ID: 1122939248

View in Genome Browser
Species Human (GRCh38)
Location 14:104973879-104973901
Sequence CTCCCCTCCCCTCCGGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 708
Summary {0: 1, 1: 1, 2: 5, 3: 62, 4: 639}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122939248_1122939260 21 Left 1122939248 14:104973879-104973901 CCCGCAGCCGGAGGGGAGGGGAG 0: 1
1: 1
2: 5
3: 62
4: 639
Right 1122939260 14:104973923-104973945 TGCCTGGCCTCTGTGGGGTGCGG 0: 1
1: 1
2: 2
3: 63
4: 461
1122939248_1122939268 30 Left 1122939248 14:104973879-104973901 CCCGCAGCCGGAGGGGAGGGGAG 0: 1
1: 1
2: 5
3: 62
4: 639
Right 1122939268 14:104973932-104973954 TCTGTGGGGTGCGGGGATGGGGG 0: 1
1: 0
2: 14
3: 477
4: 8036
1122939248_1122939256 14 Left 1122939248 14:104973879-104973901 CCCGCAGCCGGAGGGGAGGGGAG 0: 1
1: 1
2: 5
3: 62
4: 639
Right 1122939256 14:104973916-104973938 AAACCTCTGCCTGGCCTCTGTGG 0: 1
1: 0
2: 2
3: 34
4: 330
1122939248_1122939266 28 Left 1122939248 14:104973879-104973901 CCCGCAGCCGGAGGGGAGGGGAG 0: 1
1: 1
2: 5
3: 62
4: 639
Right 1122939266 14:104973930-104973952 CCTCTGTGGGGTGCGGGGATGGG 0: 1
1: 0
2: 1
3: 52
4: 910
1122939248_1122939263 23 Left 1122939248 14:104973879-104973901 CCCGCAGCCGGAGGGGAGGGGAG 0: 1
1: 1
2: 5
3: 62
4: 639
Right 1122939263 14:104973925-104973947 CCTGGCCTCTGTGGGGTGCGGGG 0: 1
1: 0
2: 6
3: 49
4: 369
1122939248_1122939261 22 Left 1122939248 14:104973879-104973901 CCCGCAGCCGGAGGGGAGGGGAG 0: 1
1: 1
2: 5
3: 62
4: 639
Right 1122939261 14:104973924-104973946 GCCTGGCCTCTGTGGGGTGCGGG 0: 1
1: 0
2: 2
3: 52
4: 465
1122939248_1122939264 27 Left 1122939248 14:104973879-104973901 CCCGCAGCCGGAGGGGAGGGGAG 0: 1
1: 1
2: 5
3: 62
4: 639
Right 1122939264 14:104973929-104973951 GCCTCTGTGGGGTGCGGGGATGG 0: 1
1: 0
2: 12
3: 59
4: 831
1122939248_1122939255 5 Left 1122939248 14:104973879-104973901 CCCGCAGCCGGAGGGGAGGGGAG 0: 1
1: 1
2: 5
3: 62
4: 639
Right 1122939255 14:104973907-104973929 TGGCTGCAAAAACCTCTGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 159
1122939248_1122939258 16 Left 1122939248 14:104973879-104973901 CCCGCAGCCGGAGGGGAGGGGAG 0: 1
1: 1
2: 5
3: 62
4: 639
Right 1122939258 14:104973918-104973940 ACCTCTGCCTGGCCTCTGTGGGG 0: 1
1: 0
2: 1
3: 41
4: 358
1122939248_1122939257 15 Left 1122939248 14:104973879-104973901 CCCGCAGCCGGAGGGGAGGGGAG 0: 1
1: 1
2: 5
3: 62
4: 639
Right 1122939257 14:104973917-104973939 AACCTCTGCCTGGCCTCTGTGGG 0: 1
1: 0
2: 2
3: 30
4: 295
1122939248_1122939267 29 Left 1122939248 14:104973879-104973901 CCCGCAGCCGGAGGGGAGGGGAG 0: 1
1: 1
2: 5
3: 62
4: 639
Right 1122939267 14:104973931-104973953 CTCTGTGGGGTGCGGGGATGGGG 0: 1
1: 0
2: 3
3: 79
4: 1010

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122939248 Original CRISPR CTCCCCTCCCCTCCGGCTGC GGG (reversed) Intronic
900368747 1:2322265-2322287 CTCCCCTCCCCTGAGCCTGCCGG + Intronic
900435685 1:2629521-2629543 CTCCCCTGCCCTGGGCCTGCAGG - Exonic
900479815 1:2892652-2892674 GTCCCCTCCCCACCCGCTCCTGG - Intergenic
900875230 1:5337836-5337858 CTTCCCTCTCCTACGACTGCTGG + Intergenic
900956011 1:5886893-5886915 CTCTCCTCCTCCCGGGCTGCAGG + Intronic
901011643 1:6205901-6205923 CTCTCCTCCCCGCGGGCTGGAGG + Intronic
901361400 1:8703586-8703608 CCTCCCTCCCCTCCGACAGCCGG + Intronic
901634406 1:10663892-10663914 CTCCGCTCCCCGTCAGCTGCGGG + Intronic
901641475 1:10695068-10695090 CTCCCCTGCCCGCTGCCTGCGGG + Intronic
901772938 1:11539935-11539957 CTTCCCTCCCCGCCGGCCTCTGG + Intergenic
901931805 1:12600712-12600734 TCTCCCTCCCCTCCAGCTGCGGG - Intronic
902097801 1:13960835-13960857 CTCCCCTCTCCTGGGGCTTCAGG + Intergenic
902394666 1:16126096-16126118 CTGCCTTCCCCCTCGGCTGCTGG - Intronic
902539333 1:17141759-17141781 CTCCCCTCTCCTCCAGCCCCAGG - Intergenic
902771387 1:18647187-18647209 CCCCCCTCCCCTCCGCTGGCCGG - Intronic
902778829 1:18691732-18691754 CCTCCCTCTCCTCCGGCTGTAGG + Exonic
902870785 1:19312435-19312457 CAGCCCTCTCCTCCGGCCGCTGG + Exonic
902940964 1:19799932-19799954 CTCCCCTCCCCGCCGCGTCCCGG + Intronic
902990129 1:20181670-20181692 CTCCATTCCTGTCCGGCTGCTGG - Intergenic
903070283 1:20723777-20723799 CTCCCATTCCCTGCGGCCGCAGG + Intronic
903994473 1:27297127-27297149 GTCCCCTACTCTCCGGCAGCCGG - Exonic
904261160 1:29288633-29288655 CTCTCCTCCCCTTCATCTGCAGG + Intronic
904477453 1:30774498-30774520 GTCCCTTCCCCTCTGACTGCTGG + Intergenic
904798114 1:33072727-33072749 CTCCCCTCCCCCACTGCTGAGGG - Intronic
904858728 1:33519452-33519474 CACCCCTGCTCACCGGCTGCTGG + Exonic
905449330 1:38046774-38046796 CGCCGCTCCGCTCCGTCTGCGGG + Exonic
905653643 1:39672307-39672329 CTCACCACCCAACCGGCTGCTGG - Intergenic
905878932 1:41451050-41451072 CTGGCCTCCCCTCCCTCTGCCGG + Intergenic
905896202 1:41547466-41547488 CTGCCATCCCCTCCACCTGCAGG - Intronic
905939839 1:41854255-41854277 CTCCCTTCCCCAGCGCCTGCTGG - Intronic
906120926 1:43389983-43390005 CGCCCCTCACCTCCGGCTCCGGG - Exonic
906416021 1:45621939-45621961 CTCTCCTCCCCTTCGGTTGTAGG + Exonic
906961615 1:50422647-50422669 CTCCCCTCCCCTCCGGGTTTAGG + Intronic
907088812 1:51705255-51705277 CTCCCATCTCCTGGGGCTGCAGG + Intronic
907384673 1:54118331-54118353 CTCCCTCCCCCTCCCCCTGCAGG + Intergenic
908979297 1:69934867-69934889 CTCTCCTCCCCTCCCTGTGCTGG + Intronic
910992147 1:93067489-93067511 CTCCCTTGCCCTCTGGCTTCTGG + Intergenic
911040620 1:93588344-93588366 CTCCACTCCACTCCTGCAGCCGG + Intronic
911546783 1:99226773-99226795 CTCCCCTCTCTCCTGGCTGCTGG + Intergenic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
912430596 1:109626532-109626554 CCCTCCGCCCCTCCAGCTGCTGG - Intronic
912716962 1:111989866-111989888 CTCCCTTCCCCCGCCGCTGCCGG + Intergenic
913485190 1:119327386-119327408 CACCCCGCCCCTCCTGCTCCCGG + Intergenic
914195351 1:145445598-145445620 ACCCCCACCCCTCCAGCTGCTGG + Intergenic
915446564 1:155977884-155977906 CTCCCGTCCCCTCCGCCGGATGG + Intronic
915724528 1:158008148-158008170 CTCCCCACCCCCCTCGCTGCCGG - Intronic
915991306 1:160519779-160519801 CTCCCCTCCCCCCCAGCCCCTGG - Intronic
916056707 1:161073284-161073306 CTACACTCTCCTCCGGCTGCAGG + Exonic
918377374 1:183922636-183922658 CTCCCCTACCCTCTGCCTCCTGG - Intronic
918487665 1:185045989-185046011 GTCCCCTCGCCTCCGGGGGCGGG + Intronic
920418509 1:205813873-205813895 CTCCCCTCCTCTCCGACCTCAGG - Intergenic
920498415 1:206471272-206471294 CTCCCCTCCCCTCCCTCCTCAGG - Intronic
921002207 1:211055659-211055681 CTCCCCTCTCCTCAAGCTGAGGG - Intronic
921023700 1:211259218-211259240 TTCCCCTCCCCCCAGGCGGCCGG + Intronic
921516181 1:216095478-216095500 CTTCCTTTCCCTCTGGCTGCAGG + Intronic
921866651 1:220094092-220094114 CTCCCCGCCCCTTCCGCTCCCGG + Exonic
922543052 1:226433580-226433602 CCCCCTTCTCCTCCGGCTTCTGG + Intergenic
922727258 1:227928244-227928266 CTGCCCTCCCCTCTGGCCCCAGG + Intronic
922765923 1:228156758-228156780 CTCCCCTGCCCACCCTCTGCTGG - Intronic
923181982 1:231528622-231528644 CTCCCCTCCCCTCCGGACGCAGG + Intergenic
923576227 1:235161307-235161329 GCCCCCTCCCCTCCGGCAGTCGG + Exonic
923617341 1:235548712-235548734 CTCCCCTCCCTTCCTACAGCAGG - Exonic
924179112 1:241423963-241423985 CTCCCCCACCCTCCTGCAGCAGG + Intergenic
924384800 1:243490795-243490817 CTCCCCTCCCCTCTGCTTTCAGG + Intronic
924469954 1:244334191-244334213 CTCCCCTTCCCTCCTTCTCCAGG + Intergenic
1063230693 10:4063241-4063263 CCCCCCTTCCCTCCCTCTGCAGG + Intergenic
1063407658 10:5812914-5812936 CTCCCCTCCGCTTCCGCTGGGGG + Intronic
1063535246 10:6876757-6876779 CCCTCCTTCCCCCCGGCTGCTGG - Intergenic
1064208480 10:13344981-13345003 AGCCCCTCCCCTCCCTCTGCGGG + Exonic
1064254554 10:13732802-13732824 CTCCCCTGCCCTCGGTGTGCAGG + Intronic
1064416422 10:15154125-15154147 CTCCCCTGCCCCCAGGATGCTGG + Intronic
1065244884 10:23746907-23746929 CTCTCCTTCCCTACAGCTGCTGG - Intronic
1065530768 10:26668006-26668028 CTCCTCTCCACTTAGGCTGCAGG - Intergenic
1066569378 10:36754350-36754372 CTCCCCTCCCCTCCCCTTCCCGG - Intergenic
1067269055 10:44773832-44773854 CTCCCCTCCTGCCCTGCTGCAGG + Intergenic
1067346301 10:45441331-45441353 CTCCCCTCCCCAGCTGCTGGTGG + Exonic
1068870235 10:61935549-61935571 CTCCACTCCCCACCAGCTCCTGG - Intronic
1069752590 10:70753823-70753845 CTTCCCACAGCTCCGGCTGCAGG - Exonic
1069844897 10:71364134-71364156 CTACCCTCTCCACCTGCTGCTGG - Intergenic
1070779529 10:79129560-79129582 CTTCCCTCCCCTCTGCCAGCAGG + Intronic
1070961888 10:80505250-80505272 CTCCCCTCTCCTCCTGAGGCTGG - Intronic
1071383292 10:85093391-85093413 CTCCCCTCCCCACCAGTTGCTGG + Intergenic
1071466187 10:85942031-85942053 TTCCCCTGCCCTCCGTCTTCAGG + Intronic
1071973604 10:90932698-90932720 TTCCCCCTCCCTCCGGCTCCTGG - Intergenic
1072226985 10:93379569-93379591 CAGCCCTCCCCTCAGGCTGGAGG + Intronic
1072578482 10:96720607-96720629 TTCCCCTCCCCAACGGCCGCGGG - Intergenic
1073242186 10:102066035-102066057 CTGCCCTGCCTTCGGGCTGCTGG + Exonic
1074104196 10:110376465-110376487 CTCCACTCCCCTCCTGCCTCCGG + Intergenic
1074464763 10:113671338-113671360 CAGCCCTCCCCTCTGGTTGCTGG - Intergenic
1074778852 10:116785882-116785904 CTCCCCTCACCTTAGACTGCAGG + Intergenic
1075080705 10:119381751-119381773 CTCCCCTCCCCGCCAGGTGCAGG + Intronic
1075311674 10:121419615-121419637 ATCCCCTTCCCTGCGGCTTCTGG + Intergenic
1075370179 10:121928505-121928527 CTCTCCACCCCTCCCGCCGCGGG - Intronic
1075436808 10:122450559-122450581 CTCCCCTCCTTTCAAGCTGCAGG + Intergenic
1075633787 10:124016967-124016989 TGCCCCTGCCCTCCTGCTGCGGG - Intronic
1075669735 10:124256251-124256273 CTGCCCTCACACCCGGCTGCTGG + Intergenic
1075768873 10:124917014-124917036 CTCCCCCGGCCTCCGGCAGCCGG + Intergenic
1076632374 10:131858753-131858775 CCCTCCTCCCGACCGGCTGCCGG - Intergenic
1076769562 10:132655665-132655687 CCCCCCACCCCTCCCACTGCAGG - Intronic
1076994347 11:290861-290883 CTCCCCTGGCCTGCAGCTGCAGG - Exonic
1077003012 11:334425-334447 CTCCCCTCCCCACAGGCTGAGGG + Intergenic
1077122746 11:917799-917821 CTCCCCACCCCTCCCCCAGCTGG + Intergenic
1077195898 11:1279834-1279856 CTCCCCTGCCCACCGGCGGCCGG - Intronic
1077414399 11:2418051-2418073 CTCCTCCCACCTCAGGCTGCTGG - Intronic
1078439266 11:11350740-11350762 CTCCCCACCCCACCATCTGCTGG + Intronic
1078532065 11:12144385-12144407 CTCCCCTCCTCTGGGGCTTCTGG + Intronic
1078542206 11:12221730-12221752 CACCCCTCCCCTGGAGCTGCTGG + Exonic
1079258203 11:18851729-18851751 CACCCCTCCCCTCCCACTGTGGG + Intergenic
1081596142 11:44460872-44460894 CTCCCCTGCCCTCAGGCTTCTGG - Intergenic
1081627978 11:44666732-44666754 CTCCCCACTCCACCAGCTGCAGG - Intergenic
1081720724 11:45286311-45286333 GTCCCCGCCCCTCTGGCGGCGGG - Exonic
1081871680 11:46385564-46385586 CGCCCCTCCCCTGCAGCCGCGGG - Exonic
1082658051 11:55874586-55874608 CCGCCCACCCCTCCGGCCGCCGG - Intergenic
1083292209 11:61696487-61696509 CTCCCCTCCCCTTCCCCTGTGGG + Intronic
1083613405 11:64015030-64015052 CTCCCCACCCCTCTGAATGCAGG - Intronic
1083822657 11:65181755-65181777 CTCCCCGCCCCTCCCTCCGCAGG - Exonic
1083970212 11:66070056-66070078 CTCCCCTCCCCGCCCACGGCCGG - Intergenic
1084273156 11:68039522-68039544 CTGCCCTCCCCTCCAGATGATGG - Intronic
1084469870 11:69353351-69353373 CTACCCTGCCCTCCAGATGCAGG + Intronic
1084532087 11:69733310-69733332 GTCCCATCCCCTGCGGGTGCAGG + Intergenic
1084641705 11:70430173-70430195 CTTCCCTCCTCTCCCTCTGCAGG - Intronic
1084794562 11:71496525-71496547 CTCCCCTCACCTCCTGCTCTGGG + Intronic
1086700613 11:89896925-89896947 GTCCACTCCCCTCCGCCTGGAGG - Intergenic
1086705556 11:89947601-89947623 GTCCACTCCCCTCCGCCTGGAGG + Intergenic
1088581548 11:111321254-111321276 CTACTCTCCCTTCCTGCTGCAGG - Intergenic
1088836107 11:113579061-113579083 CTCCCCTTCCCCACGGCTTCAGG + Intergenic
1089078556 11:115758679-115758701 CTCCACTCCCCTCGGCCTTCTGG - Intergenic
1089126967 11:116183327-116183349 CTGCCTTCCCCTCCTGCTCCAGG - Intergenic
1089439859 11:118506186-118506208 CTCCCCTCCACTCAGACTACGGG + Exonic
1089556697 11:119319201-119319223 CTTCTCTCCCCTGGGGCTGCCGG - Intronic
1089640634 11:119845140-119845162 CTTCTCTCCCCTCCTGCTGTGGG - Intergenic
1089739828 11:120574765-120574787 CTCCCCTCCCCACAGACTGATGG - Intronic
1090260306 11:125314559-125314581 GTCCCCTCCCCACTGACTGCAGG - Intronic
1091144408 11:133265121-133265143 CTCCACTCCTCTCTGGCAGCTGG - Intronic
1091405076 12:203875-203897 CTGCCCTCCCCGCCCTCTGCCGG - Intronic
1091461023 12:643330-643352 CTCCCCTCCCCACCCGGCGCGGG - Intronic
1091703651 12:2679746-2679768 GTCCCCTGCCATCCGGGTGCAGG + Exonic
1092193232 12:6534733-6534755 CTCCCCTCCCCTCCCCCACCAGG - Intronic
1092848090 12:12602747-12602769 ATCCTCTCACCTCAGGCTGCCGG - Intergenic
1092894488 12:12999823-12999845 CTCCTCTCACCACCGGCTGCAGG + Intronic
1094219296 12:27975293-27975315 CTCCCCTCCCCTCTCCCTCCAGG + Intergenic
1094375252 12:29783124-29783146 CTCCGCACCCCTTCGCCTGCCGG - Intronic
1094689155 12:32751635-32751657 CTCCCCTCCCCGCCGCCTCGTGG - Intronic
1095488071 12:42704973-42704995 CTCCCTTCCCCACTGGCTCCAGG + Intergenic
1095875819 12:47079564-47079586 CTTCCTTTCCCTCCGGCTCCCGG + Exonic
1096073630 12:48789105-48789127 GTCCCCTCCCCGCTGGCTCCCGG + Intergenic
1096116939 12:49060369-49060391 CTCCCTTCCCCTCTGGCCTCGGG + Intergenic
1096155088 12:49337160-49337182 CTCCCCTCCCTCCCGGGCGCGGG + Exonic
1096614031 12:52821667-52821689 CTTCCCTCCCATCCTACTGCAGG + Exonic
1096699136 12:53370967-53370989 CTCCCCTCCCCCGCCGCTGTAGG - Intergenic
1097282416 12:57852999-57853021 CTCCCTTCCCCGCCGCCTGCTGG + Intergenic
1097685029 12:62683263-62683285 CTTCCTTCCCCACCGGCTTCTGG - Intronic
1099932345 12:89088902-89088924 CTCCACTCCTCTCCGGATGGTGG + Intergenic
1099955702 12:89351423-89351445 ATCCACTCGCTTCCGGCTGCGGG - Intronic
1101631373 12:106498304-106498326 CCACCCTCACCTCGGGCTGCCGG - Intronic
1102625592 12:114233085-114233107 CTCCCTTGCCCTCTGGCTTCAGG + Intergenic
1102820974 12:115909074-115909096 CTCCCCTGCCCTCTCCCTGCGGG + Intergenic
1102884169 12:116508919-116508941 CCCCCCTCCCCACCCCCTGCAGG + Intergenic
1102915728 12:116750359-116750381 GCCCCCACCCCACCGGCTGCAGG - Intronic
1103565026 12:121811247-121811269 CTCTCCTCCCCTCTGCCTGAGGG - Intronic
1103698361 12:122835098-122835120 CTACCCTCCCCTCCGGGTTTAGG + Intronic
1103843661 12:123886353-123886375 CTCCCCTCCCCAGCAGCTCCTGG - Intronic
1103969402 12:124660658-124660680 CTCCCCGCCCCTCCTGCCACTGG + Intergenic
1104077513 12:125403268-125403290 CCCTCCTCCCCTCTGGCTGGTGG + Intronic
1104419182 12:128621148-128621170 CTCCCTTGCCCTCTGGCTTCTGG + Intronic
1104642348 12:130475549-130475571 TGCCCCTCCCCACCGTCTGCGGG - Intronic
1104724680 12:131068407-131068429 CTCCCCGCCCCTCTGTCTGGTGG - Intronic
1104802636 12:131565176-131565198 CTCCCCGCCCCTCTGTCTGGTGG + Intergenic
1104815587 12:131643799-131643821 CTTCCCTCCCCACCATCTGCAGG - Intergenic
1104889434 12:132133167-132133189 CCCCCCTCCCCCCCGCCTGACGG + Intergenic
1104969980 12:132526852-132526874 TTCCCCACCCCTCCTGCTGGGGG + Intronic
1105700982 13:22935567-22935589 CTGCCCCCCTCTCTGGCTGCAGG - Intergenic
1105756193 13:23466496-23466518 CGCCCCTCCCGCTCGGCTGCAGG - Intergenic
1105826454 13:24127437-24127459 CTCCCCTACCCTCTGGCCTCTGG - Intronic
1106371307 13:29136493-29136515 CTCCCCTGCCCAGAGGCTGCAGG - Intronic
1107508840 13:41061450-41061472 CTCCTCTCCCCTCCCCCTACAGG - Exonic
1107662338 13:42651533-42651555 CTCCCTTCCCCTCCTTCTGCAGG + Intergenic
1109378545 13:61526729-61526751 CTCCCCGCCCCTCCACCTTCCGG - Intergenic
1110626798 13:77662167-77662189 CTGCCCTCACCTCCGTCTTCGGG + Intergenic
1111815753 13:93150358-93150380 CTCCCCACCCCTCCCTCTCCTGG - Intergenic
1112891036 13:104231813-104231835 CTCCCCTCCCCTCCCCCAACAGG + Intergenic
1113493803 13:110713069-110713091 CTCCCCTTCCTTCCGCCTCCCGG + Intronic
1113651630 13:112037355-112037377 CTCCCCTTCCCTGCTGCTGAGGG + Intergenic
1114451624 14:22830198-22830220 CTGCCAACCCCTCCGGCTACGGG + Exonic
1114495125 14:23126916-23126938 CTCCCCTCTCCTCCAGCAGCTGG + Exonic
1118366607 14:65102131-65102153 GTTCGCTCCCCTCCGGCTCCTGG - Intronic
1118875923 14:69784865-69784887 CTCCCCTTCCCGCCTGCTGGAGG - Intronic
1119121570 14:72084127-72084149 CTCCCCTCCCCTCAAGATCCAGG - Intronic
1119432241 14:74575932-74575954 CTCCCCTTCCCTGGGGCTGTGGG - Intronic
1119573379 14:75695905-75695927 CTCCCCTCCCCTCCCTCCCCAGG + Intronic
1119616878 14:76104668-76104690 GTCCCCTCCCCTCCACCTGGGGG - Intergenic
1119753676 14:77098653-77098675 CTCCCCGCCCAGCCGGCTGGCGG - Intronic
1120143605 14:80955569-80955591 CTTCCCACCCCTCCCGCTCCCGG + Exonic
1121061576 14:90914810-90914832 TTGCCATCCCCTCCTGCTGCTGG + Intronic
1121303802 14:92892246-92892268 CTTCCTTCCCCTGGGGCTGCAGG - Intergenic
1121330495 14:93046580-93046602 CCCCCCCCGCCCCCGGCTGCTGG - Intronic
1121453336 14:94023233-94023255 TTCCCCACCCCACCAGCTGCGGG - Intergenic
1121555862 14:94836535-94836557 CTCCCCTCCAGTCTGGCTTCAGG + Intergenic
1121649630 14:95548287-95548309 CTGCCGTCCCCTAGGGCTGCTGG - Intergenic
1122016826 14:98803497-98803519 CTGCCCACCCCTCCTGCTGCAGG + Intergenic
1122397216 14:101441982-101442004 CACCCCTCCTCTCGGGCTCCTGG + Intergenic
1122487921 14:102094213-102094235 TTCCCCTCCCCTCCCACTGTTGG + Intronic
1122647949 14:103207424-103207446 CTCCCCTCCCCGCCGCGTCCCGG + Intergenic
1122658541 14:103279158-103279180 CTCCCCTCCCCGCCGCGTCCCGG + Intergenic
1122690240 14:103528815-103528837 CCCCCCGCCCCGCCGGCCGCGGG - Intergenic
1122795990 14:104206486-104206508 CTCCCTCCCTCTCAGGCTGCGGG - Intergenic
1122903574 14:104792005-104792027 CTCCCATCCCACCCAGCTGCTGG + Intronic
1122939248 14:104973879-104973901 CTCCCCTCCCCTCCGGCTGCGGG - Intronic
1122957301 14:105076685-105076707 CTCCCCTGCCCTCCGTCTCCTGG - Intergenic
1122996730 14:105269157-105269179 CTGCCCTCCCTTCAGGTTGCGGG - Intronic
1124369232 15:29094009-29094031 CTCCCCTTCCTGCCGGCTGATGG + Intronic
1124484684 15:30103883-30103905 TTCCCCTCACCTCCGGCGGGAGG - Intergenic
1124518897 15:30393355-30393377 TTCCCCTCACCTCCGGCGGGAGG + Exonic
1124539759 15:30572891-30572913 TTCCCCTCACCTCCGGCGGGAGG - Intergenic
1124758893 15:32434691-32434713 TTCCCCTCACCTCCGGCGGGAGG + Intergenic
1125181838 15:36887521-36887543 CTCCCCTCGCCCCCCGCCGCTGG - Intergenic
1125584067 15:40807875-40807897 CTTCCCTCCCCGAGGGCTGCAGG + Intronic
1125832631 15:42727685-42727707 CTCCGCTCCCCCCGGGCAGCAGG + Exonic
1126035054 15:44537557-44537579 CTCTCTTCCCCTCCGCTTGCCGG + Intronic
1126436245 15:48641319-48641341 CTCTCCTCCCCCCCTGTTGCAGG - Intronic
1127071351 15:55290322-55290344 CTTCCCGCCCCTGCGGCTCCTGG + Intronic
1127262976 15:57339202-57339224 CTCCCTTCCCCTCCTGATTCTGG - Intergenic
1128545737 15:68566505-68566527 CTCCCCTTCCCTCCAGCCTCGGG + Intergenic
1129217263 15:74107480-74107502 GTCCCCTGCCCTCTGGCTGGGGG - Intronic
1129317341 15:74753056-74753078 CTCCCCTCCCCTCCCAGTGTAGG + Intronic
1129678483 15:77644905-77644927 CTCTCCGCCTCTCGGGCTGCTGG - Intronic
1130322545 15:82853125-82853147 CTCCCAGCCCCTGCTGCTGCTGG + Intronic
1130348142 15:83067361-83067383 CGCCCCTGCCCTGGGGCTGCCGG - Intergenic
1130422732 15:83764442-83764464 CTCCCTTGCCCTCTGGCTTCTGG + Intronic
1130570600 15:85039921-85039943 CTCCCCTACCCTCCAGCCTCTGG - Intronic
1131229733 15:90651293-90651315 CTTCCCTCCCCTCCTACTGTGGG + Intergenic
1131238425 15:90717256-90717278 TTCCCGCCCCCTCAGGCTGCTGG - Intergenic
1131318702 15:91366053-91366075 CTCCTCTCCCCTCCCACTGTGGG - Intergenic
1131393048 15:92064852-92064874 CCTCCCTACCCTCCAGCTGCTGG - Intronic
1132105424 15:99059365-99059387 CTCCCCGCGCCTGGGGCTGCAGG - Intergenic
1132520614 16:386111-386133 CTCCCCTCCGGCCAGGCTGCAGG - Intronic
1132591425 16:727949-727971 CTCCCGTCCCTTTCAGCTGCTGG + Exonic
1132773877 16:1581113-1581135 CACCCCTCCCATCTGGCAGCTGG + Intronic
1132855530 16:2042983-2043005 CTCCCCACCCCACCTGCTGAGGG + Intronic
1133002342 16:2857678-2857700 CTCCCCTGACCTCCTGCGGCAGG + Intronic
1133052629 16:3125802-3125824 CTCCCCTCCCCTCCACATGGGGG - Intergenic
1133234522 16:4381735-4381757 CTTCCCCCGCCTGCGGCTGCTGG + Exonic
1133237213 16:4392868-4392890 CTCCCACCCCTTCCAGCTGCTGG - Intronic
1133262198 16:4558186-4558208 CTCCCTTGCCCACCAGCTGCTGG - Intronic
1133305387 16:4805047-4805069 GTCCCCTCCCCACCGGCCTCAGG + Exonic
1133507778 16:6429311-6429333 CTCCCCACCACTGCTGCTGCAGG + Intronic
1133921638 16:10158747-10158769 TTCCCCACCCCTCCAGCTCCTGG - Intronic
1134492218 16:14703631-14703653 CTCTCCCCACCTCTGGCTGCGGG - Intergenic
1134497599 16:14742753-14742775 CTCTCCCCACCTCTGGCTGCGGG - Intronic
1136152987 16:28364547-28364569 TTCCCCGCCCCGCCGGCTGCTGG + Intergenic
1136183836 16:28573303-28573325 CTCCCTTCTCCTCTGGCTTCAGG - Intronic
1136210096 16:28750726-28750748 TTCCCCGCCCCGCCGGCTGCTGG - Intergenic
1136533929 16:30888074-30888096 CTCCCCTCCCCTCCTGGGCCCGG + Intronic
1136621161 16:31429264-31429286 TTCCCATCCCCTCCTGCAGCTGG - Intergenic
1138085454 16:54129603-54129625 CTCCCCTTCCCTCCAGCCGAGGG + Intergenic
1138506158 16:57479330-57479352 CGCGGCTGCCCTCCGGCTGCCGG - Intronic
1138586364 16:57972844-57972866 CATCCCTCCCGTCAGGCTGCAGG - Intergenic
1139504791 16:67393468-67393490 CTCCGCTCCCTGCCGGCTCCCGG + Intronic
1139701686 16:68711618-68711640 TTCCCTTCCTCTCCAGCTGCTGG - Intronic
1140533213 16:75684518-75684540 CTCCCCTCTCCTCTAACTGCTGG - Intronic
1141131181 16:81438064-81438086 CTCTCCTCCCTTCCCACTGCTGG + Intergenic
1141771971 16:86094894-86094916 ATCACCTTCCCTCTGGCTGCTGG + Intergenic
1142009349 16:87706033-87706055 CCCTCCTCCCCTCAGGCTGCAGG - Intronic
1142161375 16:88559322-88559344 CTCCCCTCCCCCCAGCCTGCAGG - Intergenic
1142358903 16:89617015-89617037 CTCCCTTCCCCTTCTGCTCCAGG - Intronic
1142497269 17:312872-312894 CTTCCCTCCTCCCTGGCTGCAGG - Intronic
1142509442 17:385115-385137 TCCCCCTGCCCTCAGGCTGCCGG + Intronic
1142669740 17:1482672-1482694 CTCCCCTCCCCTCCCGCACTGGG + Intronic
1142669754 17:1482709-1482731 CTCCCCTCCCCTCCTGCACTGGG + Intronic
1142676588 17:1517072-1517094 CTCCCCCGCCCCCCGGCTGCAGG + Intergenic
1142752310 17:1996385-1996407 CTCCCCTCCCCCCCGGCCCAAGG + Intronic
1142809470 17:2388526-2388548 CTCGCCTCCCTCCTGGCTGCTGG + Intronic
1142850827 17:2704000-2704022 CTACCCTCCCCTCTGGCAGATGG + Intronic
1143119254 17:4596984-4597006 CCCGGCTCCCCTCCGGCTGCTGG + Intronic
1143483481 17:7239719-7239741 CCGCTCTCCCCTCCGGCTCCTGG - Intronic
1144299061 17:13906132-13906154 TTCCCCTGGCCTCCTGCTGCTGG + Intergenic
1144948483 17:18981770-18981792 CCCCCCACCCCGCAGGCTGCAGG + Intronic
1145224902 17:21119953-21119975 CCCCCCGTCCCTCCCGCTGCTGG - Intergenic
1145839744 17:27984632-27984654 CCCCCCCCCCCCCCGGCTGCCGG + Intergenic
1146052950 17:29567241-29567263 CCCCACTCCCTTCCGGCTGCCGG - Intronic
1146275834 17:31515013-31515035 CTGCCCTGCCCTCTGGCTGGAGG + Intronic
1146403624 17:32519325-32519347 CTGCGCTCCGCTCCCGCTGCAGG - Intronic
1146678720 17:34791884-34791906 CTGCCCTCCCCATGGGCTGCAGG + Intergenic
1148156851 17:45429628-45429650 CTGCGCTCTCCTCCGGCGGCGGG + Intronic
1148388518 17:47253775-47253797 CTCCCCTCCCCTCCCGCTGCGGG + Intergenic
1148504941 17:48119919-48119941 CTTCCCTCCCCCCCAGCTCCTGG + Intronic
1148978287 17:51548541-51548563 CTCTCCTGCCCTGGGGCTGCAGG - Intergenic
1150293931 17:63998135-63998157 CTCCCCTCCCCTCCCCTTGCTGG - Intergenic
1151343018 17:73484092-73484114 CTCCCCGCTCCTCCGGCTCGGGG + Intronic
1151429303 17:74051677-74051699 CTGCCCTCCCCACAGGCTGAGGG + Intergenic
1151761012 17:76103329-76103351 CTGCCCTCTCCCCCAGCTGCGGG + Intronic
1151896706 17:76985679-76985701 CTCCCCCTCCCTCCAGCTCCTGG - Intergenic
1151943077 17:77304970-77304992 CTCCTCTCCCCTCCTGGTCCTGG + Intronic
1151987839 17:77555639-77555661 CACCCCTCCCTCTCGGCTGCAGG - Intergenic
1152071842 17:78137990-78138012 CTCCCATCCCTGCAGGCTGCTGG + Exonic
1152276538 17:79361260-79361282 CTTCCCTCTCCCCAGGCTGCTGG + Intronic
1152288254 17:79424648-79424670 CTCCTCTCCCCTCTGGCCTCAGG + Intronic
1152293194 17:79452515-79452537 GTCCCCTGCCCTCTGGCTTCTGG + Intronic
1152356487 17:79810104-79810126 GCCCCCTCCCCGCCGGCTCCCGG + Intergenic
1152722433 17:81929534-81929556 CTCACCTCCCCAGCGGCTCCTGG + Intergenic
1152780878 17:82227031-82227053 CTCCCCTCCCCTCTGAGGGCAGG + Intergenic
1153070412 18:1098504-1098526 CTCCCCCCGCCCCCGGCTGTAGG + Intergenic
1153457217 18:5295266-5295288 CTCCCCCGCCCTCCCGCGGCCGG + Intronic
1153514245 18:5890524-5890546 CTCGCCACCCCTGCGGCTGGAGG - Exonic
1153676430 18:7459931-7459953 CTCCCCTCCCATCTGTGTGCTGG + Intergenic
1153981539 18:10314813-10314835 CTCCCCTCCCCTACTGCCCCAGG + Intergenic
1155218307 18:23662564-23662586 TTCCTCTCTCCTCCAGCTGCGGG - Intronic
1155877198 18:31101942-31101964 CAGCCCGCCCCTCCGGCTCCTGG - Exonic
1156457351 18:37302250-37302272 CTCCTATCCTCTCCTGCTGCTGG + Intronic
1157161123 18:45315380-45315402 CTCCCCCACCCTCCTTCTGCTGG - Intronic
1157483339 18:48069907-48069929 CTTCCCTCTCCTCCCGCTCCAGG - Intronic
1157488663 18:48107358-48107380 CTCCTCTCCCCTCCTCCTTCTGG - Intronic
1159889892 18:73943468-73943490 CTGCCTTCCCCTCTGGCTCCGGG - Intergenic
1160679687 19:407024-407046 CTCTCCTCCACACCGGGTGCTGG - Exonic
1160697975 19:493748-493770 CTCCCCGGCCCTCAGGCTGCTGG + Intronic
1160847626 19:1173490-1173512 CTCCCCGCCCCTCCCGCTCCTGG - Intronic
1160968113 19:1755448-1755470 TCCCTCTCCCCTCCGGCCGCTGG + Intronic
1160993986 19:1873431-1873453 CTGCCCTCCCCCCGGGCTCCGGG + Intergenic
1161139427 19:2638730-2638752 CTCCCCTCCCCAGGGGATGCTGG - Intronic
1161143429 19:2662796-2662818 CTCCCCTCCCCAGAGGCTGGAGG + Intronic
1161210195 19:3061981-3062003 CCCCCCTCCCCTCCTGCCGCCGG - Intronic
1161408391 19:4102889-4102911 CTCCCCTTCCCTTCGTGTGCTGG - Intronic
1162027789 19:7904180-7904202 CTCTCCGCCCCCCCCGCTGCGGG + Intronic
1162195328 19:8980201-8980223 CTCACCTCCCCTCTGTCTCCTGG - Exonic
1162218021 19:9152392-9152414 CTCCGCTCACCTCCTGCGGCAGG - Intronic
1162393662 19:10404264-10404286 CTCCCCACCCCGCTGGCCGCTGG + Intronic
1162481418 19:10928999-10929021 CTCCTCTCCCCTCAGGGTCCTGG + Exonic
1162536787 19:11267311-11267333 CTCCCGTCCCCTCCAGCCCCTGG + Intergenic
1162788979 19:13053468-13053490 CTTCCCTCCCTTCCGCCTGGAGG + Intronic
1162893073 19:13747962-13747984 CTCCCCGCTCCTCCGCCCGCCGG - Intronic
1162936306 19:13983386-13983408 CTCCCCTCCCCGCTTCCTGCTGG - Intronic
1162965302 19:14152720-14152742 CTCCCCACCTCTCAGGCTCCAGG + Intronic
1162971517 19:14183745-14183767 CTCCCCTCTCCTCCTGCTGGTGG + Intronic
1163023198 19:14494929-14494951 CCCCCTTCCCCTCCTCCTGCTGG - Intronic
1165467852 19:35985751-35985773 CTCCCCTTGCCCCCCGCTGCTGG + Intergenic
1166154387 19:40899952-40899974 CTGCCCTCCCCTGTGCCTGCAGG + Intergenic
1166301946 19:41915933-41915955 CCCCCCTCCCCCCCGCCGGCCGG + Intronic
1166361091 19:42253407-42253429 TTCCCCTCCCCTCCCCCAGCCGG + Intronic
1166856741 19:45786056-45786078 CTCGCCACCCCTCGAGCTGCTGG + Exonic
1166917685 19:46206799-46206821 CTCCCCTCTCCTGAAGCTGCAGG - Intergenic
1166919977 19:46222611-46222633 CTCCCCTGTCCTGCAGCTGCAGG - Intergenic
1167294214 19:48639909-48639931 CTCTCCTCCCCTTCTGCTGGGGG - Intronic
1167503217 19:49858664-49858686 GGCCCCTCCCCTGCGTCTGCTGG - Intronic
1167572965 19:50301639-50301661 CTTCCTTCCCCTCCTGCTACAGG + Exonic
1167703496 19:51065072-51065094 CTGCCCTCCCCTCCCGATCCCGG - Exonic
1168266983 19:55228616-55228638 CTCCCAGACCCGCCGGCTGCTGG + Intronic
1168285668 19:55331339-55331361 CTCAGCTCCTCTCCGGCTGCTGG + Intronic
1168353303 19:55688328-55688350 CTCCCTTCCCCTCCTGCTCTTGG + Intronic
1168356555 19:55703866-55703888 CTCCCCTGCGTTTCGGCTGCTGG + Intronic
925402761 2:3587320-3587342 CTCCCCACCCCTCGGGCTCAGGG - Intergenic
925998552 2:9311750-9311772 CTGCCCGCCACTCAGGCTGCAGG + Intronic
926094628 2:10073212-10073234 CCCCCCCCCCCCCCGGCTGTGGG + Intronic
926216450 2:10908539-10908561 CTCCCCTGGCTTCTGGCTGCAGG + Intergenic
927168729 2:20350838-20350860 CTCCCCTCCCCCCCGCCCACCGG + Intronic
927181022 2:20446930-20446952 CTGCCCCGCCCTCGGGCTGCAGG + Intergenic
927255070 2:21034066-21034088 CTCCCCTCCCCACAAGCTGCTGG - Intronic
927474515 2:23402148-23402170 CTCCCATCCCCTCCTCCTGCCGG - Intronic
927799711 2:26086954-26086976 CTCCCCTCCCCTCCAGTCCCTGG - Intronic
927972999 2:27317303-27317325 ATCCACTCCCCTCCCGCTGCTGG - Intronic
928694600 2:33836574-33836596 TTTTCCTCCCCTCCAGCTGCTGG + Intergenic
929180432 2:39032282-39032304 CTCCCCTACCCTCCAGCCTCTGG + Intronic
929441892 2:41971273-41971295 CTCCCCTCACCTTCCCCTGCCGG - Intergenic
929452833 2:42048175-42048197 CTCCCCTCCCCCCGGCCGGCCGG - Exonic
929531280 2:42754611-42754633 CTCCCCTGCCCTCTGTTTGCAGG + Exonic
929822704 2:45286179-45286201 CTCCCCTCCCAGCCTGCTGCAGG - Intergenic
929968234 2:46551406-46551428 CTCCACACCCCTCTGCCTGCTGG - Intronic
930124048 2:47782901-47782923 CTCCCCTTCCCTCACGCCGCGGG - Intronic
931348795 2:61470744-61470766 CTCCCCTCCCCCCCGCCGGTCGG - Exonic
931443006 2:62304561-62304583 CTCTCCTCACCTCAGGCTGGAGG - Intergenic
931874391 2:66496234-66496256 CTCCCCTCCCCTCGGGCGTGGGG + Intronic
932245154 2:70190686-70190708 CTCACCTCCCGGCCGGCTTCCGG + Intronic
932313849 2:70767187-70767209 CTCCCCTCCCTTTCTGCAGCCGG - Intronic
932496407 2:72147864-72147886 CTCCCCTCCCCCGCCGCGGCCGG - Exonic
932703266 2:74004815-74004837 CTCCCCTCGCCTCCCGCTGCTGG + Intronic
932770191 2:74496850-74496872 CTCCTCTCCCCTCACACTGCAGG + Intergenic
933666791 2:84971073-84971095 CGCCCCTCTCCCCCGGCTCCCGG - Exonic
933709619 2:85315779-85315801 CTACCTTCCCCTCCAGCTGTGGG - Intergenic
933713445 2:85343995-85344017 CTACCTTCCCCTCCAGCTGTGGG + Exonic
934887481 2:98037731-98037753 CTGCCCTCCACTCCTGCTGGGGG - Intergenic
935574208 2:104692110-104692132 CTCCTCTCCCCTCCAGCTCCTGG - Intergenic
936286829 2:111187564-111187586 CTCCCCTCCCCTCAGAGGGCCGG - Intergenic
936952646 2:117993547-117993569 TTCCCCTTCTCTCCTGCTGCTGG + Intronic
937236875 2:120436543-120436565 CGCCCCTCCCCTGCAGCAGCTGG + Intergenic
937246874 2:120499315-120499337 CTCAACTCCCCCTCGGCTGCGGG + Intergenic
937972139 2:127559107-127559129 CTCCCCGCTCCTCCTCCTGCTGG + Intronic
939215840 2:139237172-139237194 CTTCCTTCCCCTCTGGCTTCTGG - Intergenic
939961393 2:148568988-148569010 CTCCCCTCCACTCCCTCTGGGGG - Intergenic
942653976 2:178195244-178195266 CACCCCTGCCCACCCGCTGCTGG + Intronic
942905267 2:181173366-181173388 CTCCCCTCCCCTCTGCATCCTGG + Intergenic
944206701 2:197164589-197164611 GCCCCCTCCCCTGCTGCTGCGGG + Intronic
944309134 2:198213569-198213591 CTCCAATCCCTTCTGGCTGCTGG + Intronic
944432378 2:199647096-199647118 CTCCCTTGCCCTCTGGCTTCTGG + Intergenic
944668322 2:201974775-201974797 CTCCCATCCCCTGTGGCTGGCGG + Intergenic
945134907 2:206616650-206616672 CTCCCCTGCCCACCGACTGAGGG - Intronic
945305276 2:208254311-208254333 CTCCCCTCCCCTCCCCTCGCTGG + Exonic
946321344 2:218956172-218956194 CTCCCCTCCCCTTCATCTCCTGG + Intergenic
946921322 2:224584820-224584842 CTCCCCTCCCCCACGCCCGCCGG - Intronic
948051473 2:234982461-234982483 CTCCTGTGCCCTCCAGCTGCTGG - Intronic
948501464 2:238397794-238397816 CTCACCTCTGCTCCTGCTGCAGG - Intronic
948501478 2:238397838-238397860 CTCACCTCTGCTCCTGCTGCAGG - Intronic
948501520 2:238397970-238397992 CTCACCTCTGCTCCTGCTGCAGG - Intronic
948501534 2:238398014-238398036 CTCACCTCTGCTCCTGCTGCAGG - Intronic
948501548 2:238398058-238398080 CTCACCTCTGCTCCTGCTGCAGG - Intronic
948501562 2:238398102-238398124 CTCACCTCTGCTCCTGCTGCAGG - Intronic
948976817 2:241468535-241468557 TTCCCGTCTCCTCTGGCTGCTGG + Intronic
949051032 2:241897400-241897422 CTCCTCTGCCATCCGGGTGCTGG - Intronic
1168965125 20:1894336-1894358 CTCCCCTCGCCTCCGGACTCCGG - Exonic
1171217353 20:23362099-23362121 GGCCCCTCCCCTCCCGCGGCCGG - Intergenic
1172662062 20:36574489-36574511 TTCCCCTCCCCTCCCCCTCCGGG + Intronic
1172977033 20:38913855-38913877 CTCCCCTCCCCACAGGATCCTGG - Intronic
1173249613 20:41357657-41357679 AGGGCCTCCCCTCCGGCTGCAGG - Intronic
1173557284 20:43974821-43974843 GCCCCCTCCCCTGCCGCTGCAGG + Intronic
1173561739 20:44010970-44010992 CTCGCTTCTCCTCCGGCTCCTGG + Intronic
1173803522 20:45909911-45909933 CTCCACTCCCCTGAGGGTGCTGG + Intronic
1174870333 20:54175093-54175115 CTCCCCTCCTCCCTGGCTGGTGG - Intergenic
1175179132 20:57132644-57132666 CTCCCCTCCCCAGCTGGTGCGGG + Intergenic
1175232243 20:57481348-57481370 CTCCCCTCCCCTGGGTCTGGAGG - Intergenic
1175247559 20:57590997-57591019 GTCCCCTCCACTCCAGCTGGTGG - Intergenic
1175252748 20:57619314-57619336 GTGACCTCCCCTCCGGCTTCAGG + Intronic
1175380173 20:58557392-58557414 CTCCTCTTCCCTCCAGCTCCTGG - Intergenic
1175384774 20:58587183-58587205 CACCTCTCCCCTCGGGCTGTAGG + Intergenic
1175428872 20:58889233-58889255 CTCCCCTGCTCTCTGGCTCCGGG + Intronic
1175551827 20:59822417-59822439 CTCCCCTCCCCCACGCCTGCTGG - Intronic
1175782450 20:61691107-61691129 CTCCCCACCCCTCGGCCAGCAGG + Intronic
1175902749 20:62366582-62366604 GCCCCCTCCCCACCGGCAGCAGG + Intronic
1175946657 20:62562165-62562187 CTCCCCTACCCGGAGGCTGCTGG + Intronic
1176056342 20:63151117-63151139 CCCCCCACCCCTAAGGCTGCAGG - Intergenic
1176088013 20:63306867-63306889 CTGTCCTCCCCTCAGGGTGCTGG + Intronic
1176108960 20:63402551-63402573 CTCCCCTTCTCTCCGGCAGCAGG + Intergenic
1176244968 20:64093128-64093150 CTCCCCTCCCCTCCCTGTGGAGG - Intronic
1176377131 21:6092262-6092284 GGCCCCTCCACTCCGGCTCCTGG - Intergenic
1176385866 21:6138314-6138336 CTCTCCTCCCCTCCGGGGTCAGG + Intergenic
1178414565 21:32393247-32393269 CACCCCCCGCCCCCGGCTGCAGG + Exonic
1179737607 21:43399938-43399960 CTCTCCTCCCCTCCGGGGTCAGG - Intergenic
1179746344 21:43445982-43446004 GGCCCCTCCACTCCGGCTCCTGG + Intergenic
1179995923 21:44973942-44973964 CGCCCCTCCCCTCCGCTGGCTGG + Intronic
1180193911 21:46182419-46182441 CTCCCCTCCCCTTCGGTCGCTGG - Intronic
1180701199 22:17782239-17782261 CTCCACTCCCTTCCCTCTGCTGG - Intergenic
1180907949 22:19428896-19428918 CTACCCACCCCTCAGGCTTCCGG + Intronic
1181100376 22:20534924-20534946 CTCGCCTCCCTTCAGGCTTCAGG + Intronic
1181468277 22:23122445-23122467 CTCCCCTGCCCTCCAGCTGTGGG - Intronic
1181508426 22:23377503-23377525 CTCTCCTCCCCTCCCTCTGAAGG - Intergenic
1181535556 22:23541096-23541118 CTACCCTCCCTTCTGGCAGCGGG - Intergenic
1181560428 22:23696738-23696760 CTCCCTTCCCCGCCAGCTGGAGG + Intronic
1182469951 22:30542382-30542404 CTCCCCTCGCCTCCGGACTCCGG - Intronic
1182572329 22:31248602-31248624 CTCCCGGCACCTCTGGCTGCAGG - Exonic
1183149753 22:36028435-36028457 CCCCCCTCGCCTCCGGGAGCCGG + Intergenic
1183335431 22:37243525-37243547 CTCCCCTCCCCTCAGCCTACCGG - Intronic
1183663675 22:39235410-39235432 CTCCCCGCCCCTCTGGCTAGGGG - Intronic
1184776305 22:46625221-46625243 CTCCCCTCCCCTCACCATGCTGG + Intronic
1184864750 22:47195884-47195906 CTGCCCTCCCCCTGGGCTGCAGG + Intergenic
949105411 3:196865-196887 CGCCCGTCCCCTCCCGCCGCTGG - Exonic
950316405 3:12004969-12004991 CTCTCCTGGCCTGCGGCTGCCGG - Intronic
950465937 3:13153665-13153687 GTCCCCACCCCTCCTGCAGCAGG + Intergenic
950555915 3:13695994-13696016 CTCGCCTCCCCTCAGACAGCTGG + Intergenic
950729929 3:14948074-14948096 CTCCCCTCCCCGCCCGCGGCCGG + Intronic
951488305 3:23239436-23239458 CCCCCCTCCCCCCCAGCTTCTGG + Intronic
951958841 3:28291771-28291793 CTCCCCCTCCCTCAGGCTTCAGG - Intronic
953236277 3:41110369-41110391 CTCCCCTAGCCTAGGGCTGCTGG + Intergenic
954410351 3:50367902-50367924 CACCCCTCCCCTCCTGTTCCAGG - Exonic
954486112 3:50853184-50853206 CTCCCTTCCCTTCCAGCTTCTGG + Intronic
954642383 3:52108853-52108875 CTTCCCTTCCCTCCCCCTGCAGG + Intronic
956412772 3:68995559-68995581 CTCCCCTTCTCTGTGGCTGCTGG - Intronic
957543639 3:81608666-81608688 TTCCTCTCCCCTTTGGCTGCTGG + Intronic
959070237 3:101695082-101695104 CTACCCTCCCTTCTGGCAGCGGG - Intergenic
959860263 3:111208036-111208058 CTCCTCTACCCTCCTGCTGTAGG + Intronic
960691273 3:120349024-120349046 CTTCCCGCACCTCCAGCTGCTGG - Exonic
961356503 3:126343166-126343188 CCCCCCCCCCCCCCGGCTCCAGG + Exonic
961404236 3:126667395-126667417 CTCCCTGCCCCTCGGGGTGCTGG - Intergenic
961781131 3:129320541-129320563 CTCCCATCCGCTGCTGCTGCAGG - Intergenic
961869270 3:129976086-129976108 CTCCCCTCCCCTTTGCCGGCAGG - Intronic
962244791 3:133783828-133783850 CTCCCCGACCTGCCGGCTGCAGG + Intergenic
962352130 3:134663925-134663947 CTACCCTCCCTTCTGGCTGTAGG - Intronic
962588207 3:136862784-136862806 CTCCCCTCCTCTCGGGCTGGAGG - Intronic
963063123 3:141241082-141241104 CTCTCCTCCCCTCCAGATGTGGG - Intronic
963120179 3:141769672-141769694 CTCCCTTGCCCTCTGGCTTCTGG + Intergenic
964089878 3:152862817-152862839 CTCCACCTCCCTCAGGCTGCAGG - Intergenic
964616588 3:158672783-158672805 CTCCCCACACCTCCACCTGCTGG - Intronic
964766257 3:160180967-160180989 CTCCCTTCCCATCCGGCCTCAGG + Intergenic
964808983 3:160642076-160642098 CTCTCCTCCCATCCAGCAGCAGG + Intergenic
966593196 3:181703823-181703845 CTCCCTACCCCACGGGCTGCGGG - Intergenic
966928413 3:184660232-184660254 CTCCGCTGCCCTCCTGCTGCAGG + Intronic
966970367 3:185040017-185040039 CTTCCCTCCCCTCCCTCTCCTGG - Intronic
967880349 3:194297239-194297261 GTCCCCTCCCCTCCAGCCCCGGG + Intergenic
968285184 3:197504507-197504529 GTCCCCATCCCTCCGTCTGCAGG + Intergenic
968377143 4:53276-53298 AACCCCTCCTCTCTGGCTGCGGG - Exonic
968472456 4:788306-788328 CTCCCCTCCCCTAGGGCTGCAGG + Intronic
968519375 4:1028785-1028807 TTCCCCTCCCCTCCACGTGCAGG + Intergenic
968863226 4:3189608-3189630 CTCCCCTCCCCTGCAGCCCCTGG - Intronic
968893634 4:3385775-3385797 CTCCCCAACCCTCCTGCTGGTGG + Intronic
968909303 4:3469468-3469490 CTCACCCACCCTCCGGCTGGGGG - Intronic
969052020 4:4379921-4379943 ACCCCCTCCCCTCCTCCTGCTGG - Intronic
969113794 4:4859488-4859510 CTCCCCTGCCCTCCGCCGCCTGG + Intergenic
969370248 4:6727327-6727349 CTCCCCACGCCCCCGGCTCCCGG - Intergenic
969449450 4:7264764-7264786 CCCCACTCCCTTCCAGCTGCAGG + Intronic
971207372 4:24583952-24583974 CCACCCTCTCCTCCGGCTCCAGG + Intronic
972765910 4:42152175-42152197 GTCCCCTCCCCGCCGGGCGCCGG + Exonic
976066660 4:81195547-81195569 CTCCTCACCCCTCCTGCTCCTGG + Intronic
976441911 4:85085596-85085618 CTCCCTTGCCCTCCGGCTTCTGG - Intergenic
976778921 4:88737396-88737418 CTCCCCTCCCCTCCGGTGAATGG - Intronic
977985053 4:103373237-103373259 CTCCCCTCCTCCCCTGCAGCTGG - Intergenic
979785727 4:124712917-124712939 CTCCCCGCCGCGCCGGCAGCGGG - Intergenic
980739696 4:136933133-136933155 CTCCCCTCCCTTCCTGCTCCTGG - Intergenic
980809053 4:137852189-137852211 CTCCCCTCCCCTCTGCTAGCAGG - Intergenic
980944412 4:139304846-139304868 CTCCCATCCCCTCTCGCTGCAGG + Intronic
981110110 4:140925523-140925545 CTGTCCTCCCCTCCGATTGCTGG + Intronic
981128324 4:141132293-141132315 CTCCCCTCCCCCGCGCCCGCTGG + Intronic
982981260 4:162139222-162139244 CTCCCCTCCCTTCCAACTCCTGG + Intronic
983005202 4:162475942-162475964 CTCAGATCCCCTCCAGCTGCTGG - Intergenic
983088310 4:163473821-163473843 CTCGCCTCCCCTCTGCCTGAAGG + Intergenic
983882816 4:172952241-172952263 CTCACCTCCCCCCAGGCAGCAGG - Exonic
984758055 4:183342491-183342513 CTCCGCTCCCTTCCTCCTGCTGG + Intergenic
984889052 4:184474931-184474953 CTCTCCTCCCCTACCGCCGCGGG - Intergenic
985393362 4:189514917-189514939 CCCCCCCCCCCTCCTGCAGCAGG + Intergenic
985683733 5:1270968-1270990 CCCCCGCCCCCTCCGGCTCCTGG - Intronic
985733765 5:1565752-1565774 CTCCTCTGCCCTCCAGCTGATGG - Intergenic
987253818 5:16127827-16127849 CTGCCCGCCCCTCTGGCTTCTGG + Intronic
988042592 5:25909229-25909251 CCCGCCTCCCCTCCGACGGCTGG - Intergenic
988692735 5:33588794-33588816 CTCCCCTGCCCACCACCTGCAGG + Exonic
988780041 5:34512268-34512290 CTCTCCTCCCTTCAGGCTGAGGG + Intergenic
988855594 5:35225330-35225352 CTCCCCCACCCTCATGCTGCTGG - Intronic
989043194 5:37249557-37249579 CTCCCCTCCTCAGCGGCCGCCGG + Intergenic
990582031 5:57174326-57174348 CTCGCCGCCCCTCCGTCGGCGGG - Intronic
990983178 5:61619707-61619729 CTCCCTTGCCCTCTGGCTTCTGG - Intergenic
992082915 5:73252035-73252057 CTCTCCTGTCCTGCGGCTGCTGG + Intergenic
994251567 5:97542264-97542286 CACCCCTCCCCGCAGGCTGAGGG + Intergenic
995198555 5:109400475-109400497 CTTCCCCCCCCTCCCCCTGCTGG - Intronic
995700431 5:114929180-114929202 CCCCCATCCCCCCCGGCTGTGGG + Intergenic
995797907 5:115961697-115961719 GTCCCCTCTCCCCCGGCTTCAGG + Intergenic
996960385 5:129240706-129240728 CTACCCTTCACTCCAGCTGCAGG - Intergenic
997109703 5:131061334-131061356 CTTCCCTCCCCACCTGCTTCTGG - Intergenic
997582372 5:135026031-135026053 TTCCCCGCTGCTCCGGCTGCAGG - Intergenic
997950986 5:138242273-138242295 CTCCCCTCCACCACGGCAGCCGG - Intergenic
998282978 5:140830014-140830036 CTCTCCGCGCCACCGGCTGCTGG + Exonic
999153499 5:149442126-149442148 CCCCCCTACCCTCCGGCTCCCGG + Intergenic
999177224 5:149639996-149640018 CTCCCCTCCCCCAGGGCTGTAGG - Intergenic
999238375 5:150113463-150113485 CTCCCCTCCACTCCGCCCACAGG - Intergenic
1000423586 5:161064466-161064488 AGCCCCGCCCCTCAGGCTGCAGG - Intergenic
1001023990 5:168207632-168207654 CTCCCCCTCCCTCCCTCTGCTGG - Intronic
1001070334 5:168579655-168579677 CTCCGCTTCCGCCCGGCTGCTGG + Intergenic
1001130784 5:169061817-169061839 ATCCCCTCCCCTCCAGCTGGAGG + Intronic
1001328516 5:170746244-170746266 CCCCCATCCCCTCCGGTGGCTGG - Intergenic
1001585985 5:172834256-172834278 CGCCACTCGCCTCCCGCTGCCGG - Exonic
1002073605 5:176695319-176695341 CTCCCCTCCCTTCTGGCTCATGG - Intergenic
1002318929 5:178363687-178363709 TTCACCTCCCCACCGGCTGTGGG + Intronic
1002328495 5:178425668-178425690 CTCCCAGCCCCTCCAGTTGCCGG - Intronic
1002449304 5:179309960-179309982 CACCCCTGCCCTCTGGCTTCTGG + Intronic
1002536730 5:179879965-179879987 CTCAGCTCCTCTCTGGCTGCTGG + Intronic
1003074571 6:2971697-2971719 CTCGCGGCCCCTCCGGCTGGCGG - Intronic
1003122867 6:3332177-3332199 CTTCCCTGCCCTCCGACAGCTGG - Intronic
1003175076 6:3748277-3748299 CCTCCCTCCCCTAGGGCTGCGGG + Intronic
1003259193 6:4501310-4501332 TTCCCCTTCCCTCCAGCTCCTGG + Intergenic
1003840055 6:10111032-10111054 CTCCCTTGTCCTCTGGCTGCTGG + Intronic
1004140507 6:13013668-13013690 CTACCCCCTCCTCCGGCTTCGGG + Intronic
1004562085 6:16760881-16760903 CGCCCCGCTCCCCCGGCTGCTGG - Intronic
1005048997 6:21666495-21666517 CTCCCCTCTCCCCCGGACGCCGG + Intergenic
1005841700 6:29748265-29748287 CTCCCCTGGCCTCCCGCTGCCGG - Intergenic
1006071256 6:31499206-31499228 CTCCCCTCGCCTCCGGCTCCGGG + Intronic
1006184927 6:32176095-32176117 CACCCCTCCCCAACGCCTGCTGG + Intronic
1006473084 6:34238796-34238818 CTCCCCCCACCTCTTGCTGCTGG - Intronic
1006944683 6:37777575-37777597 CTCCCCGCTCCTCCAGCTTCAGG - Intergenic
1007408516 6:41648498-41648520 CTCCCCTCTCCTTGGGCTCCAGG + Intronic
1007416369 6:41693783-41693805 CTCCCTTCCCATCCTGCAGCAGG + Intronic
1007521310 6:42453080-42453102 CTCCCCTCCCCTCCGCCGCCCGG - Intergenic
1007666503 6:43516680-43516702 ATCGCCGGCCCTCCGGCTGCTGG + Intronic
1007744421 6:44034667-44034689 GTCCCCTCCCCAGAGGCTGCCGG - Intergenic
1007756135 6:44100999-44101021 CTCACCTTCCCTCTGGCAGCTGG + Intergenic
1007781486 6:44257257-44257279 CTCCCATCCCCGCTGGCTCCGGG + Intronic
1007801438 6:44397101-44397123 CTCCCCTCCCCTGAGGTTGGGGG + Intronic
1007808872 6:44472501-44472523 CTCCCCTCCCATCCTGCTTCAGG + Intergenic
1010277922 6:73990752-73990774 CTCCCCTCTCCTCCCGCGGTGGG - Intergenic
1011517373 6:88167453-88167475 CTCCCCTCCCCTCCGCCCCCGGG + Intergenic
1011734319 6:90296548-90296570 CTGCCCACCTCGCCGGCTGCCGG - Exonic
1013010899 6:106119006-106119028 CTCCCCTCCCCCTCAGCTCCTGG + Intergenic
1013174076 6:107662518-107662540 CTCCCCTCCCCTGCTGGGGCAGG + Intergenic
1013538730 6:111087447-111087469 CCCCCCGCCCCGCCGGCTGGGGG - Intergenic
1013911273 6:115278774-115278796 CTCCCCTCCCCACAAGCTGCAGG - Intergenic
1014098257 6:117482859-117482881 CTCCGCCCCGCTCCGGCTGCAGG + Exonic
1016733240 6:147448813-147448835 CTCTCCTCCCCTCAGCCTGATGG - Intergenic
1017069919 6:150566625-150566647 CTCCCCTCCCCTCAATCTGTTGG + Intergenic
1017470458 6:154733481-154733503 CTCCCCGCCGCTCGGGCCGCAGG - Exonic
1018325898 6:162668546-162668568 CTCCCCTCTCCTTCAACTGCTGG - Intronic
1018471982 6:164105595-164105617 ATCCCCTCCCCTCCCGCTGCAGG - Intergenic
1018836450 6:167487825-167487847 CTCCCTTCTCCTCCCGCCGCAGG + Intergenic
1018966524 6:168494771-168494793 CTCCCTTGCCCTTCAGCTGCTGG - Intronic
1018976615 6:168572175-168572197 CTCCCCGCATCTCCGGGTGCCGG + Intronic
1019275030 7:171670-171692 GTCCCCTCCCCTCCGTGTCCTGG + Intergenic
1019377306 7:699678-699700 CTCCCCACCCCTCCTGCAGCTGG - Intronic
1019428630 7:988573-988595 CACCCCTCCCCTCCAGGAGCAGG + Intronic
1019473244 7:1232281-1232303 ATCTCCTCCTCTCCGGCTGCAGG - Intergenic
1019513865 7:1431285-1431307 GCCCCCTCCGCTCCGGCTGCCGG - Intronic
1019711133 7:2518851-2518873 CGCCCCTCACCCTCGGCTGCCGG + Intronic
1019789463 7:3001579-3001601 CTCCCACCCCCTCCACCTGCCGG + Intronic
1020062211 7:5160953-5160975 CTCTCTTCCCCTCCCCCTGCTGG - Intergenic
1021450329 7:20778260-20778282 CGCCGCTCCCCTCGGGCTGCGGG - Intergenic
1022049093 7:26647746-26647768 CTCCCCTCACCTGCCTCTGCTGG + Intergenic
1022414116 7:30163663-30163685 CTCCCCACCCCACCGACTTCCGG + Intergenic
1022425341 7:30263459-30263481 CTCCCCTCCCCTACCACTCCTGG + Intergenic
1022485005 7:30771349-30771371 CTCCCCTTCCCTGGGGCTGGCGG - Intronic
1023077562 7:36499156-36499178 CTCCCCTTCCCTCTTCCTGCTGG + Intergenic
1023649322 7:42352017-42352039 TTCCCCTGCCCTCTGGCTTCTGG + Intergenic
1023991565 7:45131984-45132006 CTCCCCTCCCCTCATCCTGTGGG + Intergenic
1023996801 7:45163519-45163541 CTCCACGACCCTCTGGCTGCTGG - Intronic
1024570598 7:50719960-50719982 CTGCCCCCCACTCCAGCTGCTGG + Intronic
1026387406 7:69863857-69863879 CTCCCCTACCCAACGGGTGCTGG - Intronic
1026840464 7:73667864-73667886 CTCCGCTCCGCTCCGGCTCCAGG - Exonic
1029145354 7:98441982-98442004 CTCCCCTCTCCTCCTCCTGGTGG - Intergenic
1029283691 7:99452338-99452360 TTCTCATCCCCTCTGGCTGCTGG + Intronic
1029466151 7:100726130-100726152 CCTCCCTCCTCTCCGTCTGCAGG + Intergenic
1031700379 7:124917919-124917941 CTCCCCTCCCCTACACCTCCTGG - Intronic
1032119871 7:129148065-129148087 CTCTCCTCACCTCCCTCTGCAGG + Intronic
1032197571 7:129798454-129798476 ATCCCCCCACCTCAGGCTGCAGG + Intergenic
1032281730 7:130508653-130508675 CTCCCTTCTCCTCCAGTTGCAGG - Exonic
1032703150 7:134399397-134399419 CTCCCCTCCCCTCCAGGTGATGG - Intergenic
1032796104 7:135277397-135277419 CACTTCTCCCCTTCGGCTGCAGG - Intergenic
1033584321 7:142762878-142762900 CCCACCGCCCCTCCAGCTGCTGG + Intronic
1033707404 7:143902587-143902609 CTCCCCTCCCCTCCAGGGGGAGG + Intergenic
1034293054 7:149947541-149947563 CTGCCCTGCCTTCTGGCTGCTGG - Intergenic
1034410283 7:150937608-150937630 CTCACTTCCCGTCCTGCTGCAGG - Intergenic
1034684607 7:152959033-152959055 GTCCCCTGCCCTCCTGATGCAGG - Intergenic
1034737349 7:153441310-153441332 CGCTCCTCCCCTCAGCCTGCTGG - Intergenic
1034813019 7:154149332-154149354 CTGCCCTGCCTTCTGGCTGCTGG + Intronic
1035127085 7:156616564-156616586 CTCCGCTCCGCTACAGCTGCAGG + Intergenic
1035202707 7:157277376-157277398 CTCCTCTCCCCTCCCCTTGCCGG + Intergenic
1035260527 7:157659035-157659057 CTCCCTTCACCCCGGGCTGCCGG + Intronic
1035575130 8:699517-699539 CTCCCCACCCCTCAGGGTGACGG + Intronic
1035577255 8:715718-715740 CTGCCCTGCCCACCTGCTGCAGG + Intronic
1035761409 8:2071681-2071703 CTTGTCTCCGCTCCGGCTGCTGG + Intronic
1035840738 8:2809900-2809922 TTCCCCTCTCCACCAGCTGCCGG + Intergenic
1036162967 8:6406451-6406473 CTCGCCGCGCCTCTGGCTGCTGG - Intergenic
1036615797 8:10386395-10386417 CTTCCCTTCCCTCCTGCTTCAGG - Intronic
1036810784 8:11866918-11866940 CTATCCTCTCCTCCGGCAGCAGG + Intronic
1037057041 8:14455970-14455992 ATCCCCTCCCCTCCAACTGTAGG - Intronic
1037481947 8:19313744-19313766 CTCCCTTCCCCGACGGCTTCTGG + Exonic
1037817722 8:22120682-22120704 CTCCCCTCCCCTCCCGGCCCTGG - Intronic
1038037949 8:23702387-23702409 TTCCCTTCCCCTCCGCCCGCAGG - Intergenic
1038313394 8:26463083-26463105 CTCCCCTCCCCCCCAGCTTCTGG + Intronic
1038316803 8:26491284-26491306 CTCCCCTCACCTCTTGCTGTGGG + Intronic
1039620954 8:38996749-38996771 CGCCCCGCCCCGTCGGCTGCCGG - Intronic
1040409509 8:47139848-47139870 CTCCCCTCCCCACACCCTGCAGG + Intergenic
1040413903 8:47180977-47180999 CTCCTCTCCCCTCCAGCAGGGGG + Intergenic
1040418690 8:47219348-47219370 CACCCCTCTGCTCAGGCTGCTGG - Intergenic
1040891935 8:52326257-52326279 CTCCCCTTCCCCACTGCTGCAGG - Intronic
1041206297 8:55501459-55501481 CTCCCCTCACCTCCAGCCCCTGG + Intronic
1041696871 8:60745004-60745026 CTGCCCTGCCCACCGGCTGAGGG - Intronic
1041715025 8:60924645-60924667 CTCCCCTCCCCTCCCCATCCTGG + Intergenic
1042021877 8:64377838-64377860 ACCCCCTCCCCCCGGGCTGCGGG + Intergenic
1044838078 8:96315015-96315037 CTCCCCTTCCCTCCTTGTGCCGG + Intronic
1046432750 8:114150773-114150795 CTCCCATCTCCTTGGGCTGCCGG - Intergenic
1047566837 8:126053718-126053740 CTCCCCTCCCCTGCAGCCCCTGG - Intergenic
1048489293 8:134877609-134877631 CTCCTCTCCCCTCCAGCCCCTGG - Intergenic
1049229718 8:141475621-141475643 CTCCGCTTCCCTTGGGCTGCTGG + Intergenic
1049337130 8:142092488-142092510 CTCCCCTCCCCACCCCCAGCAGG + Intergenic
1049386841 8:142347135-142347157 CTGCCCTCCCGTCCTTCTGCAGG - Intronic
1049479941 8:142817837-142817859 CTCATCTCCCCTCCGGAGGCAGG - Intergenic
1049600201 8:143504066-143504088 CCCTCCTTCCCTCGGGCTGCAGG + Intronic
1049697278 8:143990394-143990416 CGCCCCCTCCCTCCGGCTCCAGG - Intronic
1049805307 8:144536179-144536201 CTCCATCCCCCTCCGGCTGTAGG + Intronic
1050899908 9:10934130-10934152 CTGCCCTCCACTCCTGCTGGTGG - Intergenic
1052901500 9:33798013-33798035 CCCACCACCCCTCCAGCTGCTGG + Exonic
1052951513 9:34217032-34217054 CTCCCCACCTCTCCGGCCTCTGG + Intronic
1052968842 9:34363973-34363995 CTACCCTCTCCTCAAGCTGCTGG + Intergenic
1057386820 9:94612257-94612279 CTCTCCTCTCCTCCCACTGCAGG + Intronic
1057438676 9:95065477-95065499 CTCTCCTCCCCTTCTCCTGCTGG + Intronic
1057489725 9:95511359-95511381 CTCTCCTCCTCCCCGGCTTCAGG + Intronic
1058668660 9:107342473-107342495 CTCCCCTGCCCAGGGGCTGCAGG - Intergenic
1059335116 9:113564298-113564320 CTCCCCTCCTCACAAGCTGCTGG + Intronic
1059372507 9:113854185-113854207 CTCCCCTGCCCTTTGGCTTCTGG + Intergenic
1059429547 9:114241542-114241564 CTCCCCTTCCTTCCCGCTTCCGG - Intronic
1059438266 9:114289150-114289172 CTCCCCACCCCTCCCCCTCCAGG + Intronic
1059669148 9:116476950-116476972 CCCAGCTCCCCTCCGCCTGCAGG + Intronic
1060193890 9:121610558-121610580 CTGCCCTGCCCTCTAGCTGCAGG + Intronic
1060400542 9:123346320-123346342 CTGCCCTGTCCACCGGCTGCTGG + Intergenic
1060498131 9:124132865-124132887 ACCCCCTCCCCTCCTGCTCCTGG - Intergenic
1060881348 9:127120407-127120429 CCCCCCTCTCCTCAGGCTCCTGG + Intronic
1061222142 9:129258495-129258517 CTCCCGGCCCCTCCTGCTCCGGG + Intergenic
1061955160 9:133957522-133957544 CTCCCTGCCTCCCCGGCTGCAGG + Intronic
1061992791 9:134169108-134169130 CTCCCCGCTCATCCGGATGCAGG + Intergenic
1062004437 9:134232118-134232140 CTGCCCTCCCCTGGGGCTGTTGG + Intergenic
1062017130 9:134296608-134296630 CGCCACTCCCTACCGGCTGCTGG + Intergenic
1062025023 9:134336235-134336257 CTTCCCTCCCCTCAGTCTCCTGG + Intronic
1062044846 9:134420214-134420236 CTCGCCTGCCCATCGGCTGCAGG - Intronic
1062430248 9:136523683-136523705 CTGCCCACCCCTCAGGCTGTGGG + Intronic
1062483818 9:136764492-136764514 CTCCCCTGCCCTCCAGCCCCTGG + Exonic
1062552800 9:137097821-137097843 CACCGCTCCCCTCCAGCTTCGGG - Exonic
1062576760 9:137212430-137212452 CTCCCCTCACCCCCTGCTGTGGG + Intronic
1062699314 9:137890752-137890774 ACCCCCACCCCTCCAGCTGCTGG - Intronic
1203572094 Un_KI270744v1:140970-140992 AACCCCTCCTCTCTGGCTGCGGG + Intergenic
1188604908 X:32016270-32016292 CTCCCTTTCCCTCCTGCTTCCGG + Intronic
1190280739 X:48927781-48927803 CTCCCCTCCCCAAAGGCTGGGGG + Intronic
1191640814 X:63428616-63428638 CTCCCCTCTCCTCTAACTGCTGG - Intergenic
1192211093 X:69128575-69128597 CTCCCGTTCACTCTGGCTGCGGG + Intergenic
1192545502 X:72009370-72009392 CTCCCTTGCCCTCTGGCTTCGGG - Intergenic
1192848082 X:74925829-74925851 CTTCCCTCCCCTCGGGCGCCCGG + Intergenic
1196441457 X:115723195-115723217 CTTCCCTGCCCTCCGGCTTCTGG + Intergenic
1196444987 X:115841184-115841206 CTTCCCTGCCCTCCGGCTTCTGG + Intergenic
1196817572 X:119677383-119677405 CTCCCCTCCCCTGTGGCCGTTGG - Intronic
1198518143 X:137428545-137428567 CCCCCCTCCCCCCGGGCTGGGGG - Intergenic
1199179633 X:144838514-144838536 CTCCCCTCCCCCCTGCCCGCCGG + Intergenic
1200003686 X:153074333-153074355 CTCTCCTCCTCTCAGGCAGCAGG + Exonic
1200004037 X:153075676-153075698 CTCTCCTCCTCTCAGGCAGCAGG - Intergenic
1200180433 X:154147199-154147221 GTCCCCTCCCCCACTGCTGCTGG + Intronic
1200186261 X:154185594-154185616 GTCCCCTCCCCCACTGCTGCTGG + Intergenic
1200191913 X:154222732-154222754 GTCCCCTCCCCCACTGCTGCTGG + Intronic
1200197668 X:154260536-154260558 GTCCCCTCCCCCACTGCTGCTGG + Intronic
1200255558 X:154580694-154580716 CTTCCCTCCTCCCCGCCTGCAGG + Intergenic
1200262211 X:154623710-154623732 CTTCCCTCCTCCCCGCCTGCAGG - Intergenic
1200794178 Y:7325741-7325763 ATCCCCTCCCCTCCTGTGGCGGG + Intergenic