ID: 1122942055

View in Genome Browser
Species Human (GRCh38)
Location 14:104985874-104985896
Sequence GAGAGTCCCCGCACCCACCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 240}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122942055_1122942065 15 Left 1122942055 14:104985874-104985896 CCAAGGTGGGTGCGGGGACTCTC 0: 1
1: 0
2: 1
3: 14
4: 240
Right 1122942065 14:104985912-104985934 GGCGCTTAGCCGGCCACCTCGGG 0: 1
1: 0
2: 1
3: 4
4: 48
1122942055_1122942060 -6 Left 1122942055 14:104985874-104985896 CCAAGGTGGGTGCGGGGACTCTC 0: 1
1: 0
2: 1
3: 14
4: 240
Right 1122942060 14:104985891-104985913 ACTCTCGGGAGCCGTGGGCCAGG 0: 1
1: 0
2: 1
3: 7
4: 108
1122942055_1122942064 14 Left 1122942055 14:104985874-104985896 CCAAGGTGGGTGCGGGGACTCTC 0: 1
1: 0
2: 1
3: 14
4: 240
Right 1122942064 14:104985911-104985933 AGGCGCTTAGCCGGCCACCTCGG 0: 1
1: 0
2: 0
3: 1
4: 47
1122942055_1122942067 26 Left 1122942055 14:104985874-104985896 CCAAGGTGGGTGCGGGGACTCTC 0: 1
1: 0
2: 1
3: 14
4: 240
Right 1122942067 14:104985923-104985945 GGCCACCTCGGGCCCTGTCCAGG 0: 1
1: 1
2: 0
3: 25
4: 205
1122942055_1122942062 5 Left 1122942055 14:104985874-104985896 CCAAGGTGGGTGCGGGGACTCTC 0: 1
1: 0
2: 1
3: 14
4: 240
Right 1122942062 14:104985902-104985924 CCGTGGGCCAGGCGCTTAGCCGG 0: 1
1: 0
2: 0
3: 8
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122942055 Original CRISPR GAGAGTCCCCGCACCCACCT TGG (reversed) Exonic
900406583 1:2495590-2495612 GGGAGGCCCCGCACACTCCTGGG + Intronic
902314836 1:15610691-15610713 GTGAGCCACCGCACCCAGCTGGG - Intergenic
905393360 1:37652017-37652039 CAGAGTCTCGGCACACACCTGGG + Intergenic
905527940 1:38653477-38653499 AAGAGCCCCCTGACCCACCTGGG - Intergenic
906003196 1:42445148-42445170 GTGAGCCACCGCACCCAGCTGGG - Intronic
912434605 1:109652265-109652287 GCGAGCCACCGCACCCAGCTTGG - Intergenic
913254507 1:116941737-116941759 GAGAGTCCCCACAGCGACCCTGG + Exonic
913958910 1:143324321-143324343 CAGAGCCCCCACACCCACCGTGG - Intergenic
914053227 1:144149701-144149723 CAGAGCCCCCACACCCACCGTGG - Intergenic
914125970 1:144816840-144816862 CAGAGCCCCCACACCCACCGTGG + Intergenic
916216749 1:162402228-162402250 GTGAGCCACCGCACCCAGCTGGG - Intronic
918519076 1:185394966-185394988 GTGAGCCCCCGCACCCAGCCTGG - Intergenic
920310065 1:205043561-205043583 GGGAGCCCCAGCACCCACCCTGG - Intronic
921072815 1:211676069-211676091 GTGAGTCACCGCGCCCACCCGGG - Intergenic
922499759 1:226087881-226087903 GAGACTACAGGCACCCACCTCGG - Intergenic
922720925 1:227899987-227900009 CAGGGCCCACGCACCCACCTTGG + Intergenic
924007975 1:239633251-239633273 GTGAGCCACCGCACCCAGCTAGG + Intronic
924799382 1:247316527-247316549 GTGACGCCCTGCACCCACCTCGG + Intronic
1065972818 10:30818628-30818650 CAGAGACCCAGGACCCACCTAGG + Intergenic
1066061425 10:31726990-31727012 GACAGTCCCAGCAACCACGTAGG - Intergenic
1066758780 10:38736298-38736320 CAGAGCCCCCACACCCACCATGG + Intergenic
1066966952 10:42276645-42276667 AAGAGTCTCCGCACCCCACTTGG + Intergenic
1072843898 10:98806859-98806881 GTGAGCCACCGCACCCAGCTGGG - Intronic
1074853880 10:117459193-117459215 GAGAGTCACTTCACCCATCTGGG - Intergenic
1077107007 11:846559-846581 GAGAGGCCCCAAACCCACCTGGG - Intronic
1077503597 11:2920111-2920133 GAGAGCCCCCACCCCCACCCTGG - Intronic
1078239637 11:9519426-9519448 GTGAGCCACCGCACCCAGCTTGG + Intronic
1078247996 11:9593855-9593877 GTGAGCCACCGCACCCAGCTTGG + Intergenic
1079377683 11:19908274-19908296 GAGAGCTCCCACACCCACCCTGG - Intronic
1079466744 11:20738219-20738241 GAAAATCCCCCCACCCACCAGGG - Intronic
1080012214 11:27471532-27471554 GTGCGTCCCGGCACCTACCTCGG - Intronic
1080434069 11:32223678-32223700 CAGGGTCCCAGCACCCACCCAGG + Intergenic
1080753507 11:35173172-35173194 GAGAGTGACAGCAGCCACCTGGG + Intronic
1081813869 11:45928036-45928058 GAGAGTGCCCGCATCCAGCAAGG - Exonic
1082817051 11:57515751-57515773 GGGAGCCCCCGCCCCCACCTCGG - Exonic
1083205892 11:61148950-61148972 GAGATTCCTCCCACCCACCAGGG + Intronic
1084745948 11:71169465-71169487 GTGAGCCACCGCACCCAGCTTGG - Intronic
1087176832 11:95104165-95104187 GTGAGGCACTGCACCCACCTGGG - Intronic
1087800616 11:102499359-102499381 GAGAGCTCCCGCACCCGCCCAGG + Intergenic
1089207174 11:116773414-116773436 GAGAATCCCGGCACCTAACTCGG + Intergenic
1090368921 11:126233191-126233213 GTGAGCCACCGCACCCAGCTGGG - Intronic
1091675370 12:2485252-2485274 GAGACTCACTGCACTCACCTGGG + Intronic
1092145186 12:6209965-6209987 GTGAGTCACCGCGCCCAGCTGGG + Intronic
1092459195 12:8671530-8671552 GTGAGTCACCGCACCCAGCTGGG + Intergenic
1094153201 12:27309567-27309589 GTGTGTCCCCGCACACACCAAGG - Intronic
1094614289 12:32022390-32022412 GTGAGCCACCGCACCCAGCTGGG + Intergenic
1096360545 12:50982341-50982363 GTGAGCCACCGCACCCAGCTGGG - Intronic
1096462219 12:51828282-51828304 CAGAGTCCCAGCTACCACCTGGG - Intergenic
1103544068 12:121687245-121687267 GACAGTCCCCGCCCCAAACTCGG - Intergenic
1103968217 12:124653341-124653363 GAGAGACGCCCCACCCAGCTGGG - Intergenic
1104125640 12:125843004-125843026 GAGAGGCCCCTCTCCCATCTAGG - Intergenic
1104639912 12:130460875-130460897 CACAGTCCCCTCACCCAACTGGG + Intronic
1107857897 13:44633622-44633644 GAGAGCCACCGCACCCAGCCAGG - Intergenic
1108996032 13:56735835-56735857 GAGACTCCCCGCCCCTCCCTGGG + Intergenic
1109089226 13:58018096-58018118 GTGAGCCACCGCACCCAGCTGGG - Intergenic
1109531890 13:63660348-63660370 GTGAGCCACAGCACCCACCTGGG + Intergenic
1111797802 13:92945569-92945591 GTGAGTCACCGCACCCAGCCGGG - Intergenic
1112582395 13:100687784-100687806 GTGAGCCACCGCACCCAGCTGGG + Intergenic
1113725052 13:112592432-112592454 GAGAGTGCCAGCCCCCACCCTGG + Intergenic
1113836230 13:113330272-113330294 GAGTTTCCACGCACACACCTGGG - Intronic
1113836341 13:113330751-113330773 GAGTTTCCACGCACACACCTGGG - Intronic
1114416940 14:22551181-22551203 GTGAGCCCCCGCACCCAGCCTGG - Intergenic
1114452168 14:22834550-22834572 GTGAGCCACCGCACCCAGCTAGG - Exonic
1115592075 14:34874445-34874467 GGGAGTCCCCACACCCCCCGCGG + Intronic
1117904453 14:60569661-60569683 GTGAGTCACTGCACCTACCTGGG - Intergenic
1117920586 14:60722940-60722962 CTCAGTCCCCGCCCCCACCTCGG - Intronic
1118400328 14:65373667-65373689 GAGAGTTCCCTGACCCACCGTGG - Intergenic
1121055544 14:90849133-90849155 GAGAGCCCGCGCAGGCACCTTGG + Exonic
1121494921 14:94385607-94385629 GAGAGCCCCTGCACCCAGCCAGG + Intronic
1122470583 14:101963606-101963628 GTGAGCCACCGCACCCAGCTGGG + Intergenic
1122942055 14:104985874-104985896 GAGAGTCCCCGCACCCACCTTGG - Exonic
1202929501 14_KI270725v1_random:25869-25891 CAGAGCCCCCACACCCACCGTGG + Intergenic
1123422797 15:20145354-20145376 CAGAGCCCCCACACCCACCGTGG - Intergenic
1123442207 15:20300995-20301017 CAGAGCCCCCACACCCACCGTGG + Intergenic
1123532022 15:21151894-21151916 CAGAGCCCCCACACCCACCGTGG - Intergenic
1123686841 15:22804258-22804280 GTGAGCCACCGCACCCAGCTGGG + Intronic
1125103269 15:35940566-35940588 AAGAATCCCTGCCCCCACCTAGG - Intergenic
1125920334 15:43521602-43521624 CAGAGTCCCCACGACCACCTGGG - Exonic
1127107330 15:55630403-55630425 GTGAGTCACCGCACCCAGCCTGG + Intronic
1128204460 15:65838465-65838487 GTGAGCCACCGCACCCAGCTGGG + Intronic
1130192291 15:81748910-81748932 GAGAGTCACTACACCCAGCTGGG + Intergenic
1130355566 15:83126908-83126930 GTGAGCCACCGCACCCAGCTGGG - Intronic
1132654728 16:1037021-1037043 GGGAGTCCCTGCCCCCACCTAGG + Intergenic
1133155392 16:3871286-3871308 GTGAGTCCCAGCTCCCAGCTCGG - Intronic
1134846531 16:17445527-17445549 GAGAGGCCCCGGGCTCACCTGGG + Intronic
1135727936 16:24871553-24871575 GTGACTCACCGCACCCAGCTGGG + Intronic
1135728321 16:24874107-24874129 GTGAGCCACCGCACCCAGCTTGG + Intronic
1136030269 16:27497733-27497755 GAGAGTCCCCTGATCCACTTGGG + Exonic
1136244004 16:28962899-28962921 GTGAGCCCCCGCACCCAGCCTGG - Intronic
1136413785 16:30091605-30091627 AAGAGTCCCGGGACACACCTTGG + Intronic
1136719005 16:32304555-32304577 CAGAGCCCCCACACCCACCGTGG - Intergenic
1136724029 16:32342911-32342933 CAGAGCCCCCACACCCACCATGG - Intergenic
1136772914 16:32857403-32857425 CAGAGCCCCCACACCCACCGTGG + Intergenic
1136837378 16:33510819-33510841 CAGAGCCCCCACACCCACCGTGG - Intergenic
1136897700 16:34004116-34004138 CAGAGCCCCCACACCCACCGTGG - Intergenic
1141540132 16:84713745-84713767 GAGAGTCCCCGGGGACACCTTGG + Intronic
1141709409 16:85689156-85689178 GACAGGCCCCGCCCCCACCCCGG + Intronic
1141831823 16:86513388-86513410 GAAAGCCCCCGCACCCACACAGG + Exonic
1142133527 16:88441580-88441602 GGGAGGCCCAGCGCCCACCTGGG - Intergenic
1142434114 16:90046463-90046485 GGGAATCCCAGCACGCACCTGGG + Intergenic
1203002402 16_KI270728v1_random:174854-174876 CAGAGCCCCCACACCCACCATGG + Intergenic
1203007426 16_KI270728v1_random:213216-213238 CAGAGCCCCCACACCCACCGTGG + Intergenic
1203075339 16_KI270728v1_random:1119513-1119535 CAGAGCCCCCACACCCACCGTGG + Intergenic
1203134007 16_KI270728v1_random:1711260-1711282 CAGAGCCCCCACACCCACCATGG + Intergenic
1142552937 17:752115-752137 GGGAGCCGCGGCACCCACCTAGG + Exonic
1142994842 17:3754566-3754588 GAGAGGCCCCGCCCTCCCCTGGG + Intronic
1146286221 17:31575747-31575769 GGGAGTTCCTGCACCCTCCTGGG - Intergenic
1147541412 17:41363327-41363349 GTGAGTCCCAGCATCCACTTAGG - Intergenic
1147581319 17:41628614-41628636 GAGAGCCTCTGCACCCACATTGG + Intergenic
1147618438 17:41845417-41845439 GAGAGTCCCCGTGCCTACCATGG + Exonic
1151397825 17:73836121-73836143 GAGATTCCCTGGACCCACCACGG - Intergenic
1151891902 17:76956050-76956072 GTGAGCCACCGCACCCAGCTGGG + Intergenic
1152613756 17:81328687-81328709 GCGAGGCCCCGCCCCCACCCTGG - Intronic
1153835700 18:8962250-8962272 CAGATTCCCCGCACCCACCAAGG - Intergenic
1160159895 18:76463068-76463090 GAGAGTACCAGCATCCAACTGGG - Exonic
1160465804 18:79074672-79074694 GAGACTCCCCTCTCCCACCAAGG - Intronic
1160681031 19:411670-411692 GAGAGGCTCTGCCCCCACCTGGG - Intergenic
1160846449 19:1168230-1168252 GAGAGCTCCTGCATCCACCTGGG + Intronic
1160881639 19:1323455-1323477 GAGGCTCCCTGCCCCCACCTGGG - Intergenic
1161505498 19:4641196-4641218 AAAAGACCCCTCACCCACCTGGG - Intronic
1161542603 19:4861145-4861167 GAGATTCCCCCCTCCCAACTGGG + Intronic
1162915864 19:13874027-13874049 GGGAGTCCGCGCAGCCACGTGGG - Intronic
1165212801 19:34249187-34249209 GTGAGTCACCGCACTCCCCTGGG + Intergenic
1166094126 19:40529197-40529219 GGGCGTCCCCACCCCCACCTCGG - Intronic
1168693920 19:58394591-58394613 CGGAGTGCCCTCACCCACCTTGG - Exonic
1202692625 1_KI270712v1_random:102124-102146 CAGAGCCCCCACACCCACCGTGG - Intergenic
927509983 2:23638495-23638517 GAGGGTCCCACCATCCACCTAGG + Intronic
927819922 2:26255215-26255237 GTGAGCCCCCGCACCCAGCCTGG - Intronic
928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG + Intronic
928379119 2:30802874-30802896 GGGAATCCCCACGCCCACCTAGG + Intronic
928409122 2:31040710-31040732 GAGAGTCCTCCCATTCACCTAGG - Intronic
928688592 2:33775622-33775644 CAGAGTCCCCCCACCCCCATGGG + Intergenic
930196739 2:48517962-48517984 GTGAGCCACCGCACCCAGCTAGG + Intergenic
932745201 2:74328287-74328309 GAGCGTCCCTCCCCCCACCTTGG - Intronic
933953777 2:87351840-87351862 CAGAGCCCCCACACCCACCGTGG + Intergenic
934237982 2:90248094-90248116 CAGAGCCCCCACACCCACCGTGG + Intergenic
934275220 2:91568643-91568665 CAGAGCCCCCACACCCACCGTGG - Intergenic
934322110 2:91980643-91980665 CAGAGCCCCCACACCCACCGTGG + Intergenic
934460394 2:94211429-94211451 CAGAGCCCCCACACCCACCGTGG + Intergenic
935383120 2:102473666-102473688 GAGAGTGACTGCATCCACCTGGG - Exonic
938576093 2:132606021-132606043 GATTCTCCCCCCACCCACCTGGG - Intronic
947612614 2:231533179-231533201 GAGAGTCGCTGTACCCATCTGGG + Intergenic
947746185 2:232508464-232508486 GAGGGTCCCAGGGCCCACCTGGG - Intergenic
948588384 2:239035260-239035282 GAGACTCCCCCCACCCCCCTGGG - Intergenic
948948894 2:241236335-241236357 CACAGCCCCCGCACCCACCGTGG + Intronic
1169730126 20:8777434-8777456 GTGAGCCACCGCACCCAGCTGGG - Intronic
1171367197 20:24633407-24633429 CAGAGTCCCAGCACCCAGCACGG + Intronic
1174455216 20:50643993-50644015 GTGAGCCACCGCACCCAGCTGGG + Intronic
1175886099 20:62291830-62291852 GGGAGGCCCCACACACACCTGGG + Intronic
1175886111 20:62291860-62291882 GGGAGGCCCCACACACACCTGGG + Intronic
1175886123 20:62291890-62291912 GGGAGGCCCCACACACACCTGGG + Intronic
1176591527 21:8654468-8654490 CAGAGCCCCCACACCCACCGTGG + Intergenic
1176796066 21:13371958-13371980 CAGAGCCCTCGCACCCACCATGG - Intergenic
1178809239 21:35866347-35866369 GGGAGTCCCCGTGCCCAGCTTGG - Intronic
1178980813 21:37263045-37263067 GTGAGTCACCGCACCCAGCTGGG + Intronic
1179591995 21:42415026-42415048 GAGAGTCCCCTCCACCCCCTCGG - Intronic
1180274374 22:10631580-10631602 CAGAGCCCCCACACCCACCGTGG + Intergenic
1180539436 22:16429105-16429127 AAGAGTCTCCGCACCCCACTTGG - Intergenic
1180548858 22:16526559-16526581 CAGAGCCCCCACACCCACCGTGG + Intergenic
1181269213 22:21649191-21649213 GAGAGCCACTGCACCCAGCTGGG - Intergenic
1181355852 22:22295326-22295348 CAGAGCCCCCACACCCACCGTGG - Intergenic
1181538276 22:23558419-23558441 GTGAGCCACCGCACCCAGCTTGG - Intergenic
1182548792 22:31090325-31090347 AAGTGTCCCCGCCCCCAGCTAGG + Intronic
1183578307 22:38706332-38706354 CATGGTCCCCGCACCCACCTTGG + Intronic
1184656367 22:45944027-45944049 CAGAGTCCCAGCCCCCACCTCGG + Intronic
952529694 3:34250586-34250608 GTGAGTCACCGCACCCAGCCTGG - Intergenic
953673932 3:44985566-44985588 GCGAGACCACGAACCCACCTCGG - Intronic
953941468 3:47102506-47102528 GTGAGCCTCCGCACCCAGCTGGG - Intronic
954990504 3:54836964-54836986 GACAGTCCCAGCCCCCAGCTGGG - Intronic
956796763 3:72724859-72724881 GTGAGCCACCGCACCCAGCTGGG + Intergenic
957053309 3:75426427-75426449 GTGAGCCCCCACGCCCACCTGGG - Intergenic
957290158 3:78268895-78268917 GAGAGTGGCCCCACCCACCTGGG - Intergenic
960669785 3:120144982-120145004 GTGAGCCACCGCACCCAGCTGGG - Intergenic
961324958 3:126104442-126104464 GAGAGGACCAGCACCCTCCTGGG - Intronic
961333285 3:126155384-126155406 GAGGGACCCAGCACTCACCTTGG + Exonic
966426285 3:179783025-179783047 GTGAGTCACCGCACCCGGCTGGG + Intronic
966731051 3:183151708-183151730 GTGAGCCACCGCACCCAGCTGGG + Intronic
967856942 3:194125146-194125168 GTGAGCCACCGCACCCAGCTGGG + Intergenic
975786806 4:77898774-77898796 GTGAGCCACCGCACCCAGCTTGG + Intronic
976317603 4:83675553-83675575 GAGAGTCCTGACATCCACCTTGG - Intergenic
977944897 4:102901278-102901300 AAGAGTCTCCGCACCCCACTTGG - Exonic
980131449 4:128819898-128819920 GAGTGCCCCTCCACCCACCTGGG + Intronic
982731088 4:158956281-158956303 GTGAGCCACCGCACCCAGCTAGG - Intronic
985677447 5:1239349-1239371 GAGTGTCCCCAAAGCCACCTTGG + Intronic
987359473 5:17093742-17093764 GTGAGTCACCGCACCCAGCCAGG - Intronic
987846376 5:23292294-23292316 GAGAGCCACCGCACCCAGCCTGG + Intergenic
991911251 5:71563628-71563650 GTGAGCCACCGCACCCAGCTGGG - Intronic
994310006 5:98258910-98258932 GAGATTCCCCAGACCCACCACGG - Intergenic
997739335 5:136239920-136239942 TAGAATCCCAGCACCCAGCTTGG + Intronic
999244250 5:150144876-150144898 CTGAGTCCCCCCACCCACCCCGG + Intronic
999313473 5:150568887-150568909 GGGACTCCCCCCACCTACCTGGG - Intergenic
1000039483 5:157474421-157474443 GGGAGGCCCTGCACCAACCTCGG - Exonic
1001010223 5:168090765-168090787 CAGAGACCCCACACCTACCTAGG - Exonic
1004664537 6:17737372-17737394 GAGAGCCACCGCTCCCAGCTTGG + Intergenic
1007366529 6:41398030-41398052 GAGAGTCCCTGCACCCACCATGG + Intergenic
1010579394 6:77575393-77575415 GTGATTCCCCCCACCCACCTCGG + Intergenic
1011514317 6:88135798-88135820 TAGAGTCCCCACCCCCACCCCGG + Intergenic
1011952242 6:92981048-92981070 GTGAGTCACCGCACCCTGCTGGG + Intergenic
1018201512 6:161399598-161399620 GAGAGTTCCCTGACCCACCCCGG - Intronic
1018668994 6:166164312-166164334 GAGAGTCCAAACACCCAGCTAGG + Intronic
1019340327 7:505889-505911 GTGAGCCACCGCACCCAGCTGGG - Intronic
1019705766 7:2496538-2496560 AGGTGTCCCCGCCCCCACCTTGG + Intergenic
1022576032 7:31498020-31498042 GTGAGCCACCGCACCCAGCTGGG - Intergenic
1023596487 7:41834420-41834442 GTGAGCCACCGCACCCAGCTGGG + Intergenic
1023618224 7:42042690-42042712 GAGAGGCCCCTCACCCTCTTTGG - Intronic
1023725115 7:43135371-43135393 TAGAGTGCCAGCAGCCACCTTGG + Intronic
1023941025 7:44768416-44768438 GAGAGCCCACCCACCCACCTCGG - Exonic
1024090794 7:45938434-45938456 CAGAGTGCCAGCACCCAGCTCGG + Intergenic
1024314845 7:48006268-48006290 GGGAGTCCCTGAACACACCTTGG - Intronic
1025834525 7:65082054-65082076 GTGAGCCACCGCACCCTCCTGGG + Intergenic
1026062369 7:67037684-67037706 CAGAGTCGCCGCACCCAGCCTGG - Intronic
1026326091 7:69312054-69312076 GTGAGCCACCGCACCCAGCTTGG - Intergenic
1032963409 7:137067185-137067207 GGGATTCCCCACAGCCACCTAGG - Intergenic
1035290470 7:157834754-157834776 GTGGGTCCCCACACCCGCCTGGG - Intronic
1036225322 8:6953139-6953161 GAGGGACCCCTCACCTACCTTGG + Intergenic
1037355569 8:18016168-18016190 GTGAGCCACCGCACCCAGCTGGG + Intronic
1038267791 8:26049642-26049664 GAAAGTCACCCCTCCCACCTGGG - Intergenic
1038567734 8:28634035-28634057 GACAGTCCCAGCATCCACATGGG + Intronic
1039047481 8:33463220-33463242 GTGAGCCACTGCACCCACCTGGG - Intronic
1039839518 8:41283982-41284004 GAGAGTCCCCTGGCCCAGCTAGG - Intronic
1040449515 8:47530294-47530316 GAGTGTCACCACACCCAGCTGGG - Intronic
1041090463 8:54296943-54296965 AAGAGGCCCCACACCCACTTGGG - Intergenic
1042525054 8:69756139-69756161 GTGAGTCACCGCGCCCAGCTGGG - Intronic
1045025727 8:98084661-98084683 GTGAGCCACCGCACCCAGCTGGG + Intronic
1048073078 8:131041141-131041163 GAGAGTCCCCACACCCCCTCCGG - Exonic
1048680851 8:136840076-136840098 GTGAGTCACTGCACCCAGCTTGG - Intergenic
1049279408 8:141736751-141736773 GGGAATCCACGCATCCACCTTGG + Intergenic
1049470720 8:142774021-142774043 GGGAGTCCACACACCCAGCTGGG + Intronic
1050261140 9:3842189-3842211 GTGAGCCACCGCACCCAGCTGGG - Intronic
1052907150 9:33845528-33845550 GTGAGCCACCGCACCCAGCTTGG + Intronic
1053432810 9:38054390-38054412 GAGACTCCCCAAATCCACCTGGG + Intronic
1053690893 9:40587126-40587148 CAGAGTCCCCACACCCACCGTGG + Intergenic
1054273910 9:63050365-63050387 CAGAGCCCCCACACCCACCGTGG - Intergenic
1054302152 9:63388097-63388119 CAGAGCCCCCACACCCACCGTGG + Intergenic
1054400930 9:64714603-64714625 CAGAGCCCCCACACCCACCGTGG + Intergenic
1054434536 9:65198917-65198939 CAGAGCCCCCACACCCACCGTGG + Intergenic
1054495854 9:65822764-65822786 CAGAGCCCCCACACCCACCGTGG - Intergenic
1057354774 9:94323985-94324007 GTGAGCCACCGCACCCACCCTGG - Intronic
1057652985 9:96933652-96933674 GTGAGCCACCGCACCCACCCTGG + Intronic
1057927885 9:99169242-99169264 GAAAGTTCCTGCACTCACCTGGG - Intergenic
1060118433 9:120965239-120965261 GTGAGCCACCGCACCCAGCTGGG - Intronic
1060541121 9:124430966-124430988 GTGAGCCACCGCACCCAGCTTGG - Intergenic
1061741590 9:132710506-132710528 CAGAGTCCCCCCACCCACCCAGG - Intergenic
1062438123 9:136556085-136556107 GTGAGCCACCGCACCCAGCTCGG + Intergenic
1203621552 Un_KI270749v1:133232-133254 CAGAGCCCCCACACCCACCGTGG + Intergenic
1187618779 X:21027562-21027584 GAGAGTCCTAGTACTCACCTGGG - Intergenic
1188650070 X:32621605-32621627 GCGAGTCCCCGAACCCAGCCAGG + Intronic
1189363415 X:40370405-40370427 GAGAGGCCCCACAGCCACCAAGG - Intergenic
1190734951 X:53250084-53250106 GAGAGTCCCTTAACACACCTGGG - Intronic
1194237439 X:91401423-91401445 GTGAGTCACCACACCCAGCTAGG + Intergenic
1195045709 X:101052706-101052728 GTGAGCCACTGCACCCACCTCGG - Intergenic
1195082420 X:101384313-101384335 GTGAGCCACCGCACCCACCCTGG - Intronic
1196085186 X:111676779-111676801 GTGAGTCACCACACCCAGCTTGG + Intronic
1199681210 X:150225783-150225805 GAGAGTGCCCGCATCCTCCAAGG - Intergenic
1201189594 Y:11435822-11435844 CAGAGCCCCCACACCCACCGTGG + Intergenic
1202584050 Y:26406152-26406174 CAGAGCCCCCACACCCACCGTGG - Intergenic