ID: 1122941988

View in Genome Browser
Species Human (GRCh38)
Location 14:104985650-104985672
Sequence CAGCGGAGGCGGCCCGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 633
Summary {0: 1, 1: 0, 2: 5, 3: 69, 4: 558}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122941979_1122941988 -10 Left 1122941979 14:104985637-104985659 CCGATCCCACCCGCAGCGGAGGC 0: 1
1: 0
2: 0
3: 9
4: 146
Right 1122941988 14:104985650-104985672 CAGCGGAGGCGGCCCGGGGCAGG 0: 1
1: 0
2: 5
3: 69
4: 558
1122941970_1122941988 22 Left 1122941970 14:104985605-104985627 CCCGGCGCCCAGGGCTCGGCCAG 0: 1
1: 0
2: 3
3: 34
4: 325
Right 1122941988 14:104985650-104985672 CAGCGGAGGCGGCCCGGGGCAGG 0: 1
1: 0
2: 5
3: 69
4: 558
1122941975_1122941988 3 Left 1122941975 14:104985624-104985646 CCAGTGTGGAAGCCCGATCCCAC 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1122941988 14:104985650-104985672 CAGCGGAGGCGGCCCGGGGCAGG 0: 1
1: 0
2: 5
3: 69
4: 558
1122941973_1122941988 15 Left 1122941973 14:104985612-104985634 CCCAGGGCTCGGCCAGTGTGGAA 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1122941988 14:104985650-104985672 CAGCGGAGGCGGCCCGGGGCAGG 0: 1
1: 0
2: 5
3: 69
4: 558
1122941974_1122941988 14 Left 1122941974 14:104985613-104985635 CCAGGGCTCGGCCAGTGTGGAAG 0: 1
1: 0
2: 1
3: 25
4: 632
Right 1122941988 14:104985650-104985672 CAGCGGAGGCGGCCCGGGGCAGG 0: 1
1: 0
2: 5
3: 69
4: 558
1122941977_1122941988 -9 Left 1122941977 14:104985636-104985658 CCCGATCCCACCCGCAGCGGAGG 0: 1
1: 0
2: 1
3: 5
4: 109
Right 1122941988 14:104985650-104985672 CAGCGGAGGCGGCCCGGGGCAGG 0: 1
1: 0
2: 5
3: 69
4: 558
1122941971_1122941988 21 Left 1122941971 14:104985606-104985628 CCGGCGCCCAGGGCTCGGCCAGT 0: 1
1: 0
2: 1
3: 16
4: 194
Right 1122941988 14:104985650-104985672 CAGCGGAGGCGGCCCGGGGCAGG 0: 1
1: 0
2: 5
3: 69
4: 558

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122941988 Original CRISPR CAGCGGAGGCGGCCCGGGGC AGG Intergenic
900086613 1:901296-901318 CAGTGGAGGTGGGCAGGGGCTGG + Intergenic
900161966 1:1228120-1228142 CTGCGGAGGCTGCCCGTGGCCGG + Intronic
900342972 1:2197381-2197403 CAGCGCAGGTGTCCCGGGTCTGG - Intronic
900374660 1:2347981-2348003 CAGCACAGCCGTCCCGGGGCAGG + Intronic
900393485 1:2443793-2443815 CAGCTCGGGCGGCCCGCGGCGGG - Intronic
900555108 1:3276437-3276459 CAGCAGAGGCAGCTCAGGGCCGG - Intronic
900564922 1:3327490-3327512 CAACGGCGGCGGCCCCGGGCAGG + Intronic
900645255 1:3706114-3706136 AGGCGGAGGCGGGCCGGGGGCGG - Intronic
900663090 1:3795837-3795859 CAGCGGGGGCTGCCCGGGCGGGG - Intronic
900671319 1:3856851-3856873 CTGCGGCGCCGGCCCAGGGCCGG - Intronic
900736667 1:4303478-4303500 CTGCGGAGGCTGCCGGGCGCTGG + Intergenic
901021583 1:6258723-6258745 CAGCCGAGGCTGCCTTGGGCAGG - Intronic
901054042 1:6440466-6440488 CAGGGGAGGCGGGGCGGAGCCGG + Intronic
901183671 1:7358553-7358575 CAGCCGGGGCTGCCCGGGGCAGG - Intronic
901207158 1:7503858-7503880 CAGCGGAGGTGGCTCAGAGCCGG - Intronic
901443533 1:9293310-9293332 CAGCGGCGGCAGCGCGGGGCGGG - Intronic
901627285 1:10631454-10631476 GAGCGGGGGCGGCCCGGGCCTGG - Intergenic
901696545 1:11012297-11012319 CAGCGAGGGCGGGGCGGGGCGGG - Intergenic
901724598 1:11230961-11230983 CAGCAGAGGCATCCCGGGACTGG + Exonic
901818121 1:11806359-11806381 CGGCGGAGTCGGCCTGGGGAGGG + Intronic
902169582 1:14599120-14599142 CGGCGGCGGCGGCCCCGGCCCGG + Exonic
902600874 1:17539657-17539679 CAGCCGCGGCGCCCCGGGACCGG + Intergenic
903324834 1:22563735-22563757 CGGCGGCGGCGGGGCGGGGCAGG + Intronic
903822114 1:26111177-26111199 CGGCGGCGGCGGCGCGGGGCTGG - Intronic
903888496 1:26554954-26554976 CAGCGGTGGGGGCGCGAGGCTGG - Intronic
905449148 1:38046188-38046210 GGGCGGTGGCGGCGCGGGGCCGG - Exonic
905449324 1:38046756-38046778 CGGCGGCGGCGGCGCGGCGCAGG - Exonic
905800217 1:40838248-40838270 GAGGGGACGCGGCCGGGGGCGGG - Intronic
906109175 1:43312059-43312081 CAGCTGAGCCGGCCAGGGGAAGG + Exonic
906318021 1:44800534-44800556 ACTCGGAGGCGGCCCGGGCCCGG - Exonic
907012631 1:50977929-50977951 CAGCGAAGGAGGCCAGTGGCCGG + Intergenic
907051054 1:51330281-51330303 CGGCGGCGGCTGCCAGGGGCCGG + Intronic
907884066 1:58577121-58577143 CAGCGGTGGCGGCGCGAGGCCGG + Exonic
907920014 1:58903661-58903683 CAGTGGCGGCGGGGCGGGGCAGG + Intergenic
908534755 1:65067148-65067170 CGGGGGCGGCGGCGCGGGGCGGG - Intergenic
908714285 1:67053743-67053765 CGGCGGCGGCGGCGCGGCGCCGG - Intronic
908836085 1:68231282-68231304 CAGGGGAGGTCTCCCGGGGCGGG + Intronic
912851764 1:113132412-113132434 CTGCAGGGGCGGCCAGGGGCAGG - Intergenic
913300769 1:117367054-117367076 CACCGGAGGCGGCGCGGAGGAGG + Intergenic
914797922 1:150937304-150937326 CAGTGGTGGCTGCCAGGGGCTGG + Intronic
915318193 1:155041509-155041531 CAGGGGAGACAGCCCAGGGCAGG + Exonic
915487013 1:156228600-156228622 CAGCGGATAGGGCCCAGGGCAGG - Intronic
916063444 1:161117972-161117994 CAGCGGGAGCGGCGCGGGGAAGG - Exonic
916588308 1:166166632-166166654 CAGCGGCGGCGGCATGGAGCCGG + Exonic
920054548 1:203182700-203182722 CTGGGGAGGCTGCCTGGGGCAGG + Intronic
921089599 1:211830513-211830535 CAGCGGAGCCGGGCCAGGGGAGG - Intronic
921132134 1:212228941-212228963 CAGCAGGGGCGGACCGGGGAGGG + Intergenic
922959962 1:229637921-229637943 CAGTGCCGGGGGCCCGGGGCTGG + Exonic
923354984 1:233145646-233145668 TACCGGAGGCTGCCAGGGGCAGG + Intronic
1063662477 10:8043863-8043885 CAGCGGAGGCGCACAGGGGTTGG + Intergenic
1065025314 10:21534890-21534912 CCGCGGCCGCGGCACGGGGCGGG - Intronic
1065288693 10:24209097-24209119 CCTGGGAGGGGGCCCGGGGCTGG - Intronic
1065726990 10:28676986-28677008 CGGGGGAGGCGGCCCAGCGCTGG - Intergenic
1066022567 10:31318827-31318849 CCGCCGCGGCTGCCCGGGGCAGG - Intronic
1067084257 10:43229756-43229778 CAGCGGAGGCGTCCAGCGGCAGG - Intronic
1069583016 10:69577929-69577951 TAGGGGAGGCGGCCCTGAGCAGG - Intergenic
1069808067 10:71138305-71138327 CAGCGGAGGTGGCCCGGCAGAGG - Intergenic
1069819268 10:71217530-71217552 CGGCTGAGGCGGCTCCGGGCCGG - Intronic
1070151995 10:73811102-73811124 GCGCCGAGGGGGCCCGGGGCTGG + Intronic
1070152284 10:73812020-73812042 CTGCGCAGGCGACGCGGGGCGGG - Intergenic
1070198104 10:74177195-74177217 CCCCGGGGGCGGCCCAGGGCCGG + Intronic
1070637444 10:78140551-78140573 CAGGGGATGAGGCCAGGGGCAGG - Intergenic
1071997448 10:91162625-91162647 CCGCGGCGGCTGCCCCGGGCGGG - Intergenic
1072727842 10:97825522-97825544 CAGTGGGGCCGGCCAGGGGCAGG + Intergenic
1072916645 10:99540920-99540942 CAGCGCAGGTGCCACGGGGCGGG + Intergenic
1073325739 10:102643407-102643429 CCGCGGCGGCGGCCGGGGTCTGG - Intergenic
1073812352 10:107164655-107164677 GGGCGGAGGCGGCGCCGGGCAGG + Intergenic
1074182848 10:111078569-111078591 CGGCGGCGGCGGCCCGCAGCCGG + Exonic
1074377435 10:112951435-112951457 CAGCGGCGGCCGCGCGGAGCGGG - Intronic
1074562297 10:114545125-114545147 CTGAGGAGGTGGCCAGGGGCTGG + Intronic
1074865457 10:117542240-117542262 CAGCGGAGGCGGCGCCGGCCAGG + Intergenic
1076035646 10:127196613-127196635 GGGCGGGGGCGGCGCGGGGCCGG + Intronic
1076836319 10:133022862-133022884 CAGCCGCGGCGGCTCTGGGCCGG + Intergenic
1076866252 10:133167820-133167842 GAGCGGAGGGGGCTCAGGGCGGG - Intronic
1076893279 10:133295649-133295671 CTGCGGAGGCGGCGCTGGCCAGG + Intronic
1077008299 11:369344-369366 GAGGGGAGGCGGGGCGGGGCGGG - Intergenic
1077008449 11:369720-369742 CCGGGGATGCGGCGCGGGGCGGG + Intergenic
1077046814 11:550331-550353 CAGAGGAGGGGCCCCGGGGCTGG - Intronic
1077076908 11:706158-706180 CGGCGGGGCCGGGCCGGGGCGGG - Exonic
1077141345 11:1026252-1026274 AGGCGGAGGCTGCCCGGGGTGGG - Intronic
1077144054 11:1036980-1037002 CAGCGGGGAGGGCCCGGGCCAGG - Intergenic
1077222412 11:1423658-1423680 CAGCGGGGGAGGCTTGGGGCAGG - Intronic
1077476301 11:2792054-2792076 CAGCGGACGCGGAACGGGGTGGG - Intronic
1078091765 11:8268509-8268531 CAGCGCAGGCGGCCGGCGGCGGG - Intronic
1078222699 11:9364653-9364675 CGGCGGGGGCCGCACGGGGCTGG + Intergenic
1078315947 11:10293772-10293794 CAGCGGGTGCGCCCAGGGGCTGG + Intronic
1078316123 11:10294365-10294387 CCGCGGTGGCGGCGCGTGGCGGG - Intergenic
1078771794 11:14358710-14358732 GAGCGGCGGCGGGCGGGGGCTGG - Intronic
1078934668 11:15940525-15940547 CAGAGGAGGTGGCATGGGGCTGG + Intergenic
1079296907 11:19241954-19241976 CAGGTGAGCCGGCCTGGGGCTGG - Intergenic
1079996910 11:27304890-27304912 GAGCCGAGGCGGCAGGGGGCTGG - Intergenic
1080836258 11:35943951-35943973 TAGCGGAGCCGGGCCGGGGCCGG + Intergenic
1081845600 11:46238353-46238375 GGGCGGAGGCGGCGCGGCGCGGG + Intergenic
1082003700 11:47408537-47408559 CGCCGGGGGCGGCCCCGGGCCGG + Intronic
1083258151 11:61508966-61508988 CAGTGGCGGCGGCCCCGGCCGGG + Exonic
1083457171 11:62786942-62786964 CGGCGGAGGCGGCCCCGCGTCGG + Exonic
1083656982 11:64234565-64234587 CGGCGGGGGCGGCGGGGGGCTGG - Exonic
1083673651 11:64313906-64313928 CAGTGGCGGCCTCCCGGGGCTGG - Intronic
1083730194 11:64648657-64648679 CTGCAGAGGCAGACCGGGGCAGG - Intronic
1083753865 11:64778564-64778586 CCGCGGGGGCGGGCCGGGGGCGG + Intronic
1083780972 11:64917147-64917169 AAGCGGAGGCGGCCCAGGCCCGG - Exonic
1083880554 11:65546404-65546426 GGGCGGCGGAGGCCCGGGGCGGG + Intronic
1083880865 11:65547654-65547676 GGGCGGAGGCGGCCCTGGGTGGG - Intronic
1083902992 11:65652687-65652709 CCGGGGGGGCGGCCAGGGGCGGG - Intergenic
1084325111 11:68395767-68395789 CATCCGAGGTGTCCCGGGGCAGG - Intronic
1084892799 11:72244605-72244627 CTGCGGAGGCGGCCCAGGAAGGG + Intronic
1085121038 11:73967823-73967845 CAGAGGAGGCTGCCCAGAGCGGG - Intronic
1088645518 11:111913493-111913515 CAGCTGGGGCGGCCCGAGGCCGG - Exonic
1089496382 11:118910408-118910430 CCGTGGAGGGGGCCCGGGGTTGG + Exonic
1089800613 11:121024158-121024180 AAGCGGCGCCGGGCCGGGGCTGG + Exonic
1091558727 12:1594589-1594611 GAGTGCGGGCGGCCCGGGGCTGG - Intronic
1094477706 12:30853943-30853965 CAGCGGAGGTGGACCCGGCCCGG - Intergenic
1095476211 12:42589650-42589672 CAGCGCAGGCTGCGCGAGGCTGG + Exonic
1095773633 12:45990083-45990105 AGGCGGCGGCGGCCCAGGGCCGG + Intronic
1096214489 12:49791904-49791926 CAGCGGGGGCCCCCCAGGGCTGG - Exonic
1096495449 12:52037135-52037157 CGGGGGAGGCGCGCCGGGGCTGG + Intronic
1097990373 12:65826013-65826035 CGCCGGAGGGAGCCCGGGGCAGG + Intronic
1098255433 12:68611081-68611103 CGGCGGCGGCCGCGCGGGGCCGG + Intronic
1102040714 12:109798941-109798963 CAGCGAAGGGGGCCCAGGGTGGG + Intronic
1102238624 12:111310152-111310174 CAGCAGGGGCTGCCCGGGGCTGG - Exonic
1103120085 12:118372862-118372884 CAGCGGCGGCGGCCGCGGGAGGG - Exonic
1103348359 12:120265778-120265800 CACAGGGGGCGGCCGGGGGCGGG - Intergenic
1104049346 12:125185777-125185799 CAGCGAAGGCGGCCTGGGGATGG - Intergenic
1104903795 12:132203100-132203122 CAGTTGAGGCTGCCCGGGGCTGG + Intronic
1105405319 13:20128176-20128198 CAGCGGGGCCGGCCAGGGCCCGG + Intergenic
1105411305 13:20174049-20174071 CAGCCGAAGCTGCCTGGGGCAGG - Intergenic
1105745444 13:23373609-23373631 GATGGGAGGCGGCGCGGGGCGGG - Intronic
1106304095 13:28495045-28495067 CAGCGGCGGCGGCTCGGAGCGGG - Exonic
1106311633 13:28559800-28559822 GAGCGGTGGTGGCCAGGGGCTGG - Intergenic
1107123496 13:36819726-36819748 CAGCGGGGGCGCCCGGAGGCGGG + Exonic
1111396305 13:87672635-87672657 CCGCGGCGGCGGCCCCAGGCTGG + Exonic
1111951252 13:94711297-94711319 CGGCGGCTGCAGCCCGGGGCTGG + Exonic
1112208269 13:97347107-97347129 CTGCGGAGGCCGCTCCGGGCTGG + Intronic
1112308306 13:98295312-98295334 CAGCAGAGGGAGCCCTGGGCAGG + Intronic
1112591043 13:100763219-100763241 CAGGGGAGGTGGCCCAGGCCTGG + Intergenic
1113784843 13:112997024-112997046 AGGCGAGGGCGGCCCGGGGCTGG - Intronic
1113795025 13:113051818-113051840 CAGCGGGGGCAGCCCTGGGCTGG - Intronic
1114269221 14:21091016-21091038 CTCCGGGGGTGGCCCGGGGCCGG + Exonic
1114865993 14:26597135-26597157 CAGGGGAGGGGGCGCGGGGCAGG + Intronic
1115217293 14:31026143-31026165 CGGTGGTGGCGGCCCGGGGATGG - Exonic
1115651312 14:35404393-35404415 AAGTGGCGGAGGCCCGGGGCTGG - Intronic
1116018229 14:39432008-39432030 CTGCGGGGGCGGCCGGGAGCCGG - Exonic
1118213609 14:63788059-63788081 CAGCAGAGGCGGCAGAGGGCTGG + Intergenic
1118776985 14:68979331-68979353 GAGCCGAGGCGGGCGGGGGCGGG + Intronic
1118992605 14:70809617-70809639 CAGCGGGCGCGGGGCGGGGCGGG - Intergenic
1119318425 14:73714428-73714450 CCGCGGGGGCGGGACGGGGCGGG - Intergenic
1119383162 14:74241088-74241110 TCGCGGAGGCAGCCCGGGGTGGG + Intronic
1119438501 14:74612703-74612725 GAGCGGGGGTGGCGCGGGGCGGG + Intergenic
1119717491 14:76869080-76869102 CAGGTGAGGAGGCACGGGGCAGG - Intronic
1119717497 14:76869099-76869121 CAGGTGAGGAGGCACGGGGCAGG - Intronic
1119717503 14:76869118-76869140 CAGGTGAGGAGGCACGGGGCAGG - Intronic
1120914821 14:89701737-89701759 CCGCGGAGGCGGCCCGCCGCCGG - Intergenic
1121569036 14:94932693-94932715 CAGTGGTGGTTGCCCGGGGCTGG - Intergenic
1121690836 14:95876363-95876385 CAGCAGCGGCGCCGCGGGGCGGG + Intergenic
1122078007 14:99247940-99247962 CAGAGCAGGCGGTCCTGGGCTGG + Intronic
1122081578 14:99270904-99270926 CTGCGGAGCCGGCTCCGGGCCGG - Intronic
1122108797 14:99480909-99480931 CGGCGGCTGCGGCCCGGGGGCGG - Intergenic
1122226856 14:100285443-100285465 CAGCGGACGCGGCCCAGCCCCGG - Intergenic
1122275218 14:100587455-100587477 CAGCCGCGGCTGCGCGGGGCCGG - Intergenic
1122414094 14:101540584-101540606 GAGCAGAGGCTGCCGGGGGCAGG + Intergenic
1122437382 14:101709447-101709469 CAACGGAGGCAGCGTGGGGCTGG - Intergenic
1122541471 14:102499952-102499974 CAGCAGAGGCAGCCCCAGGCCGG + Exonic
1122558235 14:102592799-102592821 CGGGGGAGGGGGCGCGGGGCCGG - Exonic
1122689127 14:103523192-103523214 CCGCGGCGGCGGCGAGGGGCCGG + Intergenic
1122768175 14:104085570-104085592 CCGCGGAGGCGGGCGGGGGCAGG - Intergenic
1122904314 14:104795090-104795112 CGGCGGAGGTGCCCCGGGGTTGG - Intronic
1122941988 14:104985650-104985672 CAGCGGAGGCGGCCCGGGGCAGG + Intergenic
1123763032 15:23447039-23447061 CATGGGAGGGGGCCTGGGGCTGG + Intronic
1124392188 15:29269477-29269499 CGGCGGGGGCGGCCTGGGCCCGG + Exonic
1124652357 15:31483419-31483441 CGGCCGTGGCGGCCCGGGGCCGG - Exonic
1125538053 15:40454126-40454148 AAGCAGAGGCTGCCTGGGGCAGG - Intronic
1126112792 15:45185505-45185527 CATCTGAGTTGGCCCGGGGCAGG - Intronic
1127267698 15:57375012-57375034 GAGCAGAGGCTGCCTGGGGCAGG - Intergenic
1128243640 15:66118350-66118372 CAGTGGAGGCACCCCGGAGCAGG - Intronic
1128328337 15:66739534-66739556 GAGGGGAGGGGGCACGGGGCTGG + Intronic
1128841468 15:70854229-70854251 CGGCGGCGGCGGCGCGGGGCGGG - Intronic
1129675973 15:77632626-77632648 CGGCGGCGGCGGCTCCGGGCCGG - Intronic
1129749984 15:78055892-78055914 CAGAGCAGGCGACGCGGGGCTGG + Intronic
1132099874 15:99015433-99015455 CAGCCGAGGCGTCCCGGCGCAGG - Intergenic
1132353572 15:101155448-101155470 GAGTGGAGGCTGCCCGGGGCTGG - Intergenic
1132464713 16:72281-72303 CCGCGGAGGCGGCCCAGCCCCGG - Intronic
1132498659 16:275382-275404 CAGGTGAGGCGCGCCGGGGCGGG - Exonic
1132519746 16:381719-381741 CGGCGGAGGCAGGCGGGGGCCGG + Exonic
1132604583 16:788422-788444 CGGCGGGGGCGGGCCGGGGGCGG - Intergenic
1132728998 16:1351551-1351573 CGGCGAGGGCGGCCCGGGCCCGG - Exonic
1132843553 16:1990019-1990041 CAGCGGCAGCGGCCTCGGGCGGG + Exonic
1133156447 16:3880130-3880152 CGGCGGCGGCGGCCGGGGGCGGG - Exonic
1133190497 16:4130271-4130293 CAGCGGAGGAGGCAAGGAGCAGG - Intergenic
1134172081 16:11976762-11976784 CAGCGGCGGCGGCGCGGCGCAGG + Exonic
1135429852 16:22374174-22374196 CAGCGGGGGCCTCCCGGGCCAGG + Intronic
1136237761 16:28925102-28925124 CGGCGGCGGCGGCCGGGGGCTGG - Exonic
1136398872 16:30007125-30007147 CAGGGGAGGGGGCCCTGGGGAGG - Intronic
1136428223 16:30183264-30183286 CGGCGCAGCCGGGCCGGGGCGGG + Intronic
1136522482 16:30805889-30805911 AAGCCCAGGCGGCCCGAGGCTGG + Intergenic
1137618236 16:49858960-49858982 TAGCAGAGGCAGCCCGCGGCGGG - Intergenic
1137926668 16:52547196-52547218 GAGCGGCGGCGGCGCGGGGAGGG - Intronic
1138370862 16:56525257-56525279 CAGAGCAGGCGGAACGGGGCTGG + Intergenic
1138497947 16:57419648-57419670 CAGGGGAAGCAGCCCGGGTCTGG - Intergenic
1138657333 16:58499045-58499067 CAGAGGAGGGGGCCCAAGGCTGG - Intronic
1139364837 16:66427053-66427075 CCGCCGAGGGGGGCCGGGGCCGG + Intergenic
1139471079 16:67178518-67178540 GAGGGGAGGCGGCGCTGGGCGGG + Intronic
1140223113 16:73058195-73058217 CGGCGGCGGCGGCGCGGGGCCGG + Intronic
1141254329 16:82386566-82386588 CAGGGGAGGCTGCCTGGGGGAGG + Intergenic
1141513507 16:84527575-84527597 CAGCGAGGGGGGGCCGGGGCGGG + Intronic
1141592583 16:85078434-85078456 CAGGAGAAGCGGCCCAGGGCTGG + Exonic
1142070797 16:88090522-88090544 CTGGGGAGCCGGCCCGTGGCTGG + Intronic
1142240184 16:88941392-88941414 CAGCGGCGGCGGCGGGGGGCAGG - Intronic
1142417205 16:89949178-89949200 CAGCGGCGGCGTCCCCGGGGTGG - Intronic
1142806194 17:2372422-2372444 CCGCGGAGGCCCCCGGGGGCCGG - Exonic
1143135607 17:4710773-4710795 CATGGGCGGCGGCTCGGGGCGGG + Intronic
1143202514 17:5122563-5122585 CTGGGGAGGGGGCCCAGGGCTGG - Intronic
1143289846 17:5820419-5820441 CAGACGAGGCGGCCTGGAGCTGG - Intronic
1143390519 17:6556688-6556710 CGGCGGCCACGGCCCGGGGCGGG - Intergenic
1143527665 17:7481927-7481949 CAGCCCAGGCGACCTGGGGCAGG - Intronic
1143785305 17:9251253-9251275 CAGAGGAGGCAGGGCGGGGCTGG - Intronic
1143830207 17:9645388-9645410 CAGCGGGGGCGGCACCAGGCAGG + Intronic
1144786877 17:17836944-17836966 CCTCAGAGGCGGCCCGGCGCCGG + Exonic
1144847105 17:18225764-18225786 GTGCGGCGGCGGCCCGGGCCCGG + Intronic
1144953185 17:19004747-19004769 CTGCGGCGGCGGCGCGAGGCTGG + Exonic
1145128395 17:20320544-20320566 CAGCGGCTGCGGCACAGGGCGGG + Intergenic
1145196217 17:20896670-20896692 CAGCGGCTGCGGCACAGGGCGGG - Intergenic
1145321530 17:21769989-21770011 CAGGGGAGGGCGCCCGGGGTGGG + Intergenic
1145904337 17:28508015-28508037 CAGCGCGGGCGGGGCGGGGCTGG - Intronic
1145941216 17:28744278-28744300 CAGCGGGGGCGGGGCGGGGCGGG + Intronic
1146283525 17:31559775-31559797 GAGCCGAGGCGGCCCGGGGGTGG + Intergenic
1146492356 17:33292138-33292160 CAGCGGCGGCGGCCCCGGCCGGG + Exonic
1146912979 17:36659911-36659933 CAGAGGAGGCTGTCAGGGGCGGG + Intergenic
1146924038 17:36731907-36731929 CAGCGGAGGCGGGGCTGCGCTGG - Intergenic
1147138955 17:38451067-38451089 TGGCGGAGGGGGCCCAGGGCTGG - Intronic
1147186600 17:38716581-38716603 CAGGGGAGGGCGCCCGGGCCCGG - Exonic
1147285687 17:39401408-39401430 CGGCGGGTGCGGCCCGGGCCGGG + Exonic
1147939471 17:44036127-44036149 CAGCGGAGGCAGGCCGGGGGAGG - Exonic
1147957696 17:44146023-44146045 CAGTGGGGGCTGCCGGGGGCAGG - Intronic
1148084909 17:44988106-44988128 CAGCGGAGGGGTCCCTAGGCAGG - Intergenic
1148161792 17:45454323-45454345 CAGCAGAGGCTGCCTTGGGCAGG - Intronic
1148334463 17:46832276-46832298 CAGCTCAGCCGGCCCGGGGTGGG - Intronic
1148878607 17:50707821-50707843 CAGCAGGGGCGGCCCGCGGGAGG - Exonic
1149038251 17:52158448-52158470 CGGCGGAGGCTGCCGGCGGCTGG - Exonic
1149614444 17:57987282-57987304 CAGCCGGGCCGGCCCGGGGCAGG - Intronic
1149849514 17:60026648-60026670 CTGGGGAGGGGGCCCAGGGCTGG + Intergenic
1149860654 17:60119876-60119898 CTGGGGAGGGGGCCCAGGGCTGG - Intergenic
1150393026 17:64800968-64800990 CAGCAGAGGCTGCCTTGGGCAGG - Intergenic
1150408026 17:64919319-64919341 CAGTGGGGGCGGCCGGGGCCGGG + Intronic
1150489015 17:65561705-65561727 CGGCGGGGGCGGGCCGGGGCGGG - Intronic
1150561919 17:66302323-66302345 CGGCGGCGGCGGCCGGGGGAGGG - Intergenic
1151558697 17:74859897-74859919 CGGCGGCGGCGGCTCCGGGCGGG + Intronic
1151761138 17:76103785-76103807 CCGCCCAGGCGTCCCGGGGCGGG - Intronic
1151959925 17:77400509-77400531 CAGCTGAGGCGGCCAGGGTTAGG + Intronic
1152024552 17:77800282-77800304 CTGCGGAGGTGGGGCGGGGCGGG + Intergenic
1152287768 17:79422492-79422514 CAGAGGAGGCAGCCTGGGCCGGG - Intronic
1152622857 17:81373906-81373928 CAGCAGAGGAGGCTCAGGGCCGG - Intergenic
1152628630 17:81399709-81399731 AAGCGGCGGCGGACCGGGGCCGG + Exonic
1152635768 17:81429939-81429961 CAGCAGAGGCAGCCCGGAGCTGG + Intronic
1152655403 17:81517153-81517175 CAGCGGGGGTGGGGCGGGGCAGG - Intronic
1153794492 18:8609746-8609768 CTGCAGAGGCGGGCCGGGGGCGG + Exonic
1153911397 18:9708745-9708767 GAGCGGAGTAAGCCCGGGGCAGG - Intronic
1153997435 18:10454521-10454543 CGGCGGCGGCTGCCCGGGGGCGG + Intergenic
1155519887 18:26657049-26657071 CAGGGGCCGCGGCCGGGGGCCGG - Intronic
1155654410 18:28177366-28177388 CAGCGCAGGCGGCTCGGCTCCGG + Exonic
1156099636 18:33578383-33578405 CGGCGGCGGCGGCGCGCGGCGGG - Intergenic
1156502203 18:37566948-37566970 CGGGGGAGGCCGCCCGGGACGGG - Intergenic
1157752938 18:50194731-50194753 CGAGGGAGGCGCCCCGGGGCCGG - Intronic
1159057075 18:63476870-63476892 CCGCCGAGGCGGGGCGGGGCGGG + Exonic
1160453267 18:78979518-78979540 CCGCGGAGGGGACGCGGGGCCGG + Intergenic
1160453694 18:78980964-78980986 CAGCGGCGGCGGCCTGGGCCTGG + Intronic
1160482768 18:79257653-79257675 CAGCAGAGACGGCCTGTGGCTGG + Intronic
1160567857 18:79798208-79798230 GGGCGGGGGCGGCTCGGGGCCGG + Intergenic
1160722345 19:603150-603172 CAGGGAAGAGGGCCCGGGGCTGG + Intronic
1160722433 19:603386-603408 CAGGGAAGAGGGCCCGGGGCTGG + Intronic
1160789740 19:917932-917954 CAGCGCGGGCGGGCCCGGGCGGG + Intronic
1160823020 19:1067113-1067135 CGGGGGGCGCGGCCCGGGGCTGG + Intronic
1160909757 19:1469111-1469133 CAGCGGTGGCGGCCCACGCCGGG - Exonic
1161057814 19:2199488-2199510 CAGCAGGGGCGCCCCGAGGCAGG - Intronic
1161153534 19:2721285-2721307 CCAGGTAGGCGGCCCGGGGCGGG - Exonic
1161289034 19:3483082-3483104 CAGAGGAGGGTGGCCGGGGCCGG - Intergenic
1161293151 19:3506472-3506494 CAGGTGAGGCGGCCGGGGTCGGG + Intronic
1161350077 19:3786416-3786438 CCGCGGAGGCGGGGCGGGGAGGG - Intronic
1161438795 19:4279273-4279295 CCCGGGACGCGGCCCGGGGCTGG + Exonic
1161494701 19:4580831-4580853 AAGTCGAGGCGACCCGGGGCTGG - Intergenic
1161802631 19:6424545-6424567 CGGCGGCGGCGGCCCGGGCGGGG - Exonic
1161990290 19:7680902-7680924 GAGCGGACGAGGCCCGGCGCGGG - Intronic
1162039796 19:7963841-7963863 CAGCGCAGGCGGCCTGGGGATGG + Intronic
1162056293 19:8066037-8066059 GGGCGGAGGCGGCCGGGGCCTGG - Exonic
1162145537 19:8610740-8610762 CAGGGGAGGGGGCGCGGGGAAGG + Intergenic
1162235946 19:9309712-9309734 CCGCGGACCCGACCCGGGGCAGG + Intronic
1162299309 19:9835273-9835295 CAGCGGCGGCGGGCGGGCGCGGG + Intronic
1162426923 19:10602575-10602597 CAGCAGAGGCGGCCCCTGACCGG - Intronic
1162470916 19:10871639-10871661 CAGCGGCGGCGGCCTGGGCCCGG + Exonic
1162535862 19:11262510-11262532 CAGCCGGGGCGGGGCGGGGCCGG + Intergenic
1162895499 19:13762842-13762864 CAGAGGAGGCTGCCCAGGACCGG + Exonic
1162935360 19:13979109-13979131 CAACGGGGGCGGCCGCGGGCGGG + Intronic
1162954587 19:14091008-14091030 CCGCGGAGTTGGCCCGGGGCGGG + Intronic
1163103282 19:15109897-15109919 CAGCGTGGGGGGCCCCGGGCCGG + Exonic
1163660130 19:18571968-18571990 CAGAAGAGGCGGCCCTGAGCTGG + Intronic
1163679316 19:18671522-18671544 CAGGGGCGCCGGCCCAGGGCGGG + Exonic
1163688654 19:18726328-18726350 CAGCAGAGGAGGCCCAGGCCCGG + Intronic
1163785515 19:19273063-19273085 CAGTGGGGGCGGGCGGGGGCGGG - Intronic
1163803971 19:19385317-19385339 CACCGGAGGCGGCCTTGGCCAGG - Intergenic
1163807240 19:19406407-19406429 CAGGGGCGGGGGTCCGGGGCGGG + Intronic
1165080426 19:33303193-33303215 GAGCGGAGGCGGCCTCGGCCCGG + Intergenic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165445763 19:35856225-35856247 CGGCGGTGCCGGGCCGGGGCAGG - Intronic
1165992846 19:39826052-39826074 CAGCCGCTGCGGCCCTGGGCAGG - Exonic
1166096267 19:40541376-40541398 CAGCAGAGGGAGCCCGAGGCAGG + Intronic
1166215317 19:41330991-41331013 CAGCGGGGGCGGGGCGGGGTGGG + Exonic
1166304254 19:41928595-41928617 CGGCGGCGGCGGCGCGGGGGAGG + Intronic
1166723074 19:45008752-45008774 CAGCGCAGGCAGCCCTGGGTGGG + Intronic
1166765670 19:45251316-45251338 CCGCGGAGGGGGCGCGGAGCCGG - Exonic
1166852846 19:45768686-45768708 CGGCGGCGGCGGCCGGGGCCGGG - Exonic
1166991227 19:46693951-46693973 GGGCTGAGGCCGCCCGGGGCTGG - Exonic
1167040618 19:47020828-47020850 CACCCTAGCCGGCCCGGGGCTGG - Intronic
1167357654 19:49014135-49014157 CAGCGGGGCCAGCCCAGGGCTGG - Intronic
1167411588 19:49347301-49347323 GAGCGGCGGCGCTCCGGGGCTGG + Exonic
1167527607 19:49994706-49994728 CAGCGGAGGGGGGTGGGGGCCGG + Intronic
1167570119 19:50281643-50281665 CAGGGGAGGAGGCACGGCGCCGG + Exonic
1167913964 19:52725372-52725394 CAGGGGAGGCCGACGGGGGCTGG + Intronic
1168100348 19:54138118-54138140 CAGAGGCGGCGGCAGGGGGCAGG - Intronic
1168152402 19:54456082-54456104 CAGCGAGGGACGCCCGGGGCTGG + Exonic
1168286949 19:55340002-55340024 GAGCCAAGGCGGCGCGGGGCTGG - Intronic
1168288427 19:55345788-55345810 AAGCGGGGGCGGCCCGCAGCAGG + Intronic
1168293737 19:55369281-55369303 GAGCAGACGCGGCCCGGGGCGGG + Intronic
1168308936 19:55451324-55451346 AAGAGGAGGCGGGCCCGGGCGGG + Intergenic
1168596518 19:57682167-57682189 GAGCGGCGGCCGACCGGGGCGGG - Exonic
925068907 2:951014-951036 CGCGGGAGGCGGCCGGGGGCGGG - Exonic
925133773 2:1512525-1512547 CAGCAGGGGCGGAGCGGGGCAGG - Intronic
925376201 2:3388001-3388023 TAGCGGAGGGGCCCCGAGGCAGG + Exonic
926121502 2:10243509-10243531 CAGAGGAGGTGGCCCAGGCCTGG + Intergenic
926155026 2:10448687-10448709 CAGCTGCCGCGGGCCGGGGCCGG - Intergenic
927216626 2:20671068-20671090 CAGCGGCGGGGGCGCGGGCCGGG + Exonic
927679836 2:25132065-25132087 CACCGGGGGCGGCCCGGGGATGG + Intronic
927809173 2:26172656-26172678 CTGCGGAGTCGGCGCGGGGTCGG - Intergenic
927859333 2:26550749-26550771 CTGGGGAGGAAGCCCGGGGCAGG - Intronic
928022522 2:27715770-27715792 AGGCCGGGGCGGCCCGGGGCGGG + Intergenic
928172620 2:29013046-29013068 CAGCTGAGGCTGCCTGAGGCTGG - Intronic
928511724 2:32009967-32009989 CCGCGCCGGCAGCCCGGGGCCGG - Intronic
930651798 2:53970995-53971017 CAGCAGAGCCGGTGCGGGGCGGG - Intronic
933666849 2:84971260-84971282 GCGGGGAGGCGGCGCGGGGCGGG - Exonic
934296839 2:91749095-91749117 CCGCGGCGGCGCCCCGGGGAAGG + Intergenic
934966826 2:98731007-98731029 CAGCGGCGGCGCGCGGGGGCGGG - Intronic
935165003 2:100562750-100562772 CAGCGGAGGAGGGGTGGGGCTGG - Exonic
935592607 2:104855810-104855832 CGGCGGCGGCGGCGTGGGGCAGG - Exonic
935594234 2:104867292-104867314 CAGCGGAGAGGGCCCGGCGCAGG - Intergenic
936058825 2:109281315-109281337 TAACGGAGGGGGCCCGGGGAAGG - Intronic
936122657 2:109760349-109760371 CGGCGGCGGCGGCGCAGGGCCGG + Intergenic
936122690 2:109760418-109760440 CGGCGGCGGCGGCGCAGGGCCGG + Intergenic
936222003 2:110611055-110611077 CGGCGGCGGCGGCGCAGGGCCGG - Intergenic
936222036 2:110611124-110611146 CGGCGGCGGCGGCGCAGGGCCGG - Intergenic
936370460 2:111898526-111898548 GAGCCGAGGCCGGCCGGGGCTGG - Exonic
936412921 2:112276080-112276102 CGGCGGGAGCGGGCCGGGGCCGG + Intronic
937019107 2:118634006-118634028 CAGCGGAGGCTGCCTGGAGGAGG - Intergenic
937269303 2:120637902-120637924 CTGCAGAGGCGGCCCTGGGGAGG + Intergenic
937332908 2:121043250-121043272 CAGAGGGGCCGGCCCTGGGCAGG + Intergenic
937907693 2:127060417-127060439 AGGCGGAGGCGGCGCGGGGCGGG - Intronic
937974830 2:127576408-127576430 CAGCCGCGGAGGCCCGGGACAGG + Intronic
938115954 2:128603057-128603079 CAGCGGAGGAGGCCCAGGGCTGG + Intergenic
938416193 2:131105507-131105529 CCGCGGAGGTGGCGCGGTGCGGG - Intronic
938796009 2:134718828-134718850 CAGCGGGGCCGGGCCGGGGGCGG + Exonic
938934508 2:136116855-136116877 CAGCCGCGGCGGCCCGGGGCTGG - Intronic
942241233 2:173965080-173965102 CGGCGGCAGCGGCCCCGGGCTGG + Intronic
942450914 2:176107619-176107641 CAGCGGGGGCGGCCCCGGCGGGG + Exonic
942454804 2:176130336-176130358 CAGCGGCGGCGGCCCCGGGCGGG - Exonic
942799626 2:179861020-179861042 CTGCGGAGGAGGGCGGGGGCCGG + Intronic
943173329 2:184433110-184433132 CAGCGGGGGTGGCGCGGGGGAGG - Intergenic
943669836 2:190648987-190649009 CGGCGGAGGCGGGCGGGGGAGGG + Intronic
945386616 2:209209332-209209354 CAGCTGGGGCAGCCCGGGCCGGG + Intergenic
945844368 2:214926746-214926768 CAGTGGAGGGGGGCGGGGGCAGG + Intergenic
946302380 2:218831837-218831859 CAGGGCAGGGTGCCCGGGGCCGG - Intronic
946397272 2:219449243-219449265 CAGGGGAGGTGGGCCGGGCCCGG - Exonic
946747482 2:222860883-222860905 CGGCGCTGGCGGCCCGGGGCGGG - Intergenic
947715577 2:232337417-232337439 CAGAGGAGCCGGCCTGGGCCTGG + Intronic
947721102 2:232369768-232369790 CAGAGGAGCCGGCCTGGGCCTGG + Intergenic
948047135 2:234952791-234952813 CAGCGCCGGCGGCCCGCGGGCGG + Intronic
948190532 2:236054864-236054886 CCGGGGAGGGGGCCCGGGCCCGG - Intronic
948310404 2:236981538-236981560 CAGAGGATGGGGCCCGTGGCTGG - Intergenic
948945690 2:241217953-241217975 CAGCGGGGGCGCGCAGGGGCGGG + Intronic
948945704 2:241217983-241218005 CAGCGGGGGCGCGCAGGGGCGGG + Intronic
948945737 2:241218046-241218068 CGGCGGGGGCGGGCAGGGGCGGG + Intronic
948945749 2:241218072-241218094 CAGCGGGGGCGCGCAGGGGCGGG + Intronic
948947027 2:241225819-241225841 CAGCACACACGGCCCGGGGCGGG + Intergenic
948983835 2:241508374-241508396 CAGAGGGAGGGGCCCGGGGCGGG - Intronic
948988679 2:241541173-241541195 CACCGGCCGCGGCCAGGGGCGGG + Intergenic
1169381741 20:5113260-5113282 CAGCGGAGGTAGCCGGCGGCAGG - Intergenic
1172644518 20:36461518-36461540 CGGCGGCGGCGGCCAGCGGCGGG - Intronic
1172654363 20:36527997-36528019 CAGCGGCGGCGGCGCTGGGTGGG - Exonic
1172764876 20:37346063-37346085 AGGCGGCGGCGGCCCGGGGAGGG - Intronic
1172890539 20:38260782-38260804 CAGCAGAGGCGGGGCGGGGCGGG + Intronic
1173210749 20:41029490-41029512 CGGGGGAGGCGGCCGGCGGCTGG - Intronic
1173617809 20:44414273-44414295 CAGAGGAGGGGGCAGGGGGCAGG + Intronic
1173672896 20:44810376-44810398 TGGTGGCGGCGGCCCGGGGCCGG + Intergenic
1173734299 20:45348470-45348492 GGGCGGGGGCGGGCCGGGGCGGG - Intergenic
1175265855 20:57703219-57703241 CAGCGGGGGAGGGCCGGGGAGGG - Intronic
1175749211 20:61483672-61483694 CAGCGGGGGCGGGGCGGGGGGGG - Intronic
1175931306 20:62495095-62495117 CAGCGCCAGCGTCCCGGGGCAGG - Intergenic
1176029796 20:63006470-63006492 CGGCGGCGGCGGCGCGGGCCAGG - Exonic
1176073840 20:63239645-63239667 CTGCGGAGGGGGCCCTGAGCCGG + Intronic
1176092487 20:63325390-63325412 AAGCGGAGGGGGCACAGGGCAGG - Intronic
1176722838 21:10405639-10405661 CAGCGGCGACTGCCCCGGGCTGG - Intergenic
1178314904 21:31559393-31559415 CAGCGGAGGCGCGGCGGGCCGGG + Intronic
1179511956 21:41879199-41879221 CAGCGGGTGCGGCCCGGGGCCGG + Intronic
1179531050 21:42019941-42019963 CAGCAGAGATGGTCCGGGGCTGG - Intergenic
1179783907 21:43719184-43719206 CAGCCGAGGGGAGCCGGGGCCGG + Exonic
1180042725 21:45288299-45288321 GTGGGGAGGAGGCCCGGGGCTGG + Intergenic
1180304000 22:11058381-11058403 CAGCGGCGACTGCCCGGGGCTGG - Intergenic
1180699696 22:17774523-17774545 CGCCGGGGGCGGGCCGGGGCGGG - Intronic
1181027486 22:20134312-20134334 CAGCAGAGGCGGGGCGGGTCGGG - Intronic
1181133224 22:20746678-20746700 CAGAGTAGGAGGCCCAGGGCGGG + Intronic
1181499328 22:23306855-23306877 CAGCAGAGGCCGCCCGGCTCCGG - Intronic
1182578637 22:31290850-31290872 GCGCGGAGGCGGAGCGGGGCCGG + Intronic
1183316308 22:37138905-37138927 CCGGGGAGGAGGCCCAGGGCTGG + Intronic
1183427369 22:37746805-37746827 GAGCGGAGGTGGGCCTGGGCTGG + Intronic
1183458025 22:37933230-37933252 CAGAGGAGGAGGTGCGGGGCAGG + Intronic
1183903358 22:41022239-41022261 CTGCGGAAGCGGCCCGGGCGCGG - Intergenic
1184038299 22:41928842-41928864 CAGGGCAGGTGGCCCAGGGCAGG + Intergenic
1184680700 22:46071081-46071103 CGGCGGGGGCGGGCCGGGCCGGG + Intronic
1185278861 22:49961386-49961408 CGGCGGCGGCGGCGGGGGGCGGG + Intronic
950153823 3:10707980-10708002 CAGCGGGGCCGGGCCGGGCCGGG - Intronic
950417331 3:12876061-12876083 CAGCGGAGAGGGCCCGGGTGAGG + Intergenic
950487701 3:13282746-13282768 GAGCGGCTGCGGGCCGGGGCCGG + Intergenic
950530281 3:13549065-13549087 CAGGGGAGGGGGCCGGGGGCCGG + Intergenic
952884206 3:38002784-38002806 GAGGGGAGGCGGCCTGGGCCTGG - Intronic
953666314 3:44928765-44928787 CAGCGGATGAGGACCAGGGCTGG + Intronic
953761314 3:45689406-45689428 CCGAGGTGGCGGCGCGGGGCGGG + Exonic
953884080 3:46705806-46705828 CAGCGGAGGCGGCTTGGGCTTGG - Exonic
954632824 3:52056370-52056392 GAGCGCGGGCGGCCCGGGGCCGG + Exonic
954707383 3:52488372-52488394 CAGCAAAGGCGCCCCGAGGCTGG - Exonic
955298737 3:57757020-57757042 GAGCGGAGGCCGCCCCGGGAAGG - Exonic
955721533 3:61886556-61886578 CAGTGGAGGTGGCAAGGGGCAGG - Intronic
956642822 3:71430819-71430841 GAGGGGAGGCGGCGGGGGGCAGG + Intronic
961202521 3:125055960-125055982 CGGCGGGGGCCGCGCGGGGCCGG + Intergenic
961357118 3:126346220-126346242 CAGAGGAGCTGGCCCAGGGCAGG + Intronic
961359422 3:126357562-126357584 CCGCGCGGGCGGGCCGGGGCGGG - Intergenic
961551682 3:127673251-127673273 CAGCGGAAGCGCGCTGGGGCGGG + Intronic
961574457 3:127823231-127823253 CGGCGGGGGCGGCCCGAGGTGGG + Intronic
961658946 3:128458192-128458214 AAGGGGAGGAGGCCGGGGGCTGG + Intergenic
961775154 3:129279084-129279106 GAGCGGAGGCGACGCGGGGAGGG + Intronic
963706790 3:148698080-148698102 CAGCGCAGCCGGCCCTCGGCGGG + Exonic
964801607 3:160564955-160564977 CGGCGGAGCCGGCCCGGCGCGGG - Intronic
967272631 3:187743793-187743815 CGGCGGCGGCGGCCCGGGGAGGG - Intronic
968092982 3:195909614-195909636 ACTCGGGGGCGGCCCGGGGCGGG - Intronic
968231515 3:197007517-197007539 CAGGGGAGGCGGGCAGGTGCTGG - Intronic
968434107 4:576190-576212 CGGCGGCGGCGGCGCGGGCCCGG - Intergenic
968462660 4:733075-733097 GGGCGGAGGCAGCACGGGGCAGG - Intronic
968511643 4:998218-998240 CAGCAGAGGCGGGGCGGAGCAGG + Intronic
968582902 4:1403162-1403184 CGGCGGGGGCGGACCGGGACCGG - Exonic
968620634 4:1601984-1602006 CAGTGGAGGTGGGCCGGGGGAGG + Intergenic
968674388 4:1870144-1870166 CAGCGGAGGCGGCGCGGGAGAGG + Intergenic
968763899 4:2458362-2458384 CAGGGTAGGGGGCCCGGGGTAGG - Intronic
968879947 4:3293432-3293454 CCGCGGGGGCGGCGCCGGGCAGG + Intronic
968932128 4:3586725-3586747 CAGCAGCGGGGGCCCTGGGCAGG + Intronic
968942906 4:3648411-3648433 CTGCGGAGGCGGGCGGGGTCGGG - Intergenic
968948323 4:3677140-3677162 CAGCGGGAGGAGCCCGGGGCTGG + Intergenic
969053170 4:4386794-4386816 CGGCGGAGGGCGCCCGGAGCGGG - Exonic
969226078 4:5799167-5799189 CAGCAGAGGCGGCCAGGGGCAGG - Intronic
969330752 4:6472382-6472404 GGGCGGGGGCGGCCGGGGGCGGG + Intronic
972543275 4:40057176-40057198 GATCGGAGGCGGCCCGCGCCGGG - Intronic
975485709 4:74932942-74932964 CAGCAGAGGCCGCTCTGGGCCGG + Intergenic
976812456 4:89111448-89111470 GAGCGCACGCGGCCCGGGGGAGG - Intergenic
981621150 4:146700114-146700136 TAGTGGTGGCGGCCGGGGGCGGG - Intergenic
984668070 4:182449099-182449121 CGGCGGCGGCGGCCTGGGGCGGG + Intronic
985064149 4:186104996-186105018 CGGCCGAGGCGGCCCGGGCCGGG - Intronic
985649187 5:1099395-1099417 CAGAGGAGGTGGACCGGGTCGGG - Intronic
985733923 5:1566329-1566351 CAGGGGAGGCTGTCGGGGGCAGG + Intergenic
986177562 5:5365002-5365024 CAGCGGGGGCTGCTGGGGGCAGG + Intergenic
986402846 5:7396202-7396224 CGGCCGAGGCGGCGCGGGGGTGG + Exonic
986451417 5:7869275-7869297 TGGGAGAGGCGGCCCGGGGCGGG + Intronic
986690175 5:10307672-10307694 CAGAGGAGGCGGCGTGGCGCCGG + Exonic
987050701 5:14144582-14144604 CCGGGGGGGCGGCGCGGGGCTGG + Intronic
989209585 5:38846026-38846048 GTGCAGAGGCGGCCCGGGCCGGG - Exonic
990041979 5:51387450-51387472 GAGCGGAGGCGGCCCAGAGCGGG - Intronic
990937116 5:61162646-61162668 CAGGTGAGGCCGCGCGGGGCGGG + Intergenic
991676563 5:69094297-69094319 CGGCGGCGGCGGCCTTGGGCCGG + Exonic
992444042 5:76818937-76818959 CAGGGAAGGGGGCCGGGGGCGGG + Intronic
992530255 5:77645770-77645792 CAGCCGAGGCGGAGCGGGCCGGG - Intergenic
992866227 5:80960186-80960208 CAGAGGCAGCGGCCCGGGCCGGG + Intergenic
992910722 5:81393918-81393940 GAGCGGCGGCGGCTGGGGGCTGG - Intronic
993902792 5:93595910-93595932 CAGAGTATGCGGCCCGGGGAGGG - Intergenic
997266324 5:132497110-132497132 CAGCGGCGGGGGCCGGGGGACGG + Intergenic
997463447 5:134071259-134071281 CAGCGGGGGCGGCGCCGTGCGGG + Intergenic
998205983 5:140157256-140157278 CAGGGAGGGAGGCCCGGGGCTGG - Intergenic
998292140 5:140926252-140926274 GAGCGGAGGCGGCGAGAGGCGGG - Intronic
999727220 5:154446579-154446601 CAGAGGGACCGGCCCGGGGCGGG + Exonic
999798782 5:155013709-155013731 CAGTGCAGGCGGCCCGAGGGCGG - Intergenic
1000360497 5:160442400-160442422 CAGCGGAGGATGCCCTGTGCAGG - Intergenic
1000469591 5:161623763-161623785 CAGCGGTGGCGGCTAGGGGAGGG + Intronic
1001064996 5:168529377-168529399 CAGCGGAGGCGGGCGGCGGGCGG - Exonic
1001065110 5:168529675-168529697 CGGCGGGGGCGGCCGGGGCCGGG + Exonic
1001395780 5:171419111-171419133 CAGTGGAGCCGCCCCGGGGCTGG + Intergenic
1001632680 5:173187593-173187615 CAGAGCAGGCAGCCCGGAGCTGG - Intergenic
1001822505 5:174721098-174721120 CAGCGGGGGCGGGGCAGGGCGGG + Intergenic
1002178833 5:177419075-177419097 CAGCTGAGGCTGCCGGGGGAAGG + Intronic
1002340723 5:178515212-178515234 GAGCAGAGGAGGCCCTGGGCAGG - Intronic
1002622099 5:180494939-180494961 CCGGGGGCGCGGCCCGGGGCGGG - Intronic
1002884971 6:1285557-1285579 CAGCGGAGGCAGTCTGGAGCAGG - Intergenic
1002961093 6:1915436-1915458 CAGCAGGGGCAGCCCAGGGCCGG + Intronic
1003062804 6:2875993-2876015 CTGGGGAGGCGGCCTGGGGGAGG - Intergenic
1005135911 6:22569875-22569897 CAGCGGAGACGGGCCTTGGCCGG + Exonic
1005303795 6:24495111-24495133 CAGCGGAGCTGGGCCGGGCCGGG - Exonic
1006105295 6:31712753-31712775 CAGCGGAGCCTTCCCCGGGCAGG + Exonic
1006303886 6:33207834-33207856 CAGGAGCCGCGGCCCGGGGCGGG - Intergenic
1007383117 6:41503273-41503295 GAGCGAAGACGGCCGGGGGCAGG + Intergenic
1007422690 6:41729091-41729113 CAGGGGAGGCGAGGCGGGGCCGG - Intronic
1007625418 6:43243706-43243728 CAGGTGAGGCGGGGCGGGGCGGG + Exonic
1010141923 6:72622254-72622276 CAGCGGCGGCGGCGGCGGGCGGG + Exonic
1013117802 6:107115530-107115552 CCGCGCTGGCTGCCCGGGGCGGG + Intergenic
1014098213 6:117482696-117482718 CAGAGGAGGCGGCCCGGCCCGGG + Exonic
1014246826 6:119078539-119078561 GGGCGGCGGCGGCCGGGGGCCGG + Exonic
1014246893 6:119078793-119078815 CGGCGGCGGCTGCGCGGGGCTGG - Intronic
1014724982 6:124962667-124962689 CCGCGGAGGCGGCGCGCAGCGGG - Exonic
1015366386 6:132401576-132401598 CCCTGCAGGCGGCCCGGGGCGGG - Intergenic
1017877559 6:158536957-158536979 CGGCGGAGGCGGCCGTCGGCGGG - Intronic
1018374247 6:163195846-163195868 CAGCGGAGACACCCAGGGGCGGG - Intronic
1018400322 6:163414594-163414616 CAGCGGCGGCGGCGGGGGGAGGG - Intronic
1018613058 6:165662164-165662186 CGGCGGCGGCGGCCGGGGACCGG + Intronic
1018947388 6:168357015-168357037 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947404 6:168357070-168357092 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947420 6:168357125-168357147 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947438 6:168357180-168357202 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947455 6:168357235-168357257 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947520 6:168357455-168357477 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947652 6:168357894-168357916 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947669 6:168357949-168357971 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947689 6:168358004-168358026 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947707 6:168358059-168358081 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947727 6:168358114-168358136 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947843 6:168358498-168358520 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947858 6:168358553-168358575 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947878 6:168358608-168358630 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947896 6:168358663-168358685 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947916 6:168358718-168358740 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1019279298 7:192232-192254 TGGCGGCGGCGGCCCCGGGCGGG + Intergenic
1019474635 7:1238190-1238212 CAGGGGCGGGGGCGCGGGGCTGG - Intergenic
1019487575 7:1296388-1296410 CAGCGCAGGGGGCCCGGATCTGG - Intergenic
1019614697 7:1953951-1953973 CAGTGGAGGCCGCACTGGGCAGG - Intronic
1019999968 7:4749990-4750012 CGGTGGAGGCTGCCCGGGGTGGG + Intronic
1020096875 7:5374365-5374387 CCGCGGCAGCAGCCCGGGGCCGG + Exonic
1020272863 7:6607420-6607442 AAGCTGAGGCTGCGCGGGGCGGG + Intronic
1021231050 7:18086730-18086752 CCGCGGAGGCTGGGCGGGGCTGG - Intergenic
1022088138 7:27088404-27088426 CAGCCTAGCCGGCCGGGGGCAGG + Intergenic
1022094503 7:27130389-27130411 CTGGGGCGGCCGCCCGGGGCTGG + Exonic
1022559911 7:31336862-31336884 CAGTGGTGGCGGGACGGGGCAGG - Intergenic
1023287072 7:38631258-38631280 CAGCGGCGGGCGGCCGGGGCTGG - Intronic
1024247223 7:47479587-47479609 GAGCTGAGGCCGTCCGGGGCGGG - Intronic
1024505652 7:50159167-50159189 TAGAGGAGGCGGCCCTGCGCGGG + Exonic
1025992509 7:66506340-66506362 CCGCCGAGGCGGGGCGGGGCGGG - Intergenic
1026786672 7:73305974-73305996 CAGTGGAGGAGGCACGGGGCAGG + Intronic
1027390276 7:77696898-77696920 CAGCGGCGGCGGCGGCGGGCAGG - Exonic
1029259793 7:99294069-99294091 CGAGGGAGGCGGCCCGGGCCTGG - Intergenic
1029372453 7:100158301-100158323 CACCGGGGGCGGCCCGGGCTTGG - Exonic
1029747643 7:102525335-102525357 GAGCAGAGACGGCCCAGGGCTGG + Intergenic
1029765594 7:102624425-102624447 GAGCAGAGACGGCCCAGGGCTGG + Intronic
1031253104 7:119413436-119413458 CAGCGGGGTGGGCCCGGGGGAGG + Intergenic
1031334478 7:120510855-120510877 CAGGGGAGGTGGCCAGGGGTTGG - Intronic
1031986713 7:128168261-128168283 CAGAGGACGCGGGCTGGGGCGGG + Intergenic
1032939155 7:136768468-136768490 CAGCGCAGTGGGCCCAGGGCAGG - Intergenic
1034222787 7:149459513-149459535 CAGCGGACGCGGCCCGTCGGGGG - Intronic
1034501217 7:151452183-151452205 CAGCTCAGGCGGCCCGGCACCGG + Intergenic
1034522620 7:151632312-151632334 CGGCGGCGGCGGCCTCGGGCGGG - Intronic
1035021198 7:155801491-155801513 CAGAGGAGGTGGCCTGGGGATGG - Exonic
1035023828 7:155814134-155814156 CAGTGGAGGCTGCCGGGGCCTGG - Intergenic
1036950339 8:13133553-13133575 CGGCGGAGGAGGCGCGGGGCGGG - Intronic
1037273698 8:17156403-17156425 CAGGGGAGGCGGCCGGGCGGCGG + Exonic
1037589975 8:20304005-20304027 GGGCGGGGCCGGCCCGGGGCGGG + Intergenic
1039238092 8:35525095-35525117 CAGCGGAGGCAGGCCGGGGGAGG - Intronic
1040471497 8:47738409-47738431 CAGCGCAGGCCGGCCCGGGCCGG - Exonic
1040871022 8:52100448-52100470 CAGCAGAGGCGGCTCCGGGAAGG - Intergenic
1041690148 8:60679624-60679646 CGGCGGCGGCGGCTCGGGGACGG + Intronic
1041753570 8:61288292-61288314 CCGCGGAGGCGGCGGGGAGCGGG - Intronic
1042246430 8:66712873-66712895 CTCCGACGGCGGCCCGGGGCGGG + Intronic
1042950698 8:74198381-74198403 CAGCTGCAGAGGCCCGGGGCAGG + Intergenic
1047998628 8:130358744-130358766 GAGCGGGGGCGGGGCGGGGCGGG - Intronic
1048554001 8:135457697-135457719 CGGCGGCGGCGGCACGGGGGCGG - Exonic
1049521177 8:143092179-143092201 CAGAGGAGGCGTCCAGGGGCAGG + Intergenic
1049578791 8:143401524-143401546 CAGGGGAGGCGGCCCAGAGATGG + Intergenic
1049673022 8:143878118-143878140 CGGGAGAGGCGGCCAGGGGCGGG - Intronic
1049710406 8:144060624-144060646 GAGGGGAGGCCGCCCGGCGCAGG + Intronic
1049745469 8:144261358-144261380 CAGCGGAGGGGCCCCGTGGAGGG - Intronic
1049850335 8:144827217-144827239 CTGGGGACGCGGGCCGGGGCCGG - Intergenic
1053013103 9:34646610-34646632 CATCGGGGGCGGCGCGGGGAGGG + Intronic
1053050505 9:34957888-34957910 CGGAGGAGGCGGCCCGGAGGGGG - Intronic
1053885008 9:42637170-42637192 CAGCGGCGCCTGCCCTGGGCTGG - Intergenic
1054224029 9:62444621-62444643 CAGCGGCGCCTGCCCTGGGCTGG - Intergenic
1054458007 9:65445203-65445225 CAGCAGCGGGGGCCCTGGGCAGG - Intergenic
1056681647 9:88724638-88724660 CAGCAGAGACGGCCAGGGGAGGG + Intergenic
1056990470 9:91405890-91405912 CAGAGTCGGCGGCCGGGGGCGGG - Intergenic
1056992420 9:91423951-91423973 CGGCAGGGGCGGGCCGGGGCGGG + Intergenic
1057279301 9:93698613-93698635 CAGGGAAGGCAGCCCTGGGCAGG - Intergenic
1057279912 9:93701932-93701954 CTGCAGAGGCGGCCTGGGGCTGG - Intergenic
1057352899 9:94315536-94315558 CAGTTGGGGCGGCCCCGGGCAGG - Intergenic
1057470098 9:95349570-95349592 CGGAGGATGCGGCGCGGGGCGGG - Intergenic
1057489030 9:95507797-95507819 CAGGGCAGGGGGCACGGGGCAGG + Intronic
1057489289 9:95508926-95508948 CAGCTGCGGCTGCCCGGGCCCGG - Intronic
1057654848 9:96942055-96942077 CAGTTGGGGCGGCCCCGGGCAGG + Intronic
1057739123 9:97696871-97696893 CAGCGAAGAAGGCCCGGGGCTGG + Intronic
1057869814 9:98709049-98709071 GGGCGGAGGCGGCCCGGTGCGGG - Exonic
1057931609 9:99198294-99198316 CAGCGGAGTCTGCACAGGGCCGG + Intergenic
1058684089 9:107465700-107465722 CAGCAAAGGCGGCGCGGAGCGGG + Intergenic
1059942123 9:119368985-119369007 CCCCGAATGCGGCCCGGGGCCGG + Intronic
1060106712 9:120877218-120877240 CGGCGGGGGCGGGGCGGGGCGGG + Exonic
1060139835 9:121201061-121201083 CAGCCGGGCCGGGCCGGGGCCGG - Intronic
1060478029 9:123999941-123999963 CTGCGGGGCCGGCCCGGAGCCGG - Intergenic
1061208671 9:129178365-129178387 CAGCCGAGTAGCCCCGGGGCGGG - Intergenic
1061231673 9:129319243-129319265 CAGCAGAGGGGGCCAGGGGAGGG - Intergenic
1061293728 9:129666194-129666216 CCGGGGAGCCGGCGCGGGGCGGG + Intronic
1061480769 9:130896767-130896789 CATCGGAGGCAGCCCTGGCCTGG - Intergenic
1061485305 9:130917596-130917618 CTGCAGAGGCAGCCCTGGGCGGG - Intronic
1061623615 9:131827498-131827520 CAATGGAGGCTGCCGGGGGCTGG + Intergenic
1061797763 9:133098282-133098304 CAGAGGTGGCGCCCGGGGGCAGG + Exonic
1061882264 9:133574311-133574333 CAGCTGGAGCGGCCAGGGGCTGG + Intronic
1061921607 9:133785526-133785548 CAGCGGAGCCTGCCTGGGACAGG + Intronic
1061952455 9:133943984-133944006 CAGGAGAGGCGGCGCAGGGCCGG + Intronic
1062014218 9:134283160-134283182 CAGCAGAGGCGGGGAGGGGCAGG - Intergenic
1062161128 9:135080497-135080519 CAGGGGAGGCAGCCCGGGAATGG - Intronic
1062410572 9:136422116-136422138 CAGCAGGGGCGGCCAAGGGCAGG + Intronic
1062424714 9:136500794-136500816 CAGCGGGGGCGGCCTGGAGACGG - Exonic
1062472442 9:136712454-136712476 CGGCGGAGGCGCGCGGGGGCGGG - Intergenic
1062565496 9:137162330-137162352 GCGCGGAGCCGGCCAGGGGCGGG + Intronic
1062574569 9:137200226-137200248 CGGCGGCGGCGGCGGGGGGCGGG + Exonic
1062579177 9:137222007-137222029 CTGCGGCGGCGGCGCGCGGCCGG - Intergenic
1062653538 9:137590453-137590475 CGGCGGCGGCGGCGCGTGGCAGG - Exonic
1062689622 9:137834537-137834559 CAGCGGAGATGGCCAGGGGCCGG - Intronic
1185747477 X:2584244-2584266 TTGCGGATGCGGCGCGGGGCCGG - Intergenic
1186426126 X:9465292-9465314 GGGCGGGGGCGGCCCGGGGGCGG + Exonic
1189322361 X:40094670-40094692 CAGTGGAGGCGACCGCGGGCAGG + Intronic
1189348495 X:40260207-40260229 CAGAGGAGGCGGGGCGGGGGAGG - Intergenic
1189534526 X:41923205-41923227 GAGCGAGGGCGGCCCGGGCCCGG + Intronic
1190554275 X:51618135-51618157 CGGCGGTGGCGACCCGGGGGAGG - Intergenic
1190560570 X:51682093-51682115 CGGCGGTGGCGACCCGGGGGAGG - Intergenic
1190563721 X:51711228-51711250 CGGCGGTGGCGACCCGGGGGAGG + Intergenic
1197415265 X:126165969-126165991 CGGCGGCGGCGGCCCGGCGGCGG + Intergenic
1199771471 X:150977917-150977939 GAGGGGAGGGGACCCGGGGCTGG + Intergenic
1199772596 X:150984039-150984061 CGGCGGCGGCGGCGCCGGGCGGG - Intronic
1199772643 X:150984155-150984177 CGGCGCCCGCGGCCCGGGGCGGG + Intronic
1200080247 X:153572682-153572704 CAGTGGAGGCTGCCTGGAGCTGG - Intronic