ID: 1122942055

View in Genome Browser
Species Human (GRCh38)
Location 14:104985874-104985896
Sequence GAGAGTCCCCGCACCCACCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 240}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122942055_1122942062 5 Left 1122942055 14:104985874-104985896 CCAAGGTGGGTGCGGGGACTCTC 0: 1
1: 0
2: 1
3: 14
4: 240
Right 1122942062 14:104985902-104985924 CCGTGGGCCAGGCGCTTAGCCGG 0: 1
1: 0
2: 0
3: 8
4: 176
1122942055_1122942067 26 Left 1122942055 14:104985874-104985896 CCAAGGTGGGTGCGGGGACTCTC 0: 1
1: 0
2: 1
3: 14
4: 240
Right 1122942067 14:104985923-104985945 GGCCACCTCGGGCCCTGTCCAGG 0: 1
1: 1
2: 0
3: 25
4: 205
1122942055_1122942065 15 Left 1122942055 14:104985874-104985896 CCAAGGTGGGTGCGGGGACTCTC 0: 1
1: 0
2: 1
3: 14
4: 240
Right 1122942065 14:104985912-104985934 GGCGCTTAGCCGGCCACCTCGGG 0: 1
1: 0
2: 1
3: 4
4: 48
1122942055_1122942064 14 Left 1122942055 14:104985874-104985896 CCAAGGTGGGTGCGGGGACTCTC 0: 1
1: 0
2: 1
3: 14
4: 240
Right 1122942064 14:104985911-104985933 AGGCGCTTAGCCGGCCACCTCGG 0: 1
1: 0
2: 0
3: 1
4: 47
1122942055_1122942060 -6 Left 1122942055 14:104985874-104985896 CCAAGGTGGGTGCGGGGACTCTC 0: 1
1: 0
2: 1
3: 14
4: 240
Right 1122942060 14:104985891-104985913 ACTCTCGGGAGCCGTGGGCCAGG 0: 1
1: 0
2: 1
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122942055 Original CRISPR GAGAGTCCCCGCACCCACCT TGG (reversed) Exonic