ID: 1122946150

View in Genome Browser
Species Human (GRCh38)
Location 14:105011041-105011063
Sequence GCCTAGGGCTGCAGCCCCAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 239}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122946134_1122946150 27 Left 1122946134 14:105010991-105011013 CCAGAACAGCCTCTGCCTGGCGC 0: 1
1: 0
2: 2
3: 9
4: 219
Right 1122946150 14:105011041-105011063 GCCTAGGGCTGCAGCCCCACTGG 0: 1
1: 0
2: 2
3: 26
4: 239
1122946136_1122946150 18 Left 1122946136 14:105011000-105011022 CCTCTGCCTGGCGCTCCACAGGG 0: 1
1: 0
2: 4
3: 30
4: 423
Right 1122946150 14:105011041-105011063 GCCTAGGGCTGCAGCCCCACTGG 0: 1
1: 0
2: 2
3: 26
4: 239
1122946141_1122946150 12 Left 1122946141 14:105011006-105011028 CCTGGCGCTCCACAGGGGGGAGG 0: 1
1: 0
2: 1
3: 16
4: 194
Right 1122946150 14:105011041-105011063 GCCTAGGGCTGCAGCCCCACTGG 0: 1
1: 0
2: 2
3: 26
4: 239
1122946145_1122946150 3 Left 1122946145 14:105011015-105011037 CCACAGGGGGGAGGTGAGTGGGA 0: 1
1: 0
2: 2
3: 24
4: 365
Right 1122946150 14:105011041-105011063 GCCTAGGGCTGCAGCCCCACTGG 0: 1
1: 0
2: 2
3: 26
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122946150 Original CRISPR GCCTAGGGCTGCAGCCCCAC TGG Exonic
900181061 1:1311189-1311211 GCCCAGGGCTGCAGTCCCTCAGG + Intronic
900519145 1:3097331-3097353 GCCGAGGGCTGCATCTCCAAAGG + Intronic
900528202 1:3139494-3139516 GCCTGGGTCTGCAGCCCCCGAGG - Intronic
901069058 1:6508231-6508253 ATCCAGGGCTGCAGCCCCTCAGG - Intronic
901216608 1:7558721-7558743 GCCTGGGGCTGCAGACACAGGGG - Intronic
901512228 1:9723132-9723154 CCCTATGGCTGCCTCCCCACCGG + Exonic
903553418 1:24175303-24175325 GGATAGGGCTGCCGCCCCAGTGG + Intronic
903687184 1:25140417-25140439 TCATAGAGCTGGAGCCCCACAGG + Intergenic
904454087 1:30636500-30636522 GCCTGGGGCTCCTGCCTCACTGG - Intergenic
904605668 1:31696380-31696402 GCCTTGGGCTGCAGGAACACAGG - Intronic
905933229 1:41804373-41804395 GCCCAGTGCTGCAGGCACACGGG + Intronic
906147488 1:43568691-43568713 GCCTTGCCCTGCAGCCCCTCGGG + Intronic
908174148 1:61537846-61537868 GCCTAGGGCTGCACCCTCTCAGG - Intergenic
910936390 1:92486550-92486572 TCCTAGGGCTGCACCACCCCCGG + Intronic
912706776 1:111920603-111920625 GCCCTGGGCTGGACCCCCACAGG - Intronic
913193478 1:116433257-116433279 GCCTTGGGCTGCAGCTGCCCTGG - Intergenic
914828856 1:151156192-151156214 GACCAGGGCTGCTGCACCACAGG - Intergenic
914921754 1:151852115-151852137 GCCTGGGGCTGCAGCATCAGGGG + Intronic
915734309 1:158075123-158075145 GCCTAGGCCTGCCCCACCACTGG + Intronic
919762988 1:201110115-201110137 GCCTGGGGCTGCAGGCTCGCAGG + Intronic
922796625 1:228342744-228342766 GCCTTGGGCTCCAGCCCTTCTGG + Intronic
923098631 1:230794994-230795016 ACCAAGGGCAGCAGTCCCACTGG + Intronic
923464305 1:234234525-234234547 TCCTAGTGCTGCTGGCCCACAGG + Intronic
923778880 1:237004218-237004240 GCCCAGGGCTGCATCCGCAAAGG - Exonic
1062768908 10:84765-84787 ACCTAAGGCTGAAGCCCCATGGG + Intergenic
1063371592 10:5525920-5525942 GCTGAGGGCTGCAGCCCCCCTGG - Exonic
1063978778 10:11437509-11437531 TCCTAAGGCTGGAGTCCCACTGG + Intergenic
1064627872 10:17279967-17279989 GCTTATGGCTGGAGGCCCACAGG + Intergenic
1065766931 10:29039031-29039053 GCCCAGGCCTGCAGCCCAAAGGG - Intergenic
1065778226 10:29142625-29142647 GGCTAGGGCTCCACCCCCACGGG + Intergenic
1067134592 10:43596450-43596472 ACCCGGGGCTCCAGCCCCACAGG + Intergenic
1067432467 10:46253141-46253163 CCCTGGGGCTCCAGCCTCACCGG - Intergenic
1069745675 10:70713448-70713470 CCCTGGGGCTCCTGCCCCACTGG - Intronic
1073132052 10:101196005-101196027 GCCAAGGCCTCCAGCCCCAATGG + Intergenic
1074147303 10:110728252-110728274 GCCTAGGTCTCCAGCCTCTCTGG + Intronic
1075446879 10:122519332-122519354 CTCTGGGGCTGCAGCTCCACAGG + Intergenic
1075563129 10:123482878-123482900 GCCTAGAGCAGAAGCCCCAAAGG - Intergenic
1076030019 10:127149498-127149520 GCCTGGGGCTTTAGCACCACAGG - Intronic
1076458714 10:130623533-130623555 GCTTGCGGCTTCAGCCCCACAGG - Intergenic
1077177550 11:1197587-1197609 GCCTGTGCCTGCAGCCCCACAGG + Intronic
1077312579 11:1897068-1897090 GCATGGAGCTGCAGCCCCTCTGG - Intergenic
1078146187 11:8723169-8723191 GCCCACGGCAGCAGCCACACTGG - Intronic
1078354754 11:10625371-10625393 GCATAGGGTGGCAACCCCACAGG + Intronic
1080237709 11:30091530-30091552 TCCTAGGGCTGGAGCACCATTGG + Intergenic
1080302012 11:30794915-30794937 TCCTGGGGCTGCAGCTGCACTGG + Intergenic
1081117590 11:39223285-39223307 GTCTAAGGTTGCAGTCCCACTGG - Intergenic
1081778664 11:45694730-45694752 CCCTGGGGCTTCAGACCCACAGG + Intergenic
1081973390 11:47215215-47215237 GCCTCGGGCTCCAGCTCCAGGGG - Exonic
1083006899 11:59355425-59355447 CCCTAGGCCTGGGGCCCCACAGG + Intergenic
1083199519 11:61111769-61111791 GCCCAGGGCAGCAGACCCTCGGG - Intronic
1083660832 11:64251189-64251211 GACTAGGGCTGCAGTACCAGCGG - Intergenic
1083719672 11:64598138-64598160 CCCTAGGGCTACAGGACCACTGG - Intronic
1084711399 11:70846110-70846132 GCCTGGGGGTGCTGTCCCACTGG - Intronic
1084891135 11:72237690-72237712 CCCTGGAGCTGCAGCCCCCCCGG + Exonic
1085335486 11:75690671-75690693 GGCTGGGGCCGCAGTCCCACAGG + Intergenic
1085361314 11:75890109-75890131 GCCTAGCTCTCCAGCCCCATCGG - Intronic
1088238493 11:107750183-107750205 GTCTAGGGGTGAAGCCCCAGTGG + Intergenic
1088598856 11:111458319-111458341 GGACAGGGCTGCAGCCCTACTGG + Intergenic
1090287418 11:125512004-125512026 ACCTGGGGCTCCAGCCCCACAGG - Intergenic
1091093402 11:132793761-132793783 GCCTAGGGCAGTAGTCCCATGGG - Intronic
1091219237 11:133920504-133920526 GCCTTGGGCTGCAGACTCTCGGG + Exonic
1091316674 11:134618781-134618803 GCCCAGGGCTGCAGCTCCTTTGG - Intergenic
1091538281 12:1434583-1434605 GCAAAGGGGGGCAGCCCCACTGG - Intronic
1091773750 12:3170773-3170795 GCCTCAGCCAGCAGCCCCACAGG - Intronic
1092416138 12:8291846-8291868 GCCTTGGGCTGGAGTCCCAGGGG + Intergenic
1095955236 12:47802229-47802251 GCCCACTACTGCAGCCCCACTGG - Exonic
1096548794 12:52359018-52359040 CCAAAGGGCTGTAGCCCCACTGG - Intergenic
1097920251 12:65064382-65064404 CTCTAGGGCTGAGGCCCCACTGG + Intronic
1102344001 12:112146797-112146819 GCCTAGTGGTGCAGACCAACAGG - Intronic
1103904234 12:124319292-124319314 CCCAAGAGCTGCTGCCCCACAGG - Intergenic
1104462983 12:128970182-128970204 CCCTAAGGCTGCAGCCCACCGGG - Intronic
1104959368 12:132480936-132480958 CCCTAGGGGTGCAGCCTCACTGG - Intergenic
1106229791 13:27813003-27813025 GCCTAGGTCTGCAGTCACCCTGG - Intergenic
1106473708 13:30079408-30079430 GCCTCGGGCTGCAGCCAGATTGG + Intergenic
1107597637 13:41979871-41979893 GCCAAGGGCTCCAACCCTACAGG + Intergenic
1108737161 13:53296454-53296476 TCCTGGGAATGCAGCCCCACAGG - Intergenic
1112366568 13:98760768-98760790 ACCCAGGGCTTCAGCCCCACTGG - Intergenic
1113552056 13:111200170-111200192 GCCTTGGGCTGCGGCCTCTCTGG + Intronic
1113834207 13:113318213-113318235 GCCTATGACTGCACCCCAACGGG - Intronic
1118476812 14:66125126-66125148 GCCTTTGGCTGCAGCACCACAGG - Intergenic
1118745576 14:68770673-68770695 GCCCAGGGCTGAAGCACCGCTGG - Intergenic
1119296850 14:73539578-73539600 GCCTAGGGCTTCACACCCATGGG + Intronic
1119530794 14:75359767-75359789 TCCTGGGGCTGCTTCCCCACCGG + Intergenic
1119618352 14:76113187-76113209 GTCGTGTGCTGCAGCCCCACGGG + Intergenic
1122202855 14:100133005-100133027 GCCTCAGGCTGCAGCTCCAAGGG - Intronic
1122252577 14:100450232-100450254 ACATAGGGCTCCAGCCACACTGG + Intronic
1122923191 14:104888339-104888361 GCCTAGGGCCTCAGGCCCATGGG - Intronic
1122946150 14:105011041-105011063 GCCTAGGGCTGCAGCCCCACTGG + Exonic
1123996411 15:25720992-25721014 GCCTGGGGCTGCAGCGCCCTGGG - Intronic
1124212474 15:27775132-27775154 GCCCAGGGCGCCAGCCCCAGAGG - Intronic
1127165755 15:56243742-56243764 GCCTGGGGCTGCAGCAGCACGGG - Intergenic
1128965149 15:72051403-72051425 GCCTGGGTCTGCAGCCCACCTGG - Intronic
1129682346 15:77664839-77664861 GCCACGGCCAGCAGCCCCACAGG - Intronic
1129785304 15:78306253-78306275 CTCTAAGGCTGCAGCCCCACAGG + Intergenic
1130089018 15:80803759-80803781 GTCTTGGGCTCCAGACCCACAGG + Intronic
1130254048 15:82317629-82317651 GCCTCGGGCTGGAAGCCCACAGG - Intergenic
1131568421 15:93506883-93506905 GCCTGGGGCTCCTGTCCCACTGG + Intergenic
1132215648 15:100059800-100059822 GCCTGGAGCTGCAGCCTCATGGG - Intronic
1132506499 16:312229-312251 GCTGAGGGCAGCTGCCCCACCGG + Intronic
1132716751 16:1294193-1294215 GTCTGGGAATGCAGCCCCACAGG + Intergenic
1132814202 16:1818141-1818163 GCCTGGGGCTTCTGCTCCACAGG + Intronic
1132981845 16:2742356-2742378 GCCCAGGCCAGCAGCCCCATGGG - Intergenic
1136285151 16:29236401-29236423 GCCCAGGCCTGCAGCCCCCAGGG + Intergenic
1138252725 16:55516227-55516249 GCCTATTGCTGCAGCCACTCAGG - Intronic
1139391598 16:66609203-66609225 GCTTAGGACAGCAGCCCCGCTGG + Intronic
1139959246 16:70708299-70708321 GCCTAGGGCTGGGCCCCTACAGG + Intronic
1140137518 16:72220747-72220769 GCCTAGGGCACCAGATCCACAGG - Intergenic
1140455899 16:75105357-75105379 GCCCAGTGCTGTGGCCCCACAGG - Intronic
1142090214 16:88206025-88206047 GCCCAGGCCTGCAGCCCCCAGGG + Intergenic
1142379655 16:89724070-89724092 GCCCAGGGCAGCAGCCGCAGAGG - Intronic
1144765515 17:17730457-17730479 GCCATGGGCTGCATCCCCATGGG - Intronic
1146654419 17:34626705-34626727 GCCTCGGGCTCCAGCCCGTCCGG - Intronic
1146655064 17:34630173-34630195 GCCTAGGGCTTCTTCCCCAGGGG - Intronic
1148822464 17:50367535-50367557 AGCTGGGGCTGCAGCCCCAGAGG - Intergenic
1151805916 17:76405343-76405365 GACCAGGGCTGCTGCACCACGGG - Intronic
1152722609 17:81930220-81930242 GCCAGGGGCTGCTGACCCACTGG + Intergenic
1152904810 17:82964653-82964675 GCCTACAGGTGCACCCCCACGGG + Intronic
1152941240 17:83173821-83173843 AGCAAGGGCTGCAGGCCCACAGG + Intergenic
1153223328 18:2880467-2880489 GCCCAGGGTTACAGCCCCAAGGG + Intronic
1153326183 18:3822714-3822736 GCCTAGGTCTGCAGTCCCCAAGG + Intronic
1155221336 18:23689063-23689085 GCCTGTGGCTGCAGTGCCACAGG + Intergenic
1157854424 18:51092123-51092145 ACCTAGGGCTGCTGGGCCACTGG + Intergenic
1157966873 18:52218364-52218386 TCCCAGAGCTGCAGCCACACTGG + Intergenic
1159023941 18:63166038-63166060 GGCCAGGGTTGCAGACCCACAGG + Intronic
1159232824 18:65630771-65630793 GCCTAGGGTTGCTGCCACACAGG + Intergenic
1159960918 18:74555341-74555363 ACCAAGGGCTGCAGCCCCCTTGG + Intronic
1160439054 18:78875185-78875207 CCCTGGGGATGCAGCTCCACAGG - Intergenic
1161100167 19:2417770-2417792 TGCTAGGGCGGCAGCCCCATGGG + Intronic
1161322644 19:3648483-3648505 GCCTGGGTCTGCAGTCCCACAGG - Intronic
1161322654 19:3648511-3648533 GCCCGGGTCTGCAGCCCCACAGG - Intronic
1161322664 19:3648539-3648561 GCCCGGGTCTGCAGCCCCACAGG - Intronic
1164853806 19:31505189-31505211 GGCTGGGGCCGCAGCCCTACAGG - Intergenic
1165169486 19:33881441-33881463 GACTGGGCCTCCAGCCCCACTGG + Intergenic
1168600086 19:57710529-57710551 GCCTAGGGCTCCAACCCAGCAGG + Intronic
925688562 2:6496530-6496552 CCCTAAGGCTGCCTCCCCACTGG - Intergenic
926013716 2:9429229-9429251 GCCAAGGCCGGCAGCCCCAGTGG - Intronic
926682417 2:15674083-15674105 GCCACAGGCTGCAGCCCCGCTGG + Intergenic
927847746 2:26480133-26480155 GCCTAGGCCTGAAGCCCCCGTGG + Intronic
928387081 2:30879791-30879813 GCCTAGGGTTCCAGCCCCTAAGG - Intergenic
931696994 2:64878796-64878818 GCCAAGGGCTGGAGCACCAAGGG - Intergenic
931977427 2:67658056-67658078 GCCAAGGACTGCAGACACACAGG - Intergenic
932432919 2:71686220-71686242 GCCTAGTGCTCCAGCCCATCAGG - Intronic
932490068 2:72114746-72114768 GCCCAGGGCTGCAGAGCCGCAGG - Intergenic
933262491 2:80146207-80146229 GGCTAGGGCTGCAGAACAACTGG - Intronic
933966967 2:87437930-87437952 GCTTACTGCTGCAGCCCCAGGGG - Intergenic
934779301 2:96959594-96959616 GCCCTGGCCTCCAGCCCCACAGG + Intronic
936326830 2:111512567-111512589 GCTTACTGCTGCAGCCCCAGGGG + Intergenic
936905949 2:117536020-117536042 GCCTAGGACCCCAGCTCCACAGG - Intergenic
937098746 2:119252467-119252489 GGCTAATGCTGCAGCCTCACTGG + Intronic
937815981 2:126251278-126251300 CCCCAGGGCTGCAGCAGCACTGG + Intergenic
938101469 2:128500614-128500636 GCTTAGGGATGCAACCGCACAGG + Intergenic
938638687 2:133256818-133256840 GATGAGGGCTGCAGCCCCAAAGG - Intronic
946147047 2:217738884-217738906 TCTGAGGGCTGCAGCCCCATGGG + Intronic
947432962 2:230046626-230046648 GCCCAGGGCCTCAGCACCACGGG - Exonic
947590618 2:231383144-231383166 GCCAAGGGCTCCAGCCGCAGTGG + Intergenic
947624688 2:231612322-231612344 GACCAGGGCTCCAGCCCCAGGGG - Intergenic
948156434 2:235787080-235787102 GCCTGGGGCCGTGGCCCCACAGG + Intronic
948647961 2:239420628-239420650 GCCTTGGGCTGCATCTGCACAGG - Intergenic
948733376 2:239981254-239981276 GCCCATGGATGGAGCCCCACAGG + Intronic
948987589 2:241534738-241534760 GCCAACGGGTGCAGCCCCAGAGG + Intergenic
1170527624 20:17256769-17256791 CCCTAGCTCTGCAACCCCACAGG + Intronic
1170568698 20:17620993-17621015 GCCTGGCACTGCAGCCACACTGG - Intronic
1170819855 20:19747733-19747755 GCCTCTAGCTGCAGCCCCAGTGG + Intergenic
1173789992 20:45822371-45822393 TCACAGGGCTGCAGCCACACTGG - Intergenic
1173977179 20:47195809-47195831 GCCTTGGCCTCCAGCCACACCGG - Intergenic
1174112265 20:48204992-48205014 GCCCAGGGCAGCAGCTCCAGGGG - Intergenic
1176098226 20:63353749-63353771 CCCTAGGACTACAGCCCCCCAGG - Intronic
1179217537 21:39380514-39380536 GACTGGGGCGGCATCCCCACCGG - Intronic
1179657411 21:42853779-42853801 TACTAGGACTGCAGGCCCACGGG + Intronic
1179886362 21:44315878-44315900 GCACAGGGCTGCAGCTCCACGGG - Intronic
1180600065 22:17009699-17009721 GCCTAGGGCTCCAACCCAATAGG - Intergenic
1180700649 22:17779800-17779822 GCCTCGGGCTGCAGCCACAGAGG - Intergenic
1181163244 22:20969745-20969767 GCCTCTGGCTACAGCCCCACAGG - Intronic
1181415013 22:22753118-22753140 GCCTGGGGCTGAAGCCACTCAGG - Intronic
1184533924 22:45073585-45073607 GCCTCGGGCTCCAGCCCTCCAGG - Intergenic
1184683966 22:46087710-46087732 GTCTAGGGCTCCAGCCCCTCTGG - Intronic
1185031451 22:48445543-48445565 GCCTAGCTCTGCAGCCCCGCTGG + Intergenic
1185078943 22:48698758-48698780 GCCTCGGGGTGCAGCCCGTCTGG + Intronic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
949869110 3:8571689-8571711 TCCTAAGGCGGAAGCCCCACTGG - Intergenic
950208170 3:11096116-11096138 GCTTAGTTCTGCAGCCCCAACGG - Intergenic
950267838 3:11588424-11588446 CCCCTGGGCTGCAGCCCAACTGG - Intronic
953559526 3:43975801-43975823 GGCCAGGGCTGCAGTCCCTCTGG + Intergenic
954411516 3:50373335-50373357 GGCTGGGGCTCCGGCCCCACCGG - Intronic
960180974 3:114577548-114577570 GCCTATGGCTTCAGCACCATGGG - Intronic
961458360 3:127035260-127035282 GCCTCAGGCTCCAGCCCCAGTGG + Exonic
961716284 3:128859607-128859629 GCCTGGGGCTCCAGTTCCACAGG + Intergenic
962134770 3:132722243-132722265 GCCTTGGGCTTCACCTCCACCGG + Exonic
967134698 3:186503559-186503581 TCCTGGGGCTGCAGCCCAGCAGG + Intergenic
967572636 3:191048859-191048881 GCCTAAGGCTGTACCCCCCCGGG - Intergenic
967981979 3:195071264-195071286 GCCTGGAGATGCTGCCCCACCGG + Intronic
968215430 3:196885780-196885802 GCCAAGGGCCGGAGCACCACAGG + Exonic
968739933 4:2322355-2322377 GCCCATGGCTACAGCCCGACAGG + Intronic
969108745 4:4828240-4828262 GCTTGGGGCTGGAGGCCCACAGG - Intergenic
969754247 4:9137981-9138003 GCCAAGGGCTGCAGACTCTCTGG + Intergenic
969814142 4:9674257-9674279 GCCAAGGGCTGCAGACTCTCTGG + Intergenic
971336175 4:25726019-25726041 TCCTACGGATGCAGCCCAACAGG + Intergenic
972479585 4:39485193-39485215 GTCTGGGGCTCCAGCCCCACAGG - Intergenic
973194094 4:47419860-47419882 GCTTAGTTCTGCAGCCCCAAGGG - Intronic
973197571 4:47463370-47463392 GCCTAGAGGTGCAGCTCCAGGGG - Intronic
983530415 4:168804577-168804599 GCCTAGGGCTGCTGCCCCGATGG - Intronic
983576846 4:169270353-169270375 GCCTGGGGCTGCGGCCCGGCCGG + Intronic
986044953 5:4027812-4027834 GCCTAGGACTCCAAACCCACAGG - Intergenic
987076729 5:14389722-14389744 GCATAGGCCTGCAGTCCCAAGGG - Intronic
991491054 5:67182950-67182972 GCCTATGGCTGTAATCCCACAGG + Exonic
991958601 5:72020008-72020030 GCCCAGGGCTGCACCACCAAGGG + Intergenic
994163084 5:96579155-96579177 GCCTAGGACTCCTTCCCCACTGG - Intronic
996634826 5:125677031-125677053 GGGTAGGTCTGCAGACCCACTGG - Intergenic
997895181 5:137709697-137709719 TTATGGGGCTGCAGCCCCACTGG - Intronic
998200496 5:140114332-140114354 GTCTCGTGCTGCAGCCCCCCTGG - Exonic
1001008184 5:168073552-168073574 ACCTAGGGGGGCAGCCCCTCTGG + Intronic
1001052556 5:168424710-168424732 GCCTAGTTCTCCAGCCTCACTGG - Intronic
1001852440 5:174981150-174981172 CCCCAGGGCTGGAGCCTCACTGG + Intergenic
1002202374 5:177537089-177537111 GCCTGGGCCTGCTGCTCCACTGG - Intronic
1003398754 6:5774753-5774775 GGCCAGGGCTGCAGCACCTCGGG + Intergenic
1004074496 6:12332522-12332544 GCCTAGGACTTTTGCCCCACTGG - Intergenic
1004199702 6:13536250-13536272 CCAAAGGGCTGCTGCCCCACAGG - Intergenic
1007382982 6:41502695-41502717 GCCTCTGGCACCAGCCCCACTGG + Intergenic
1011639543 6:89406282-89406304 GGCTAGGGCTGCACCCCCACAGG + Intronic
1012467353 6:99530479-99530501 GCCTAAGGGTTCAGTCCCACAGG + Intergenic
1013016307 6:106163663-106163685 TCCTTGGGCAGCAGCCCCAGGGG - Intergenic
1019287933 7:232920-232942 GGCTGGGGCTGCAGGCCCAGAGG - Intronic
1019323060 7:424402-424424 GCCCAGACCTGCAGCCCCATGGG + Intergenic
1019387274 7:764421-764443 GCCCCGCGCTGAAGCCCCACTGG - Intronic
1019412478 7:912313-912335 GCCTCGGGCCGCAGCCTCAATGG - Intronic
1019700145 7:2470844-2470866 GCCCAGAGCTGCAGCCCCAGTGG - Intergenic
1019742142 7:2680312-2680334 GCCTGGGTCTCCGGCCCCACAGG + Intronic
1020017307 7:4838497-4838519 GCCTGGGGCTGCAGCCCCAGGGG - Intronic
1020213184 7:6170472-6170494 GCCCATGGCAGCAGCCCCTCGGG - Intronic
1020824983 7:13016221-13016243 GGCTAGGGCTCCACCCCCACGGG + Intergenic
1022375350 7:29806822-29806844 GCCCGGGGCTGCAGCCCGGCGGG - Intronic
1022494813 7:30846163-30846185 GCCTGGGGCTGCAGGACCATAGG - Intronic
1022504613 7:30902541-30902563 CCCTGGGGCTGCAGCTCCTCAGG - Intergenic
1024250131 7:47500170-47500192 GCTTCTGTCTGCAGCCCCACAGG - Intronic
1024287435 7:47771400-47771422 GCCTAGGGGTGCATGCCCAATGG + Intronic
1026933595 7:74238844-74238866 GCCCAGCCCTTCAGCCCCACTGG + Intronic
1030884774 7:114923067-114923089 GCCACGCGCTGCGGCCCCACGGG - Exonic
1031928521 7:127661459-127661481 GCCTAGGGATGAAGCTCCTCAGG - Intronic
1032509110 7:132457846-132457868 GCCAAGGAATGCAGCCCCAGAGG + Intronic
1032586232 7:133149409-133149431 GCCCAGGGCTGCTCCACCACTGG - Intergenic
1032841051 7:135713960-135713982 TGCCAGGGCTGAAGCCCCACAGG + Intronic
1033110075 7:138565531-138565553 GCCTGGGGCTCCAGTCTCACAGG + Intronic
1033363673 7:140655663-140655685 GCCCGGGGCTCCAGCCCCATAGG - Intronic
1034348651 7:150402747-150402769 CCCTAGGGACGCAGCCCTACAGG + Intronic
1035305837 7:157930719-157930741 TCCTGGGGCACCAGCCCCACAGG + Intronic
1036690208 8:10940422-10940444 TCCTGGGGCTGCAGCCCTCCTGG - Intronic
1037890000 8:22619022-22619044 GCCTGGGGCTGCAGCCACCATGG + Intronic
1040872615 8:52116551-52116573 GCATGAAGCTGCAGCCCCACTGG + Intronic
1049048329 8:140170824-140170846 GGCCAGGCCTGCAGCCTCACAGG + Intronic
1049200863 8:141339930-141339952 GCCTGGGTCTGCAGCCCTACGGG - Intergenic
1049444640 8:142624392-142624414 GCCGAGGGCTGGAGCCACAGAGG - Intergenic
1049654815 8:143792837-143792859 GCCTGGGCCTGCAGCCTCCCCGG - Exonic
1050204410 9:3181729-3181751 GCTCAGGGCTGCCGCCCCGCTGG - Intergenic
1053411873 9:37921025-37921047 CACCAGGGCTGCAGCCACACTGG + Intronic
1056091471 9:83209523-83209545 GCCAAGGGCTGCAGACCCCTGGG + Intergenic
1056588293 9:87943929-87943951 GCTGAGGGCTGCAGCCCCTGCGG - Intergenic
1057294120 9:93825555-93825577 TCCTAGGGGTGCAGCCGTACAGG - Intergenic
1060956895 9:127648066-127648088 CCCTAGAGCAGCAGCTCCACAGG + Intronic
1060991135 9:127849780-127849802 GCCCAGGGCTTGAGCCCCAGTGG + Intronic
1061954374 9:133953870-133953892 ACCTAGGGATGGAGGCCCACAGG - Intronic
1062333395 9:136054378-136054400 GCGTGGGGCTGCAGCCTCACCGG - Intronic
1062339836 9:136089153-136089175 GCCTGTGGCTGCCGCCCCGCTGG - Intronic
1062379542 9:136280668-136280690 GCCTTGGGCTGGAGCCCTCCTGG - Intergenic
1062396985 9:136356547-136356569 GCCCAGGGCCGCAGCCCACCTGG - Exonic
1062490568 9:136803138-136803160 GCCCAGGGCTGGGGCCCCCCAGG + Intronic
1062490619 9:136803273-136803295 GCCCAGGGCTGGGGCCCCCCAGG + Intronic
1189295132 X:39912458-39912480 GCCCAGGGCTGAAGCCCAAAAGG - Intergenic
1197264189 X:124348430-124348452 ACCTAAGGCTTCAGCCTCACGGG + Intronic