ID: 1122940287

View in Genome Browser
Species Human (GRCh38)
Location 14:104978147-104978169
Sequence CGCCTGCAGCCCGCTCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 276}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122940287_1122940298 2 Left 1122940287 14:104978147-104978169 CCCAGGGGAGCGGGCTGCAGGCG 0: 1
1: 0
2: 1
3: 18
4: 276
Right 1122940298 14:104978172-104978194 GAGGGGCGCACCGCTGCCGGGGG 0: 1
1: 0
2: 1
3: 7
4: 124
1122940287_1122940295 -1 Left 1122940287 14:104978147-104978169 CCCAGGGGAGCGGGCTGCAGGCG 0: 1
1: 0
2: 1
3: 18
4: 276
Right 1122940295 14:104978169-104978191 GGGGAGGGGCGCACCGCTGCCGG 0: 1
1: 0
2: 0
3: 27
4: 305
1122940287_1122940300 9 Left 1122940287 14:104978147-104978169 CCCAGGGGAGCGGGCTGCAGGCG 0: 1
1: 0
2: 1
3: 18
4: 276
Right 1122940300 14:104978179-104978201 GCACCGCTGCCGGGGGTTCCGGG 0: 1
1: 0
2: 1
3: 4
4: 120
1122940287_1122940305 18 Left 1122940287 14:104978147-104978169 CCCAGGGGAGCGGGCTGCAGGCG 0: 1
1: 0
2: 1
3: 18
4: 276
Right 1122940305 14:104978188-104978210 CCGGGGGTTCCGGGCCAGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 244
1122940287_1122940297 1 Left 1122940287 14:104978147-104978169 CCCAGGGGAGCGGGCTGCAGGCG 0: 1
1: 0
2: 1
3: 18
4: 276
Right 1122940297 14:104978171-104978193 GGAGGGGCGCACCGCTGCCGGGG 0: 1
1: 0
2: 1
3: 12
4: 134
1122940287_1122940299 8 Left 1122940287 14:104978147-104978169 CCCAGGGGAGCGGGCTGCAGGCG 0: 1
1: 0
2: 1
3: 18
4: 276
Right 1122940299 14:104978178-104978200 CGCACCGCTGCCGGGGGTTCCGG 0: 1
1: 0
2: 1
3: 2
4: 78
1122940287_1122940302 14 Left 1122940287 14:104978147-104978169 CCCAGGGGAGCGGGCTGCAGGCG 0: 1
1: 0
2: 1
3: 18
4: 276
Right 1122940302 14:104978184-104978206 GCTGCCGGGGGTTCCGGGCCAGG 0: 1
1: 0
2: 3
3: 25
4: 310
1122940287_1122940303 17 Left 1122940287 14:104978147-104978169 CCCAGGGGAGCGGGCTGCAGGCG 0: 1
1: 0
2: 1
3: 18
4: 276
Right 1122940303 14:104978187-104978209 GCCGGGGGTTCCGGGCCAGGTGG 0: 1
1: 0
2: 1
3: 30
4: 282
1122940287_1122940296 0 Left 1122940287 14:104978147-104978169 CCCAGGGGAGCGGGCTGCAGGCG 0: 1
1: 0
2: 1
3: 18
4: 276
Right 1122940296 14:104978170-104978192 GGGAGGGGCGCACCGCTGCCGGG 0: 1
1: 0
2: 0
3: 23
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122940287 Original CRISPR CGCCTGCAGCCCGCTCCCCT GGG (reversed) Intronic
900109279 1:998806-998828 CGCCCCCAGCCCGCCCCCCCGGG + Intergenic
900109303 1:998848-998870 CACCTGCAGACCGCGGCCCTGGG + Intergenic
900119970 1:1044435-1044457 CACGTGCAGCCGGCTCACCTCGG - Exonic
900163947 1:1237297-1237319 TGGCTGCAGCCAGCTCTCCTGGG - Intergenic
900164305 1:1238614-1238636 TGCCTGCAGAGCGCTGCCCTGGG - Intergenic
900176881 1:1294948-1294970 AGCCTGCAGCTGGCTCCCCCCGG - Intronic
900402316 1:2477630-2477652 ACCCTGCAGCCCCCTCTCCTGGG + Intronic
900542941 1:3213058-3213080 CGCCTGCCGCACGCTTCCCCGGG + Intronic
900953727 1:5874333-5874355 GGGCTGCCGCCCACTCCCCTTGG - Intronic
901045383 1:6393031-6393053 CGCCTCCAGCCGGCTCCTCCTGG - Intronic
901250124 1:7771535-7771557 CGTCTGCAGCCCGCGACCCAAGG - Intronic
901676578 1:10889023-10889045 CGCCCGCAGCCCGCCCGCCCCGG - Intergenic
902483424 1:16725034-16725056 AGCCCGCAGCTCGCGCCCCTCGG + Intergenic
902585658 1:17437772-17437794 CGCCGGCCGCCCCCTCCCCGCGG + Intronic
902640303 1:17762644-17762666 CACCTGCAGCCCAACCCCCTGGG - Intronic
903549451 1:24147743-24147765 GGCCTGGAGCTCGCTCTCCTGGG + Intergenic
903573248 1:24321869-24321891 TGCCTGGAGCCCGCAGCCCTGGG + Intronic
905349225 1:37333109-37333131 TGCCTGCAGCTCACTCCTCTGGG + Intergenic
905647187 1:39633004-39633026 CTCCTGCAACCCGATCCCCGGGG + Intronic
905772254 1:40645922-40645944 AGCCTGCAGGCCACTCCCCAAGG + Intronic
905789924 1:40784294-40784316 CGCCTGCGGCCAGCGCTCCTCGG + Exonic
906377807 1:45310184-45310206 CGCCTGCAGTCCCCGCCACTCGG + Intergenic
907415842 1:54313259-54313281 AGGCTGCAGCCCCCTCCCCCAGG - Intronic
908786204 1:67736763-67736785 AGTCTGGAGCCCACTCCCCTAGG - Intronic
909988412 1:82191311-82191333 CCTCTGCAGCCCTCTCCACTGGG + Intergenic
910655124 1:89610673-89610695 CCCCTGGAGCCTGCTGCCCTGGG - Intergenic
910726321 1:90343553-90343575 CTCCTGCAGCCTGCTGCCCCTGG - Intergenic
914702757 1:150149738-150149760 CGGCTGGAGACCGCTCCCCAGGG - Intronic
914702955 1:150150397-150150419 CCCCGGCGGCCCGGTCCCCTCGG + Intronic
915488532 1:156238839-156238861 CGCCTGCTGCCCAGTCCCCCAGG - Intronic
915977665 1:160401181-160401203 CGGCTTCAACCGGCTCCCCTGGG - Intronic
919805734 1:201380072-201380094 TGCCTGCACCCCCCTCCCCTGGG - Intronic
920274992 1:204798091-204798113 GGCCTGCTGCCTGCTGCCCTGGG - Intergenic
922518074 1:226223350-226223372 CGCCTGCGGCCCGCGCACCCGGG + Intergenic
923171703 1:231422385-231422407 CGCAGGCAGCCCCCGCCCCTCGG - Exonic
924477567 1:244395241-244395263 AGCCTGCAGCCCCCTTCCCACGG - Intergenic
924743185 1:246809610-246809632 CCCCTGCAGAAGGCTCCCCTTGG - Intergenic
1064229588 10:13518278-13518300 AGCCTGCAGCCTGCTCGCCACGG - Intronic
1065506851 10:26438223-26438245 CGCCTGCAGCCCGCCCTCAGGGG - Exonic
1066065714 10:31759738-31759760 CGCCTAGAGCCCCCGCCCCTGGG - Intergenic
1067694331 10:48524143-48524165 CGCCTGCCGCCTGCGCCCCGGGG + Intronic
1067716012 10:48691510-48691532 CTCCAGCAGCCCGCTACGCTGGG - Intronic
1069592289 10:69649714-69649736 TGCCTTCAGCTGGCTCCCCTCGG + Intergenic
1069777881 10:70937385-70937407 CAGCTGCCGCCCACTCCCCTTGG - Intergenic
1069904554 10:71724698-71724720 CCCCAGCAGCACGCTCCCCAGGG + Intronic
1072548217 10:96456877-96456899 TGCCTCCAGCAAGCTCCCCTGGG - Intronic
1072553211 10:96494481-96494503 GGCCTGCAGGCCACTCTCCTCGG - Intronic
1073331247 10:102671160-102671182 GGCCAGCAGCCCCCTCCCTTCGG - Intergenic
1073871217 10:107866611-107866633 CTCCTGCTGCCCTATCCCCTGGG + Intergenic
1073930122 10:108566365-108566387 CCCCTGCAGCCCGCCTCCCTGGG + Intergenic
1076006140 10:126949244-126949266 CTCCTGCAGCCCTCTCCCTGTGG + Intronic
1076024704 10:127101694-127101716 CACCTGCTGCTGGCTCCCCTTGG - Intronic
1076553806 10:131308238-131308260 TGCCTCCAGGCCGCTCCCCACGG - Exonic
1076767763 10:132646005-132646027 CGCCGGCACCCCACACCCCTGGG - Intronic
1076878628 10:133229653-133229675 CGTCTGCAGCCAGCATCCCTGGG - Intergenic
1077215058 11:1391749-1391771 CTCCTGCATCCTGCTGCCCTGGG - Intronic
1077216559 11:1397566-1397588 AGCCTGCAGCCCAGGCCCCTGGG - Intronic
1077283269 11:1754875-1754897 TGGCTGCAGTCGGCTCCCCTGGG - Intronic
1077361088 11:2140402-2140424 CGCCGGCGGCCCCTTCCCCTTGG - Intronic
1077377317 11:2211125-2211147 TGCCTGCAGCCCGCTCACTGAGG - Intergenic
1077419563 11:2444228-2444250 CGCCCGCAGCTCGCGCGCCTGGG + Intergenic
1080651032 11:34222892-34222914 AGCCTGCAGCAAGCTCTCCTGGG + Intronic
1081992163 11:47343658-47343680 CGCCCGCACCCTGCTCCCCCAGG + Intronic
1083446145 11:62709070-62709092 CGCGTCCTGCCCGCTTCCCTCGG + Exonic
1083553223 11:63606612-63606634 CGCCTCCAGCTCGCTGCTCTGGG - Intronic
1083733954 11:64669092-64669114 CACCTGCAGCCCTCTCTGCTGGG + Intronic
1083997070 11:66278005-66278027 CCCCGGCACCCCGCACCCCTCGG - Intergenic
1084009557 11:66340041-66340063 CCCCTCCAACCCCCTCCCCTGGG + Intronic
1084576008 11:69988350-69988372 CGCCTGCAGCCCTGTGCCCTCGG + Intergenic
1085417786 11:76330745-76330767 CCGCTGCAGCCCGGACCCCTGGG + Intergenic
1087038216 11:93774293-93774315 CTCCTGCAGCCTGCTGCCCTGGG - Intronic
1087076130 11:94128767-94128789 CGGCTGCATTCCGCGCCCCTCGG - Intergenic
1089584724 11:119502958-119502980 CACCTGCAGGCCCCACCCCTCGG - Intergenic
1089747278 11:120626221-120626243 CCACTGAAGCCCCCTCCCCTGGG - Intronic
1092211753 12:6650963-6650985 CTCCTTCAGCCCTCTCCCTTCGG - Exonic
1092406849 12:8227498-8227520 CACCTGCAGCCAGCTGGCCTCGG - Exonic
1097141741 12:56908325-56908347 TCCCTGGAGCCCGCTGCCCTCGG + Intergenic
1101351101 12:103930449-103930471 CGCCTCCACCCCCCACCCCTGGG - Exonic
1102028032 12:109724524-109724546 CGCCAGCAGCCCACCCTCCTCGG + Intronic
1102197316 12:111034550-111034572 CGCCAGCAGCCCCCTGCCCGAGG - Intronic
1102467647 12:113139242-113139264 GTCCTGGAGCCCGCTCCCATCGG + Intergenic
1102557298 12:113735584-113735606 CTCCTGCCGGCCCCTCCCCTTGG - Intergenic
1103343337 12:120233115-120233137 TGACTGCAGCCCCCTGCCCTGGG + Intronic
1103698539 12:122835639-122835661 CGCCCGCCGCCCGCTCGCCTGGG - Exonic
1106810001 13:33350147-33350169 TGCCCGCAGCCCGCTCGCCCCGG + Intronic
1109212165 13:59547514-59547536 CACCTGCAGTCCTCTCCACTGGG + Intergenic
1109212172 13:59547539-59547561 CCCCTGCAGTCCTCTCCACTGGG + Intergenic
1112771843 13:102800646-102800668 AGCCTCCAGCCCGCGCCCCTGGG - Intronic
1112921710 13:104621547-104621569 CCACTGCATCCCGCCCCCCTGGG + Intergenic
1113600158 13:111562927-111562949 CGCCTGCACCCTCCTCCCCCAGG - Intergenic
1116653829 14:47626871-47626893 CGCCTGCACTCCGCAGCCCTTGG - Intronic
1118752246 14:68815988-68816010 CGCCTGCAGCCAGCTCCGCGGGG + Intergenic
1118779479 14:68997521-68997543 CCCCTGCATCCCACTCCCCAAGG + Intergenic
1119436792 14:74602808-74602830 TGCCTGGAGCCGTCTCCCCTTGG - Intronic
1122271157 14:100568957-100568979 CGCCGGGAGCGCGCTCCGCTCGG + Intronic
1122367196 14:101201153-101201175 CTCCAGCAGCCAGCTCTCCTGGG + Intergenic
1122780302 14:104140636-104140658 CACCTGCAGCCCTCTCCACTAGG - Intronic
1122940287 14:104978147-104978169 CGCCTGCAGCCCGCTCCCCTGGG - Intronic
1127515465 15:59689221-59689243 CGAGCGGAGCCCGCTCCCCTCGG + Exonic
1127674662 15:61228391-61228413 CGCCCGCACCCCGCTTCCTTCGG + Intronic
1128109543 15:65067905-65067927 AGCCTGCATCCCGCTCCCCTGGG - Exonic
1128113393 15:65090425-65090447 TGCCTTCAGCCTGCTCCACTGGG + Intergenic
1128706130 15:69838498-69838520 TGCCTGCACCCCTCTTCCCTAGG + Intergenic
1128787287 15:70407130-70407152 CACCTGCTTCCCGCTGCCCTGGG + Intergenic
1129481172 15:75827690-75827712 CACCCCCAGCACGCTCCCCTGGG - Intergenic
1131161605 15:90108674-90108696 TCCCTGCAGCCCCCTACCCTCGG - Intergenic
1132547225 16:538877-538899 CCCCCCCAGCCCGCTCACCTAGG + Intronic
1132987754 16:2776952-2776974 CGCCGGGTACCCGCTCCCCTCGG + Intronic
1133347519 16:5080708-5080730 CACCTGCAGCCAGCTGGCCTCGG - Intronic
1133784397 16:8963512-8963534 CGCCGGCCGCCCGCCCGCCTCGG - Intronic
1134539933 16:15056035-15056057 CGCCCGCCGCCCCCGCCCCTCGG + Exonic
1135479937 16:22814141-22814163 AGCCGGCAGCGCGCTCCGCTCGG + Intergenic
1136498115 16:30656158-30656180 CCCCTGCAGCCCGGACCCCACGG - Exonic
1138596695 16:58032954-58032976 GGCCGGCAGCCCCCTCCCCGGGG - Intronic
1139420160 16:66844869-66844891 CGCCCGCCCCCCGCTGCCCTGGG - Intronic
1141487010 16:84347173-84347195 CGCCTGCAGCCTCCCCACCTCGG - Intergenic
1143181287 17:4986042-4986064 TGCCTTCAGCCCTTTCCCCTTGG - Intronic
1143586937 17:7855048-7855070 CGCCTGGATCCCGCCCGCCTGGG - Exonic
1143591523 17:7888097-7888119 CCCCAGCAGCCGGCTCCCCCTGG - Intronic
1143630765 17:8139011-8139033 CGCCTCCAGCCGGCTCCGCCCGG + Intergenic
1143976240 17:10831973-10831995 AGCCTGCAGCCTGCTCAGCTTGG - Intronic
1143995027 17:10998810-10998832 CACCCCCAGCCCTCTCCCCTTGG - Intergenic
1144500901 17:15786340-15786362 CGCCCGAGGCCCCCTCCCCTGGG - Intergenic
1144692902 17:17280698-17280720 CGCCTCCCGCCCGCTCCCGGCGG + Intronic
1144692951 17:17280882-17280904 CGCCGGGAGCCCCCTCCCCCCGG - Intronic
1145050231 17:19654307-19654329 CGCCTGCACCCCTCAGCCCTTGG + Intronic
1145163063 17:20589002-20589024 CGCCCGAGGCCCCCTCCCCTGGG - Intergenic
1145815732 17:27793763-27793785 AGCCTGCAGCCCCCGCCCCGGGG + Intronic
1145939966 17:28738086-28738108 CCCCTGCAGGCCCCACCCCTAGG + Exonic
1146433696 17:32822731-32822753 CGCCTGCTGCCCGCCACCCGCGG - Intronic
1147210473 17:38870114-38870136 CGCCTCCCGCCAGCTCGCCTCGG + Exonic
1147890549 17:43713784-43713806 CGGCTGCAGCGCGCTCTCCGCGG + Intergenic
1147971815 17:44222237-44222259 CGCCTGCGGCCTGCTTTCCTAGG - Intergenic
1147986091 17:44308564-44308586 CTCCAGCCGCCCGCCCCCCTCGG - Exonic
1148108578 17:45132261-45132283 CGCCCGCAGCCCGGGCCTCTTGG + Exonic
1148122569 17:45221717-45221739 TCCCTCCAGCCCGCCCCCCTGGG + Intronic
1149656246 17:58310927-58310949 CTCCAGCACCCTGCTCCCCTTGG - Exonic
1150657132 17:67046636-67046658 AGCCTCCAGCCAACTCCCCTGGG + Intronic
1151408182 17:73902782-73902804 GGCCTGCCGGCCTCTCCCCTCGG + Intergenic
1151715777 17:75830371-75830393 CGCCTCCAGCCTGCTGCCCCTGG - Exonic
1152066005 17:78112857-78112879 GGCCTGCTTCCCGCTGCCCTGGG - Exonic
1152366905 17:79861655-79861677 CTCATACAGCCCCCTCCCCTGGG + Intergenic
1152504424 17:80738164-80738186 CTCCTGCTGCCTGCTCCCCCTGG - Intronic
1152640761 17:81448287-81448309 AGCCTCCTGCCCCCTCCCCTGGG - Intronic
1158498062 18:57974469-57974491 TGCCTGCATGTCGCTCCCCTTGG - Intergenic
1158618177 18:59006604-59006626 CTCCAGCTGCCAGCTCCCCTTGG - Intergenic
1160735772 19:661804-661826 TGCCTGCAGCCTCTTCCCCTGGG + Intronic
1160739304 19:678634-678656 CGCCTGCAGTCCCAGCCCCTGGG - Intronic
1160983652 19:1827781-1827803 CTCCCGCAGGCCGCCCCCCTCGG + Exonic
1161026175 19:2038426-2038448 AGCCTGCTGCCCCCTCCCCGCGG - Exonic
1161073892 19:2275778-2275800 CACCTGCGGCCCGCTCTGCTAGG + Exonic
1161306710 19:3572922-3572944 CGCCCGCAGCCCGCCCCCGTCGG - Exonic
1161401470 19:4067606-4067628 CGCCTCCACCCCGCTGCGCTAGG + Intergenic
1161456316 19:4371405-4371427 CGGCAGCAGCCAGCTCCACTCGG - Intronic
1161959546 19:7516190-7516212 CGCCGGCCGCCGGCTCCCCCCGG - Exonic
1162130122 19:8521341-8521363 CTGCTGCAGCCCCCGCCCCTGGG - Exonic
1162263121 19:9548215-9548237 CGCCTGCAGCAGGATCCACTAGG + Intergenic
1162925030 19:13926586-13926608 TGCCTACAGCCCCCTCACCTGGG - Exonic
1163662839 19:18588948-18588970 GGCATGAAGCCCGCGCCCCTGGG - Intronic
1165907647 19:39203611-39203633 CACCTGCAGCCCAGGCCCCTGGG - Intronic
1166731205 19:45060001-45060023 CGTCTGCAGCTTGCTCCCCCAGG + Intronic
1166850701 19:45759252-45759274 CGCTCACAGCCCACTCCCCTGGG - Intronic
1167141116 19:47651383-47651405 TGCCTGGAGCCCGCTCTCCTGGG + Intronic
1167346018 19:48946305-48946327 CCCCTGCAGTCCGCTGCCCGGGG + Intergenic
1167487807 19:49773318-49773340 AGCCAGCACCCCGCTCCCATTGG - Intronic
1167513026 19:49906549-49906571 CACCTGGAGCCCACTCCCCGTGG + Intronic
1167575971 19:50317602-50317624 CTCCAGCAGCCCTCTCCCCTTGG + Intronic
1168234131 19:55051301-55051323 TGCCTGCATCCCCCTTCCCTGGG - Intronic
1168273968 19:55265981-55266003 CCCCTGCAGCCCTCCCCCCAGGG - Exonic
936091480 2:109504332-109504354 GGCCTGCAGTCCTGTCCCCTCGG - Intronic
937241043 2:120462935-120462957 CGACTCCAGCCAGATCCCCTGGG - Intergenic
946191572 2:218010438-218010460 CCCCTGCTGCCCGCGCCCCGTGG - Intergenic
947749289 2:232524302-232524324 TGCCTGCAGCCCGCGATCCTGGG - Exonic
948449051 2:238057850-238057872 CGCCTGCACTCCGCAGCCCTTGG + Intronic
948716014 2:239864371-239864393 GGCCTGCATACTGCTCCCCTCGG - Intergenic
948916145 2:241035890-241035912 CGCCTGCACCCCCCACCCCATGG - Intronic
1168826962 20:820248-820270 CATCTGCAGCCCCTTCCCCTGGG - Intergenic
1169204583 20:3732631-3732653 CGCCCGCCGCCCCCTCCCCCAGG - Intergenic
1169257638 20:4111091-4111113 CGCTAGCAGCTCCCTCCCCTTGG + Intergenic
1172117931 20:32583214-32583236 GGCCTGCAGCCCCGTCCCCTGGG + Intronic
1172635427 20:36406763-36406785 GGTCTGCAGCCCACTGCCCTGGG - Intronic
1174264480 20:49321201-49321223 CCCCTCCTGCCTGCTCCCCTGGG - Intergenic
1174648038 20:52103072-52103094 GGCCTGAAGCCCACTCTCCTGGG + Intronic
1175641659 20:60635401-60635423 AGCCTGCTGCCCACACCCCTGGG - Intergenic
1175767822 20:61603385-61603407 TGTCTGCAGCCAGCTTCCCTAGG - Intronic
1175980133 20:62734558-62734580 CGCCTGCTCCTCGCTCCCCAGGG - Intronic
1177188112 21:17819671-17819693 CGCCTGCGGCCCCCGCCCCGGGG - Intergenic
1178916446 21:36708004-36708026 CGCCCGCAGCTCGCTCCGCAGGG + Intronic
1179819953 21:43930855-43930877 GGCCTGCTGCCCTGTCCCCTCGG + Intronic
1179935168 21:44599429-44599451 CCCCTGGAGCCCTCTCCCCTGGG + Intronic
1180746143 22:18090384-18090406 CAGCTACAGCTCGCTCCCCTTGG + Exonic
1180975095 22:19843915-19843937 CACCTCCACCCTGCTCCCCTAGG + Intronic
1182430962 22:30298713-30298735 CTCCTCCAGCCTGCTCCCCCAGG - Intronic
1184235920 22:43182994-43183016 TGCCTGGAGCCCGCTCTCCCTGG + Exonic
1184321551 22:43745549-43745571 TGCCCGAAGCCCCCTCCCCTTGG - Intronic
1184404561 22:44292672-44292694 GCCCTGCATCCCGCTCCCCAAGG + Intronic
1184486602 22:44783551-44783573 CTCCTGCACCCACCTCCCCTAGG + Intronic
1184957724 22:47902936-47902958 GCCCTGCAGCCTGCTTCCCTGGG + Intergenic
1185218116 22:49615183-49615205 CGCCTGCATCCCGCAGCCCTGGG - Intronic
1185227061 22:49659270-49659292 CGGCTGCAGCCCGGTGCCCCGGG - Intergenic
1185346805 22:50313972-50313994 TGCCTGCAGCCCCATGCCCTTGG + Intronic
950426842 3:12928812-12928834 GTCCTGCAGCCCTCTCCCCAGGG - Intronic
953332246 3:42063558-42063580 CGCCTGTAGCCCCGTCTCCTTGG + Intronic
954361484 3:50124973-50124995 CCCCTGCAGCCAGCGGCCCTGGG - Intergenic
955044709 3:55348875-55348897 CGCCTGCCTCCCCCTCCCCATGG + Intergenic
956462552 3:69485812-69485834 CACCTGCAGCCCACTGCCTTGGG - Intronic
959484105 3:106908296-106908318 TGCCTGCAGCCCACCACCCTGGG + Intergenic
960908282 3:122623129-122623151 TGCCTGCAGCACGTTCCCCCTGG - Intronic
962344203 3:134607809-134607831 CGTTTCCAGCCCACTCCCCTGGG - Intronic
962714483 3:138115100-138115122 GCCCTGCAGCCCGGCCCCCTCGG - Intronic
963870208 3:150408374-150408396 CGGCTGCAGCTCCCTCCGCTGGG - Exonic
964282282 3:155079856-155079878 AGCCTGGAGCCCGCGCGCCTTGG + Intronic
964720774 3:159765276-159765298 AGCCTGCCGTCTGCTCCCCTGGG + Intronic
965793326 3:172411790-172411812 CTCCCGCAGCCCGCCACCCTAGG - Intergenic
968443171 4:634610-634632 GGCCTGGAGCCCGCACCACTGGG - Intronic
968871461 4:3244851-3244873 CTCCTGCTGCCTGCTCCTCTTGG + Intronic
968994708 4:3938308-3938330 CACCTGCAGCCAGCTGGCCTCGG - Intergenic
969619161 4:8270261-8270283 CGCCTGCAGCGCGCACACGTTGG - Exonic
969694673 4:8727931-8727953 CTCCTGCAGCCCCCACCCATTGG - Intergenic
969759290 4:9170485-9170507 CACCTGCAGCCAGCTGGCCTAGG + Exonic
972312038 4:37890988-37891010 CGCCTCCAGCGCGCTCGCCCAGG + Intergenic
979310481 4:119197823-119197845 CTCCTGCAGCTCGCCCTCCTTGG - Intronic
979448503 4:120840767-120840789 CCCCTGCAGCCTGCCGCCCTAGG - Intronic
981368844 4:143935054-143935076 CATCTGCTGCCCGCTCCCTTTGG - Intergenic
985784524 5:1886953-1886975 CCGCCGCCGCCCGCTCCCCTCGG + Exonic
986173177 5:5330360-5330382 CGCATGCAGCCCGCAGGCCTCGG + Intergenic
988705985 5:33726298-33726320 CACCTGCAGCCCTCTGCCCCAGG - Intronic
989178862 5:38556664-38556686 CGCCTGCACGCCGCTCGGCTGGG + Intronic
992151568 5:73909650-73909672 CTCCTGCAGCCAGCTCTCCCTGG - Exonic
993187237 5:84635850-84635872 CGCCGGCAGCGCCCTGCCCTGGG + Intergenic
993385032 5:87252528-87252550 TCCCTGCAGCCCGCTACCTTGGG - Intergenic
995326356 5:110894021-110894043 CGCCTGCACTCCGCAGCCCTTGG + Intergenic
997423387 5:133786611-133786633 TCCCTGCATCCCTCTCCCCTGGG - Intergenic
997778278 5:136630845-136630867 GGCCTGCAGGCTGCTCCCCTGGG + Intergenic
999129481 5:149271932-149271954 GCCCTGCGGCCCGCTCCCCGGGG + Exonic
999322577 5:150624648-150624670 CTCCTGCTGCCTGCTCCCCGGGG - Intronic
1000016428 5:157281910-157281932 CATCTGCAGCCCCCTCTCCTGGG + Intronic
1001570081 5:172725154-172725176 CACCTGCAGCCCTCTTCCTTTGG - Intergenic
1002576495 5:180177038-180177060 CGTCTGCAGCCCTCTCCTCTGGG - Intronic
1003552366 6:7109585-7109607 CGCGTGCAGCTCGCGCCCCTCGG + Intronic
1003974273 6:11328064-11328086 GGCCTGCTGCCTGCTCCCATGGG + Intronic
1006150314 6:31983510-31983532 AGCCAGCAGCCTGCTTCCCTGGG - Intronic
1006156615 6:32016248-32016270 AGCCAGCAGCCTGCTTCCCTGGG - Intronic
1006193345 6:32222696-32222718 GCCCTGCTTCCCGCTCCCCTAGG - Exonic
1007644441 6:43369487-43369509 CGGGAGCAGCCCCCTCCCCTCGG + Intergenic
1009800779 6:68533757-68533779 CGCCTGCACCCCTCAGCCCTTGG - Intergenic
1013048757 6:106512107-106512129 CGCCCGCAGCCAGCCCCCCAAGG + Exonic
1017969409 6:159298802-159298824 AGCCTCCCTCCCGCTCCCCTGGG + Intergenic
1019005877 6:168795835-168795857 CGCCTGCAGCTGGCTCTTCTGGG + Intergenic
1019005951 6:168796192-168796214 CGCCTGCAGCTGGCTCTTCTGGG + Intergenic
1019054527 6:169213698-169213720 GGCCCGCAGCTCACTCCCCTGGG + Intergenic
1019174135 6:170151443-170151465 CCTCTGCCGCCCGCTCCTCTAGG - Intergenic
1019325492 7:436363-436385 CTCCTGCCGCCCCCGCCCCTTGG - Intergenic
1019487751 7:1297069-1297091 CCCCTGCACCCCGCGCACCTGGG - Intergenic
1019734947 7:2645969-2645991 TGCCGGCAGCCCCCTCCCCAGGG + Intronic
1020279826 7:6644438-6644460 CGGCTGCAGGCGGCTCCCGTGGG - Intronic
1024356285 7:48416661-48416683 CGCCTGCAGGAGGCTTCCCTTGG - Intronic
1025739087 7:64182166-64182188 CGGCTGCGGCCCGCGCCGCTGGG - Intronic
1027261241 7:76465974-76465996 CCTCCGCAGCCCGCTCCCCCAGG - Intronic
1027312625 7:76964082-76964104 CCTCCGCAGCCCGCTCCCCCAGG - Intergenic
1027960540 7:84940116-84940138 GGCCAGCAGCCCAGTCCCCTAGG + Intergenic
1029238774 7:99143919-99143941 CGCCTGCCGCCCGGACGCCTGGG - Exonic
1029540617 7:101180086-101180108 CGCCCGCCGCCCGCCCCGCTTGG - Exonic
1029640305 7:101816122-101816144 CGCCCGCAGCCCCCACCCCCGGG - Intronic
1029896615 7:103990102-103990124 CGGCTGCGTCCCGCGCCCCTCGG + Intergenic
1033644270 7:143288600-143288622 GCCCTGCAGCCCCCTCCCCTCGG + Intronic
1034426996 7:151019182-151019204 GGCCCGCTGCCCGCTGCCCTGGG - Exonic
1034480948 7:151320361-151320383 TCCCTGCAGCCTGCTGCCCTAGG + Intergenic
1035239433 7:157520257-157520279 CGCCTGGGGCCCTCTCCCCCAGG - Intergenic
1035387624 7:158484917-158484939 CTCCTGCAGCCGACTCCCCGTGG - Intronic
1035648014 8:1243223-1243245 AGCCTGCAGGCCCCTGCCCTGGG + Intergenic
1036381435 8:8238516-8238538 CACCTGCAGCCAGCTGGCCTCGG + Intergenic
1036803291 8:11808668-11808690 AGCCTGCCGCCCTCTCCCCGAGG - Intronic
1036847226 8:12178476-12178498 CACCTGCAGCCAGCTGGCCTCGG - Intergenic
1036868593 8:12420797-12420819 CACCTGCAGCCAGCTGGCCTCGG - Intergenic
1038227507 8:25670556-25670578 CGCCTCCACCCCGCCCACCTGGG - Intergenic
1042004773 8:64168821-64168843 CCCCTGGAGCCCACTGCCCTGGG + Intergenic
1044605004 8:94040752-94040774 CGCCTGAAGTCCCCTCCCCAGGG + Intergenic
1048304991 8:133278029-133278051 TGCCAGCAAGCCGCTCCCCTGGG + Intronic
1049166275 8:141128263-141128285 CGCCGGCCGCCCGCTCCCTGGGG - Intronic
1056699764 9:88892502-88892524 CTGCTCCAGGCCGCTCCCCTGGG - Intergenic
1058581892 9:106467448-106467470 AGCTTGGAGCCCCCTCCCCTTGG + Intergenic
1058898433 9:109420302-109420324 TGCCTGCAGCCAGCTCCCACAGG - Intronic
1060991951 9:127854452-127854474 CTCCGGCCGCCTGCTCCCCTCGG - Exonic
1061312922 9:129775670-129775692 TGCATGCAGCCCCCTCCCCAGGG - Intergenic
1061828079 9:133274400-133274422 GGCCTGCAGCCTGCACCCCGTGG + Intronic
1061919841 9:133776672-133776694 CCCCTGCCGCCTGGTCCCCTTGG + Intronic
1062041047 9:134404448-134404470 TGGCTGCAGCCGGCTCACCTGGG + Intronic
1062385895 9:136311398-136311420 CTCCTCCATCCAGCTCCCCTGGG - Intergenic
1062391068 9:136334074-136334096 CCCCTGCAGCCCGTACCTCTGGG + Intronic
1062476048 9:136728044-136728066 GGCCAGCAGCCCAGTCCCCTAGG + Intergenic
1062567418 9:137169453-137169475 CGCCTGGAGCCCGCGGCGCTAGG - Exonic
1192081098 X:68048719-68048741 GGTCTGCAGCCAGCTTCCCTGGG - Intronic
1192455283 X:71270774-71270796 CACCTGCAGGACCCTCCCCTTGG + Intergenic
1196824679 X:119731810-119731832 AGCCTGCTGACAGCTCCCCTTGG - Intergenic
1200065844 X:153503758-153503780 TGGCGGCAGCCTGCTCCCCTGGG + Intronic