTAGAGCAGGCACATAGCGG + Intronic
1183079557 22:35447807-35447829 GGGTTGGGGCAGGCAAGGAGCGG + Intergenic
1183415108 22:37677254-37677276 AGGCTACAGCAGGGAGGGAGCGG - Intronic
1183927760 22:41218103-41218125 GCGCTAGCCCAGGCACGCAGGGG - Intronic
1184549738 22:45198125-45198147 GGGCCAGAGGAAGCAGGGAGGGG - Intronic
1185064199 22:48622544-48622566 GGGCTGGAGCAGACATGGAGGGG + Intronic
950024559 3:9811203-9811225 GGGCTGGAAGGGGCACGGAGAGG - Intronic
950342541 3:12260188-12260210 GGGCTGGGGGAGGCAAGGAGGGG + Intergenic
950520148 3:13493282-13493304 GGGCTAGAGCAGGCTCTATGTGG - Intronic
953882064 3:46695735-46695757 GGGCTCGAGCAGGAAGGGAAGGG + Intergenic
954690440 3:52392746-52392768 GGCCTAGGGCAGGCAGGGAGAGG - Intronic
959083557 3:101827817-101827839 GGGCCAGAGGAGGCAGGGAGGGG - Exonic
960533216 3:118788365-118788387 GGGCAAGAGAAGGGAAGGAGGGG - Intergenic
961009175 3:123424559-123424581 GGGCTAGAACAAGCACAGCGAGG + Intronic
964307232 3:155354965-155354987 GGGCTTGAGCAGGACAGGAGAGG + Intergenic
967305193 3:188052507-188052529 GGGCTAGCTCTGGCAGGGAGTGG - Intergenic
969375779 4:6762191-6762213 GGGCTGGGCCAGGCACGGGGAGG + Intergenic
969402144 4:6962697-6962719 GGGAGAGAGCAGGCAAGGAGTGG - Intronic
969604830 4:8197223-8197245 AGGCTGGAGCAGGCAGGAAGAGG + Intronic
970726129 4:19047021-19047043 GGGTTAGAGAAGGCAAGGATGGG - Intergenic
971005543 4:22370368-22370390 GGGGTGGAGCAGCCACTGAGTGG + Intronic
972762081 4:42116447-42116469 GGGGTAAAGGAGGCACGGAGGGG + Exonic
973609632 4:52623157-52623179 GAGATAGAGCAGACAGGGAGTGG + Intronic
975394027 4:73853941-73853963 TGGGCAGAGGAGGCACGGAGCGG - Intronic
975405202 4:73981363-73981385 TGGGCAGAGGAGGCACGGAGCGG + Intronic
976211731 4:82678053-82678075 GGGCTAGACCAGGCAACTAGGGG + Intronic
977778355 4:100950736-100950758 GGACAAGAGCAGGGACAGAGAGG - Intergenic
977796225 4:101168128-101168150 GGGCTAGTGCAGACAGGGAATGG + Intronic
982109623 4:152041775-152041797 GGGATAGGGCATGCAGGGAGGGG - Intergenic
984065456 4:175042811-175042833 TGGCCAGAGCAGGCACTGCGGGG - Intergenic
984531548 4:180922635-180922657 GCGCTAAAGCAGGCAGGGAAGGG + Intergenic
985663622 5:1169849-1169871 AGGCTACAGCAGGGAAGGAGGGG + Intergenic
986026301 5:3854523-3854545 GGGCTCGCGCTGGCACGGACAGG - Intergenic
988694457 5:33606517-33606539 TGGCTAGAGTGGGCACGCAGTGG - Intronic
993706067 5:91172316-91172338 GGGCTGGAGCAGGAAGGAAGGGG - Intergenic
996485117 5:124024517-124024539 GGGGTAAAGCAGGGAAGGAGAGG - Intergenic
998455149 5:142266332-142266354 GGATGAGAGCAGGCACAGAGTGG - Intergenic
999285377 5:150391430-150391452 GGGCTGGAGCAGGGACTGAGGGG - Intronic
999439571 5:151591019-151591041 TGGCTGGAACAGGCACAGAGAGG - Intergenic
1001154274 5:169259408-169259430 GGGCTACAACAGGTAGGGAGAGG + Intronic
1001963603 5:175895073-175895095 GGGGTAGAATAGGCAGGGAGAGG - Intergenic
1002066839 5:176656144-176656166 GGGCTGGGGCAGGCAGGCAGGGG + Intronic
1002549253 5:179974819-179974841 GGGAGAGAGCAGGCACGCAGCGG + Intronic
1002564098 5:180100317-180100339 GGCCTAGAGCAGGCCAGGGGTGG + Intergenic
1002805577 6:570876-570898 GGGACAGAGCAGACACAGAGAGG + Intronic
1003315869 6:5011436-5011458 TGGCCAGTGCAGGCACTGAGCGG + Intergenic
1003934490 6:10961132-10961154 GGGGATGAGCAGGCAGGGAGGGG + Intronic
1005682048 6:28217475-28217497 GATCTAGTGCAGGCACGGAATGG - Intergenic
1006797442 6:36740918-36740940 GGCCTGCACCAGGCACGGAGAGG + Exonic
1006939466 6:37742443-37742465 GGGCAAGAGGAGGCAGGAAGGGG - Intergenic
1007390344 6:41546832-41546854 GGGCCGGAGCCCGCACGGAGCGG + Exonic
1007767610 6:44170169-44170191 AGGCTGCAGCAGGCAGGGAGTGG - Intronic
1009379467 6:63009872-63009894 GGGCTAGAACAATCCCGGAGGGG - Intergenic
1015875360 6:137817053-137817075 GGCCTAGAGCATGCATGGAAAGG + Intergenic
1016355592 6:143214781-143214803 GGGAGAGAACAGGCATGGAGAGG - Intronic
1017022572 6:150152315-150152337 GAGCTGGAGCAGGGACAGAGCGG - Intronic
1017672273 6:156778826-156778848 GGGCTACAGCCGGCCCGGCGCGG + Exonic
1018859137 6:167698461-167698483 AGGCAAGAGCAGGCGGGGAGAGG + Intergenic
1020564655 7:9779616-9779638 GGGCCAGAGTAGACATGGAGTGG - Intergenic
1022518225 7:30988916-30988938 GGCGTGGCGCAGGCACGGAGGGG + Intronic
1024825609 7:53386455-53386477 GGGCTGGAGCAGGGAAGAAGTGG - Intergenic
1027431071 7:78113141-78113163 GGGATAGAACACGCAGGGAGGGG + Intronic
1028850732 7:95534530-95534552 GGGCTAGTGCTGGGAAGGAGGGG - Intronic
1029469978 7:100748214-100748236 GGGTGAGAGCAGGCCCTGAGAGG + Exonic
1030063246 7:105639841-105639863 GGGCGGGAGCAGGCACCGAAGGG + Intronic
1031236852 7:119188212-119188234 AGGCTAGAGCAGGTTCTGAGGGG + Intergenic
1031593315 7:123619821-123619843 GGGCAAGAGCAGGCAAGAAGGGG - Intronic
1031969621 7:128054652-128054674 GGGATAGAGGAGCCAGGGAGAGG - Intronic
1032541137 7:132704033-132704055 GGACCAGAGCAGTCACGGGGTGG + Intronic
1035020304 7:155796902-155796924 GGGCTGGGGCCGGCCCGGAGAGG - Intergenic
1035241622 7:157534298-157534320 GGGCTGGAGTAGGGAGGGAGAGG - Intergenic
1039489284 8:37935671-37935693 GGGCTGGAGCAGGAAGGGATGGG - Intronic
1040471288 8:47737758-47737780 GCGCTTGAGCAGGCGGGGAGCGG + Exonic
1041135132 8:54749920-54749942 GGGCTAGAGAATTCATGGAGGGG + Intergenic
1041648910 8:60281682-60281704 GGGCTAGGCCAGGCACACAGGGG - Intergenic
1042101609 8:65280712-65280734 AAGCTAGAGGAGGCAAGGAGAGG - Intergenic
1046663862 8:116977798-116977820 GTGGTAGAGCAGGCTGGGAGTGG - Intronic
1049654940 8:143793241-143793263 GGGACAGAGCACTCACGGAGTGG + Intronic
1049685999 8:143939609-143939631 GGAGTACAGCAGGCAGGGAGTGG - Intronic
1049796105 8:144497929-144497951 AGCCTAGGGCAGGCACTGAGAGG - Intronic
1053131574 9:35618516-35618538 GGGCCAGAGGGGCCACGGAGGGG + Intronic
1055010659 9:71561473-71561495 GGGCTAGAGCCGCCATGGAAAGG - Intergenic
1057182380 9:93037076-93037098 AGGCTGGAGCAGGGACGGGGTGG + Intergenic
1057937773 9:99255339-99255361 GGGCTGGAGGAGGCAAGGATGGG - Intergenic
1058447409 9:105066151-105066173 AGGCTCCAGCAGGCACAGAGGGG + Intergenic
1060585044 9:124780451-124780473 GGGCTAGAGCAGGCAGGCGGTGG + Intronic
1060662527 9:125412889-125412911 GGCCCAGAGCAGGCAAGGAGGGG - Intergenic
1060789016 9:126473281-126473303 GGGCTATGGCAGGGAAGGAGGGG - Intronic
1060962548 9:127691358-127691380 GGATGAGAGCAGGCACTGAGGGG - Exonic
1061007208 9:127935047-127935069 GGGCTGGAGCGGGCTGGGAGCGG - Intergenic
1061520289 9:131113763-131113785 GAGCTGGAGCAGGCAGGGAGTGG + Intronic
1061991068 9:134159069-134159091 GGGCTCCAGCAGGGACGGCGAGG - Exonic
1062460025 9:136659140-136659162 GGGCCGGAGCAGGCAGGGAGAGG + Exonic
1185597259 X:1314678-1314700 GGGGTTGGGCAGGCACAGAGGGG - Intergenic
1185597324 X:1314944-1314966 GGGGTTGGGCAGGCACAGAGGGG - Intergenic
1187948207 X:24447016-24447038 GGTCTAGACCAGGCAGGGATAGG + Intergenic
1190004458 X:46721784-46721806 AGTCTAGAGCAGGTAGGGAGGGG + Intronic
1196456209 X:115893216-115893238 GGGCTAGAGCTGGCCCAAAGTGG - Intergenic
1197758678 X:130013444-130013466 GGACTGGGGCAGGGACGGAGAGG - Exonic
1200039394 X:153354860-153354882 GGGCTGGGGCAGGGATGGAGAGG - Intronic