ID: 1122940046

View in Genome Browser
Species Human (GRCh38)
Location 14:104977182-104977204
Sequence CCCCACTCCTTGGGGAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122940046_1122940051 -2 Left 1122940046 14:104977182-104977204 CCTGTTTTCCCCAAGGAGTGGGG 0: 1
1: 0
2: 0
3: 17
4: 177
Right 1122940051 14:104977203-104977225 GGTCCAGCCTGCACCAGTGCCGG 0: 1
1: 0
2: 4
3: 11
4: 169
1122940046_1122940058 22 Left 1122940046 14:104977182-104977204 CCTGTTTTCCCCAAGGAGTGGGG 0: 1
1: 0
2: 0
3: 17
4: 177
Right 1122940058 14:104977227-104977249 CAGCCCAACCCCCTGGCCAGTGG 0: 1
1: 0
2: 2
3: 25
4: 328
1122940046_1122940055 15 Left 1122940046 14:104977182-104977204 CCTGTTTTCCCCAAGGAGTGGGG 0: 1
1: 0
2: 0
3: 17
4: 177
Right 1122940055 14:104977220-104977242 TGCCGGCCAGCCCAACCCCCTGG 0: 1
1: 0
2: 0
3: 15
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122940046 Original CRISPR CCCCACTCCTTGGGGAAAAC AGG (reversed) Intronic
901005635 1:6170415-6170437 CCCCACTCCTCGGGGGCACCGGG + Intronic
901663731 1:10814918-10814940 CCACCCTCCTTGGGGGCAACTGG - Intergenic
901754780 1:11434908-11434930 TCCCACTCCTGGGGGACAACTGG + Intergenic
902755834 1:18548582-18548604 CCCCAGTCATTGGGGCAAAGGGG + Intergenic
902818250 1:18928194-18928216 CCCCACCCCCTGGGGACACCTGG + Intronic
904044719 1:27602645-27602667 CCCCACCCCCTGGGGAAGAGGGG + Intronic
904753475 1:32755105-32755127 CCGCACTTGTTGGGGGAAACAGG - Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907413894 1:54301103-54301125 CCCCACTTGCTTGGGAAAACTGG + Intronic
907570159 1:55476098-55476120 CTCCACTCCTCTGGGAAGACAGG - Intergenic
914022414 1:143882152-143882174 CCCCACTCCTGGGGGGAATCTGG + Intergenic
915005105 1:152628512-152628534 CCCCACTCCTGGGCCAGAACAGG - Intergenic
915863939 1:159477915-159477937 CCCAACCCATTGGGGAACACTGG - Intergenic
919911637 1:202114647-202114669 CCCCTTTCCTTGGGGGAAAGGGG - Intergenic
920116715 1:203626791-203626813 CCGCACTGCTTGGGGAGAGCTGG + Exonic
921926223 1:220711910-220711932 CCCCTCTCCTTAGGGAAATATGG + Intergenic
922152986 1:223021038-223021060 CCCCACCCCCTAGGGACAACTGG + Intergenic
923063266 1:230496371-230496393 CCCCACTACTTGGGGCAGATGGG - Intergenic
924772332 1:247088730-247088752 CCCCACACCTTGGGCACAGCAGG - Intergenic
1063975864 10:11415124-11415146 CGCCACTCCCTTGGGAAAAGTGG - Intergenic
1064877958 10:20016843-20016865 CCTCACTCCTTGCGGAATTCTGG + Intronic
1065340090 10:24696434-24696456 TCCCACTCATTGGCGAAAACGGG - Intronic
1067155425 10:43777251-43777273 CCCTACTCCATGGGGCACACCGG + Intergenic
1068573870 10:58661370-58661392 CCCACCTCCTTTAGGAAAACTGG + Intronic
1069813656 10:71180089-71180111 CACCCCTGCTTGGGGAAGACGGG - Intergenic
1071859640 10:89659075-89659097 CCCCATCCTTTGGGGAAAGCTGG - Intergenic
1074463580 10:113661796-113661818 CCCCACCCCAAGGGGAAAACAGG + Intronic
1075275158 10:121086449-121086471 CCCCACACCTTGGGGAGGCCAGG + Intergenic
1076497105 10:130904544-130904566 CCCCACTCCAGGGTGAAAGCTGG + Intergenic
1081487911 11:43546296-43546318 CGACACTCCTTGGGGAAGAAAGG - Intergenic
1081834681 11:46143853-46143875 CCCCACTTCCAGGGGAAAGCTGG + Intergenic
1082835112 11:57645873-57645895 CCCCACCCCTGGGGGAAACCTGG - Exonic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1089314173 11:117579397-117579419 GCCCACTCCTTGGGCACAACTGG + Intronic
1091643339 12:2254228-2254250 CCCCACTCCCTGAGAACAACTGG - Intronic
1096823658 12:54257484-54257506 CCCAACGCCTGGGGGAAAAAAGG + Intronic
1097245710 12:57606565-57606587 TCCCACCTCTTGGGGAAAAATGG - Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098485949 12:71022054-71022076 CCTCAATCCTTGGGGATTACGGG + Intergenic
1101008462 12:100425924-100425946 CCCCAAACCTAGTGGAAAACAGG + Intergenic
1103017579 12:117507846-117507868 CCCCACTCCTATTGGAAATCAGG + Intronic
1103085732 12:118060968-118060990 CCCCCCTCCCCGGGGAGAACGGG + Intronic
1103624608 12:122208334-122208356 CCCCACTCAGTGGGGAAAGCAGG - Exonic
1105891327 13:24684582-24684604 CCCCTCTCCCAGGGGAAAAATGG + Intronic
1110049900 13:70883730-70883752 CCTGACTCCTTGGTAAAAACAGG + Intergenic
1110568099 13:76976431-76976453 CACCACTCCTTGGCGAAGAAGGG + Intergenic
1112901822 13:104366022-104366044 TCCCACTCCTTGTGGATAAGGGG - Intergenic
1113856440 13:113448883-113448905 CCCCACTCCCTGGGAAAACTGGG - Intronic
1119423038 14:74518988-74519010 CCTCACTCCATGGAGAAAAATGG + Intronic
1122687725 14:103518021-103518043 CCCCACTCCGAGGTGAACACAGG - Intergenic
1122940046 14:104977182-104977204 CCCCACTCCTTGGGGAAAACAGG - Intronic
1125879892 15:43185054-43185076 CCACAATCCTGTGGGAAAACAGG - Exonic
1126675776 15:51158314-51158336 TCCAACTCCTAGGGGCAAACTGG - Intergenic
1127284440 15:57520068-57520090 CCCCACACCACTGGGAAAACAGG - Intronic
1129467345 15:75731499-75731521 CCCCTCTCCTGGGGGAATGCAGG - Intergenic
1129719862 15:77872112-77872134 CCCCTCTCCTGGGGGAATGCAGG + Intergenic
1132234155 15:100206606-100206628 TCCCTCTCCCTGGGGAAAGCTGG + Intronic
1132734419 16:1378484-1378506 CCCCACTCCAAGGGGAGAAAAGG - Intronic
1133199050 16:4191272-4191294 CCCCACCCCTTGAGGAAACCAGG + Exonic
1133264350 16:4574575-4574597 TCCCACTCCTTGGGAAACACTGG + Intronic
1133415132 16:5600620-5600642 GCCCACTGCTTGGTGTAAACTGG + Intergenic
1133565784 16:6992083-6992105 ACCCATTCCTTAGGGAGAACGGG + Intronic
1134048931 16:11123468-11123490 CCCCAGTCCTCATGGAAAACAGG + Intronic
1135135563 16:19883974-19883996 CCCCTCTCCTTGGGGGACACAGG - Intronic
1135631187 16:24036792-24036814 CCTCAATCAGTGGGGAAAACTGG - Intronic
1135984345 16:27173089-27173111 CCCCACACCTTGGAGGACACTGG + Intergenic
1136099836 16:27985885-27985907 CACGACTCCTTGAGGAACACAGG + Intronic
1137222405 16:46469467-46469489 CCCCAAGCCTTGGTGAGAACTGG - Intergenic
1142429297 16:90017992-90018014 CCCTCCTCCTTTGGGAAAAAAGG - Intronic
1144270713 17:13612856-13612878 CCCTATTCCTTGGGGAAAGTGGG - Intergenic
1144357930 17:14463389-14463411 CACCACTCCTTGAGGAAATTTGG - Intergenic
1144613411 17:16745912-16745934 CCTCACTCCTTCTGGAAAGCCGG + Intronic
1145102094 17:20085984-20086006 CTTCACTCCTTGGGGACATCAGG - Intronic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1146956573 17:36939549-36939571 ATCCAGTCCTTGAGGAAAACCGG - Intronic
1147215314 17:38895911-38895933 CCCCACTCCTGGGAGATACCTGG - Intronic
1148742565 17:49901272-49901294 ACCCAATCCTTCTGGAAAACTGG - Intergenic
1151786518 17:76277879-76277901 CCCCACTGCTGGGGGAGAAAAGG - Intronic
1152187532 17:78867333-78867355 TCCCTCTCCTTGGGGATAATAGG - Intronic
1152299405 17:79486282-79486304 CCCCACTTCCTGGGGACAAAAGG + Intronic
1152610273 17:81311914-81311936 CCCCGCTCCTGGGGAAAAACAGG + Exonic
1152810334 17:82378804-82378826 CCCCGCCCCTTGGGGACAGCAGG - Intergenic
1153234128 18:2969558-2969580 CCCCACTAAATGAGGAAAACTGG + Intronic
1153322623 18:3788134-3788156 CCCCTCTTCTTAGGGAAAAGAGG - Intronic
1155680115 18:28477426-28477448 CCCCTCTCCTAGGGGAATATTGG + Intergenic
1156495026 18:37520020-37520042 ACCCTCTCCTTGGGGGAGACTGG + Intronic
1163160486 19:15461296-15461318 ACCCACTCCTGCGGGAGAACAGG - Exonic
1164878057 19:31706701-31706723 CCCCACTCCTGGAAGAACACTGG + Intergenic
927103347 2:19804771-19804793 GCCCATTCCTTTGGGAAAATGGG - Intergenic
927225641 2:20763440-20763462 CCCCACCCCTTGGGGTGAAGAGG + Intronic
927514574 2:23664678-23664700 CCCTCCTCTTTGTGGAAAACTGG - Intronic
929349881 2:40937717-40937739 CCCCACTGGTTGGGGAAAGGTGG + Intergenic
929904021 2:46030401-46030423 CCCCACTACTTGGGGTATTCTGG - Intronic
931648180 2:64444362-64444384 CCCCACTCTTGAGTGAAAACTGG - Intergenic
931808932 2:65835165-65835187 CCCCACTCCTTGACGATAGCTGG + Intergenic
931879639 2:66554747-66554769 CCCCACTCCTAGGATAAAGCTGG - Intronic
933614278 2:84468399-84468421 CTGGACTCCTTGGGGTAAACAGG - Intergenic
934104823 2:88685963-88685985 CCCCAATTCTTTGGGAAAAATGG - Intergenic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
939912528 2:148001039-148001061 TCCCTCTATTTGGGGAAAACTGG + Intronic
945974214 2:216258240-216258262 CTCCACTCCTTGGGGCACACTGG + Exonic
946107567 2:217385271-217385293 CTACACTCCTTTTGGAAAACTGG - Intronic
946163767 2:217851532-217851554 CCCAAAGCCTTGGGGAAAACTGG - Intronic
948639206 2:239363476-239363498 CCCAAATCCATAGGGAAAACAGG + Intronic
949011448 2:241681516-241681538 CCCCACTTTTTGTGGAGAACGGG - Intronic
1177246081 21:18525954-18525976 CCCCACTCCTTGCACCAAACGGG + Intergenic
1178040407 21:28634410-28634432 GCCCTTTCCTTGGGGAAAATTGG - Intergenic
1178450945 21:32699296-32699318 CCCCAAACCTTGGTGAGAACTGG - Intronic
1179319324 21:40274547-40274569 CCCCTTTCCTTGGGGAAAGATGG + Intronic
1179540203 21:42078958-42078980 CTCCACTCCTAGGGGATAGCGGG + Intronic
1181886944 22:26028970-26028992 CACCACTGCTTGGGGATATCAGG - Intronic
1181889100 22:26045972-26045994 CACCTCTCATTGGGGAAAAATGG + Intergenic
1184947040 22:47811029-47811051 GCCCACTCCTAGGGCAAAAGGGG - Intergenic
1185241531 22:49749990-49750012 GCCCACTCCGTGGGGAGCACAGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951543763 3:23806422-23806444 CCCCCGCCCCTGGGGAAAACGGG - Intronic
952676429 3:36036632-36036654 CTCCACTCCTAGGTGAAAATGGG + Intergenic
959369447 3:105504794-105504816 CCCCACACCTAGGTGAAGACAGG - Intronic
960838121 3:121928087-121928109 GCCCTCTCCTTAGGGAACACAGG + Intronic
962697245 3:137962426-137962448 CACCAGTCCTTGGGGACAAAAGG + Intergenic
962753516 3:138451571-138451593 CCCCACTCCTGGGGAAGCACAGG - Intronic
963315189 3:143751542-143751564 CCCCACTCCTTGGGGTCAGCTGG + Intronic
963398877 3:144771332-144771354 CCCCACTTCTTGGAGAAAGAGGG - Intergenic
963458138 3:145573338-145573360 CCCCACTTCTTTGGGGAAAATGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967220104 3:187241524-187241546 CCAGACTCCTTGGGCAGAACAGG + Exonic
968457765 4:707538-707560 CCCGACCCCCAGGGGAAAACAGG - Intronic
968457804 4:707646-707668 CCCGACCCCCAGGGGAAAACAGG - Intronic
968457867 4:707826-707848 CCCGACCCCCAGGGGAAAACAGG - Intronic
968457893 4:707898-707920 CCCGACCCCCAGGGGAAAACAGG - Intronic
968457924 4:707970-707992 CCCGACCCCCAGGGGAAAACAGG - Intronic
968582645 4:1402195-1402217 CCCTTCTCCCCGGGGAAAACAGG + Intergenic
969849029 4:9942341-9942363 CCCCACTCCCTGGGGAACCATGG + Intronic
971339339 4:25753494-25753516 CCCCACAGCTGGGGGAAGACAGG - Intronic
976653019 4:87456338-87456360 CCCCAATCCTTAGGAAAGACAGG + Intronic
976856089 4:89607249-89607271 CCTCTCTTCTTGGGGGAAACTGG + Intergenic
977007637 4:91591033-91591055 CCCCACCCCTTGGGGACATTTGG + Intronic
986517855 5:8582072-8582094 CCCCACAGCCTGGGGGAAACAGG - Intergenic
990560316 5:56977461-56977483 CCCCACACCTTGGGGACATTTGG + Intergenic
992157478 5:73969425-73969447 CCTCCCTCCCTGGGGCAAACAGG - Intergenic
995289167 5:110429725-110429747 TCCCACTTTTTGAGGAAAACTGG + Intronic
997488348 5:134250927-134250949 CCCCACCACTTGGGAATAACTGG + Intergenic
997510804 5:134452538-134452560 CCCCTCTTCTGGGGGAAGACTGG + Intergenic
997932150 5:138081644-138081666 CCTCTCTGCTTGGGGAAAATAGG - Intergenic
998661540 5:144244121-144244143 CCCCACTCTTTGGGGGATTCAGG + Intronic
999767617 5:154753681-154753703 CCCCTCTCCTGGTGGAAAAATGG - Intronic
1000024218 5:157344881-157344903 CTCCACTCCTGGAGGAAAATGGG - Intronic
1000493388 5:161945339-161945361 TCCCTCTCCTTGTGTAAAACAGG + Intergenic
1000853421 5:166368882-166368904 CCCCACAGCTGGGGGAAGACAGG - Intergenic
1006321192 6:33320536-33320558 CCCGGCGCCTTCGGGAAAACCGG - Exonic
1010176437 6:73033186-73033208 GCCCCCTGCTTGGGGAAAAGAGG - Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1019626693 7:2019488-2019510 CCACCCTCCTTGTGCAAAACGGG + Intronic
1020110688 7:5446332-5446354 CCCCACCCCATGGGGGACACAGG + Intronic
1021898195 7:25257337-25257359 CTCCACTCTTTGGGGATAAGTGG + Intergenic
1023108315 7:36785144-36785166 CCTCCCTCCCTGGGGAACACAGG - Intergenic
1023995725 7:45157918-45157940 CCCCACTCCTCGGGGTTCACCGG + Intronic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026787970 7:73313587-73313609 CCCCTCTCCTTGGGGAGTTCAGG - Intronic
1029988916 7:104945312-104945334 GCCCAGTCCCTGGGGAACACAGG - Intergenic
1030399266 7:109028162-109028184 TCCCAGTGGTTGGGGAAAACTGG + Intergenic
1031362649 7:120865411-120865433 ACCCACTCCTTGTGGGAAAGAGG - Intergenic
1032438539 7:131922429-131922451 GCCGACTTCTTAGGGAAAACAGG + Intergenic
1033275234 7:139966892-139966914 CCCCACTCCTGGAGGAGAAAGGG - Intronic
1033589502 7:142797611-142797633 CCCCGCTCCTGGGGAAAGACTGG + Intergenic
1034524457 7:151648407-151648429 GCCCCCTGCTTTGGGAAAACTGG + Intronic
1035115931 7:156523951-156523973 CCACACTCCATCGGGAACACAGG + Intergenic
1037848945 8:22310106-22310128 TCCCACACTTTGGGGAATACTGG - Intronic
1043344628 8:79285613-79285635 CCCCAATTTTTGGGGAAAATGGG + Intergenic
1044078613 8:87856070-87856092 CCTCTGTTCTTGGGGAAAACAGG - Intergenic
1045610560 8:103836297-103836319 CCCCACCCCTTTGGGAAACCCGG + Intronic
1049153813 8:141055090-141055112 CCCCATTTCTTGGGGCAAATGGG + Intergenic
1050045942 9:1545286-1545308 CATCACCCCTTTGGGAAAACGGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1060013684 9:120067409-120067431 CCCCAGGCCATGGGGACAACTGG + Intergenic
1061296418 9:129679270-129679292 CTCCATTCCTTGTGGAATACAGG - Intronic
1203771364 EBV:51497-51519 CCCCACCCTTGGGGGGAAACCGG + Intergenic
1203574711 Un_KI270744v1:166390-166412 ACCCACTCTTTGGGGGACACAGG - Intergenic
1186432228 X:9514659-9514681 CCACTCCCCTTGGGGAAAGCCGG - Intronic
1189147871 X:38673754-38673776 CCTCACTCCTATGGTAAAACAGG + Intronic
1189699109 X:43697949-43697971 CTCCACTTCTAGGGGAAAAGTGG + Intronic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1193365240 X:80623604-80623626 CCCCACTCCCTAGCCAAAACAGG - Intergenic
1194850674 X:98864882-98864904 CCCAATTCTTTGGGGAAAATGGG - Intergenic
1195219426 X:102732174-102732196 CCCAAATCTTTGGGGAAAAATGG + Intronic
1195781060 X:108464782-108464804 CCGCATTCCTTGGCGCAAACAGG + Intronic
1197891462 X:131274379-131274401 CTCCTTTCCTTGGGGAAAAGAGG + Intronic
1198590333 X:138173433-138173455 CCCTGCTCCTTGGGGAAAATTGG + Intergenic
1198796006 X:140395470-140395492 CCATACTGCTTGGGGAAAAATGG + Intergenic
1199260352 X:145766301-145766323 CCCCTCTCCCTGGGGAAATCGGG + Intergenic
1199716393 X:150510061-150510083 GCCCACCCCTTTGGGAACACTGG - Intronic
1200138166 X:153884979-153885001 CCCCACTCCTTCTGGAGAAGGGG + Intronic