ID: 1122941087

View in Genome Browser
Species Human (GRCh38)
Location 14:104981721-104981743
Sequence CCGCAGCCTGCCTGTTTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122941087_1122941091 -7 Left 1122941087 14:104981721-104981743 CCCCACAAACAGGCAGGCTGCGG No data
Right 1122941091 14:104981737-104981759 GCTGCGGCTATGTGCAGTTGAGG No data
1122941087_1122941093 7 Left 1122941087 14:104981721-104981743 CCCCACAAACAGGCAGGCTGCGG No data
Right 1122941093 14:104981751-104981773 CAGTTGAGGACTGGCTCCCCAGG No data
1122941087_1122941092 -2 Left 1122941087 14:104981721-104981743 CCCCACAAACAGGCAGGCTGCGG No data
Right 1122941092 14:104981742-104981764 GGCTATGTGCAGTTGAGGACTGG No data
1122941087_1122941094 8 Left 1122941087 14:104981721-104981743 CCCCACAAACAGGCAGGCTGCGG No data
Right 1122941094 14:104981752-104981774 AGTTGAGGACTGGCTCCCCAGGG No data
1122941087_1122941095 9 Left 1122941087 14:104981721-104981743 CCCCACAAACAGGCAGGCTGCGG No data
Right 1122941095 14:104981753-104981775 GTTGAGGACTGGCTCCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122941087 Original CRISPR CCGCAGCCTGCCTGTTTGTG GGG (reversed) Intergenic
No off target data available for this crispr