ID: 1122947553

View in Genome Browser
Species Human (GRCh38)
Location 14:105020068-105020090
Sequence ATGTTCCAGTGGCAAGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122947548_1122947553 -4 Left 1122947548 14:105020049-105020071 CCTTCTTTTCCCTGAAAACATGT 0: 1
1: 0
2: 4
3: 48
4: 454
Right 1122947553 14:105020068-105020090 ATGTTCCAGTGGCAAGTTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122947553 Original CRISPR ATGTTCCAGTGGCAAGTTGA GGG Intronic
900630946 1:3634858-3634880 ATGTCACAGTAGCAAGTTTACGG + Intronic
900861638 1:5237370-5237392 ATCTACCTGTGGCAAGTTGGGGG + Intergenic
902720314 1:18299941-18299963 ATGAGCCACTGGCCAGTTGATGG - Intronic
905734263 1:40315254-40315276 ATGTGCCAGAGGCAGGGTGAGGG + Intronic
908539166 1:65106283-65106305 ATGTCCCTGTGGTAAGTTAAGGG - Intergenic
908616612 1:65929395-65929417 ATGTTCCTGTTCCAAGTTGCAGG + Intronic
909955464 1:81773486-81773508 TTATTCCAGAGGCAAGTCGAAGG + Intronic
910634380 1:89390597-89390619 ATGTCCCAGGAACAAGTTGAGGG + Intergenic
914517386 1:148385467-148385489 ATGGTGCAGTGGGAATTTGAAGG + Intergenic
920521870 1:206633809-206633831 ATCTTCCAGAGCCAAGTGGAAGG - Intergenic
920572272 1:207026208-207026230 AAGTTCCAGAGGCAAATGGAAGG - Intronic
921443680 1:215219459-215219481 ATGTTTCAGTGGCACATTTAAGG - Intronic
921625665 1:217375124-217375146 ATGTTCCAGTTGGAACTTCAAGG + Intergenic
922116580 1:222618742-222618764 TTTTCCCAGTGGCAGGTTGATGG + Intronic
1067246672 10:44553243-44553265 ATGTTCCAGTGACATTCTGATGG + Intergenic
1067758265 10:49023421-49023443 ATGTTTCAGTGGAAGGTTTAAGG + Intronic
1070979598 10:80633534-80633556 AGGTTCCAGAGGCAAGTAGGTGG - Intronic
1071615091 10:87067843-87067865 CTGTTCCAGTGACAAGTATAGGG + Intronic
1073563243 10:104514853-104514875 ATGTACGAGTAGAAAGTTGATGG - Intergenic
1073776380 10:106790175-106790197 ATGTTACAGTAACAAATTGAAGG - Intronic
1073776385 10:106790249-106790271 ATGTTACAGTAACAAATTGAAGG - Intronic
1075736245 10:124666345-124666367 AGGTTGCAGTGGCAGGTGGAGGG - Intronic
1076150702 10:128159883-128159905 ATGTTCCCTTTGCAAGTTCAAGG - Intergenic
1080981376 11:37411081-37411103 ATGATCCAGGGGCAAGTCAAGGG - Intergenic
1081716655 11:45255444-45255466 ATTTTCCAGTGGAAAGTTGGCGG + Intronic
1081747434 11:45482934-45482956 ATGGTCCAGTGGCATGTCCAAGG - Intergenic
1081841369 11:46203912-46203934 ATGTTCCAGTGCCCAGATGGAGG + Intergenic
1084677440 11:70644199-70644221 ATTTTACAGTGGCCAGTTCATGG + Intronic
1087526569 11:99321132-99321154 ATGTGCAATTGGCAAGCTGAAGG - Intronic
1091955989 12:4643633-4643655 ATTTTCCCATGGCAAGTAGAAGG + Intronic
1092965460 12:13637298-13637320 ATGTTTCAGTGGAAACCTGAAGG + Intronic
1093425955 12:19029240-19029262 ATGTTCCAGTTCCAATCTGAAGG - Intergenic
1095174590 12:39077006-39077028 ATATTCCAGTGGTTGGTTGATGG + Intergenic
1095587346 12:43863811-43863833 ATGGTGCAGTGGCAGGCTGAAGG - Intronic
1096749527 12:53749948-53749970 ATCTTCCAGTGGCTGCTTGAGGG + Intergenic
1096984982 12:55750293-55750315 TTCTTCCACTGGCAAGGTGAGGG + Exonic
1098361115 12:69655411-69655433 AGGTACCAGTGGCATTTTGATGG + Exonic
1098944088 12:76571421-76571443 ATGTACCAGTCTCATGTTGATGG - Intergenic
1101137935 12:101764757-101764779 ATGTTCCAGTTGCAAATCCAAGG + Exonic
1110125066 13:71932381-71932403 AGGTTTCAGTGGAAAGATGATGG + Intergenic
1111921375 13:94415023-94415045 ATGTTCCAGTGACAATGAGAAGG + Intergenic
1112314932 13:98352286-98352308 GATTTCCAGTGGCAATTTGAGGG - Intronic
1116507445 14:45702330-45702352 ATTTTTCAGTGGAAAATTGATGG + Intergenic
1117274062 14:54174500-54174522 TTGTTCCAGAGGAAAGCTGAGGG - Intergenic
1117282672 14:54256046-54256068 ATCTACCTGTGACAAGTTGAGGG - Intergenic
1119845630 14:77827586-77827608 ATGTTTAAGTGGCAAACTGAGGG - Intronic
1120385043 14:83834199-83834221 ATGTTCCAGTTCCAGTTTGAAGG + Intergenic
1120603033 14:86536399-86536421 ATGTTCCCATGGTAAGTTGTTGG - Intergenic
1122947553 14:105020068-105020090 ATGTTCCAGTGGCAAGTTGAGGG + Intronic
1125299937 15:38244678-38244700 ATGTTGCAGTGGGAAGAGGAGGG + Intergenic
1127618071 15:60707111-60707133 AGATTCCAGTGGCCAATTGAGGG - Intronic
1135859986 16:26047427-26047449 ATATTCCAGTGGGAAGTTGGTGG + Intronic
1140818653 16:78643380-78643402 AATTTCCAGTGGCTAGTTCAGGG + Intronic
1142239311 16:88937976-88937998 ATGTTCCAGTGGCTTCTGGAGGG + Intronic
1150954820 17:69845822-69845844 ATGTTCCACTGGAAAATTGTTGG - Intergenic
1151057684 17:71052470-71052492 ATGTTCCAGGGTCAGGCTGATGG + Intergenic
1152367649 17:79865910-79865932 ATGTTCCAGGGGCCAGCTGCTGG + Intergenic
1153608755 18:6860545-6860567 GTTTTCCAGTGGCTGGTTGATGG + Intronic
1155076683 18:22363444-22363466 ATGGTCCAGAGGAAAGATGATGG - Intergenic
1156399842 18:36730123-36730145 ATGTTTGAATGGCAAGGTGAGGG + Intronic
1159991772 18:74917015-74917037 AGGTTCCAGTGGCAGGAAGAAGG + Intronic
1168199264 19:54802906-54802928 ATATTCCAGTATCAAGTTGGAGG + Intronic
924970143 2:118705-118727 ATGTTACAGTGAAAAGGTGAGGG + Intergenic
925970118 2:9100594-9100616 AAGTTCCAGGGGCAGGGTGATGG + Intergenic
926527990 2:14006814-14006836 AGTTTCCAGTGGCCAGGTGATGG + Intergenic
926626588 2:15095730-15095752 ATGTCCCATTGTCAAGTTGGTGG + Intergenic
930942967 2:57035800-57035822 ATGTTCCAGTGGCAACAGGGTGG + Intergenic
933403441 2:81827880-81827902 ATCTTCCAGAGGCTATTTGATGG + Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935977008 2:108587904-108587926 ATCTTCCGGTGGCAAGGTGCAGG - Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
939354828 2:141087717-141087739 ATGCTCGAGTGGAAACTTGAAGG + Intronic
940207079 2:151214798-151214820 ATGTTACAGTTGCTAGTGGAAGG - Intergenic
940407435 2:153321718-153321740 ATGCTCCACTGGGAAGTTTAGGG - Intergenic
941167790 2:162102035-162102057 ACGTTCCAATGGGTAGTTGAAGG - Intergenic
941275589 2:163486789-163486811 ATTTGACAGTGGCAAGATGAAGG - Intergenic
942655704 2:178211983-178212005 AGGTTCCATTGGGAAGTTGGGGG + Intronic
942754844 2:179328518-179328540 TTGTTTCCATGGCAAGTTGAAGG - Intergenic
942755759 2:179339072-179339094 CTGTTCCAGTGCCAAGTTTTGGG + Intergenic
1170021583 20:11842203-11842225 ATCTTCCTGTGGCAACTGGAAGG - Intergenic
1171378152 20:24709269-24709291 ATGTTGCAGTGGCAGGTTCTAGG + Intergenic
1172662417 20:36576258-36576280 AAGTTACAGTGCCAAGTGGAGGG + Intronic
1174803418 20:53584620-53584642 ATGTGGCAGTGACAACTTGAAGG - Intronic
1177448773 21:21237625-21237647 ATGTTCTATTGGACAGTTGAAGG + Intronic
1177916635 21:27096570-27096592 ATTTTACAGTGGCAGGTAGAGGG + Intergenic
1178811730 21:35889284-35889306 ATCTTCCACTTGCAAGTTTATGG + Intronic
1180561254 22:16616012-16616034 ATGTGGCAGTGACAACTTGAAGG + Intergenic
1182964937 22:34512066-34512088 TTGTCCCAGTTGCAAGTTGTTGG + Intergenic
1183534405 22:38388993-38389015 ATGTGGCAGTGACAACTTGAAGG - Intronic
949094164 3:66020-66042 ATATTCCACTGCCAAGATGAAGG - Intergenic
951180404 3:19652793-19652815 ATCTTCCAGTGGCTACTTTATGG + Intergenic
952887970 3:38023104-38023126 AGGTGCCAGTGGGAAGCTGAGGG + Intronic
954291139 3:49650722-49650744 ATGTTCCAGATGCACGGTGAGGG - Exonic
956580289 3:70804182-70804204 ATGTCCCAGTTTCAAGTTGTGGG - Intergenic
956937620 3:74121294-74121316 ATTTTGCAGTCACAAGTTGAAGG - Intergenic
957803145 3:85111818-85111840 ATCTTACAGTTGAAAGTTGATGG - Intronic
959393586 3:105806713-105806735 AATTTTCAGTGGCAAATTGATGG + Intronic
961180851 3:124876373-124876395 ATGTTCCAGTTGCAAGATACTGG - Intronic
966850155 3:184159773-184159795 ATGGTCCAGTGGATAGTTCATGG - Intronic
971983460 4:33787652-33787674 ATGTTCCTGTGGCAAAGCGATGG + Intergenic
973374766 4:49279143-49279165 GTGTGCCAGTAGCAAGTAGATGG + Intergenic
973382645 4:49331098-49331120 GTGTGCCAGTAGCAAGTAGATGG - Intergenic
973877982 4:55240855-55240877 GTCTTCCAGTGGCTACTTGACGG - Intergenic
974139653 4:57868697-57868719 AAGTTCCAGTGGAATATTGAAGG - Intergenic
974968638 4:68797868-68797890 ATGTTACAATGGAGAGTTGATGG + Intergenic
975663907 4:76715049-76715071 ATGTTGAAGTGGGAGGTTGATGG + Intronic
978083983 4:104627335-104627357 ATGTTCCATCTGCAAGATGAAGG + Intergenic
978886485 4:113772248-113772270 ATGGTGCAGTGGCAGGCTGAAGG - Intergenic
981613790 4:146624673-146624695 ATGTACCAGTGACAAGGAGAGGG - Intergenic
983359714 4:166712623-166712645 AAATTCCAGTGGCTATTTGATGG - Intergenic
984151911 4:176143722-176143744 TTGGTTTAGTGGCAAGTTGATGG - Intronic
989301606 5:39901615-39901637 ATTTTCCAGTGCCATGTAGAAGG - Intergenic
989767865 5:45107620-45107642 ATGTTCCAGTGGGTTGTTGGAGG - Intergenic
995894130 5:116991978-116992000 GTGTTCCTGAGGAAAGTTGAAGG + Intergenic
997463715 5:134072624-134072646 ATGGTCCAGTTGCAGGCTGATGG - Intergenic
998148726 5:139745316-139745338 ATCTGCCTGTGGCAAATTGAGGG - Intergenic
998378209 5:141705437-141705459 ATATTCCAGTGGGGAGGTGAGGG - Intergenic
1004303332 6:14477929-14477951 ATGTTTAAGTGGCAATTAGAAGG + Intergenic
1004663247 6:17728673-17728695 ATAGTGCAGTGGCAAGCTGAAGG - Intergenic
1006261547 6:32877400-32877422 ATTTTCCACTTGCAAGTTTATGG - Intergenic
1006765851 6:36505860-36505882 ATGTTCCAGTGTCCAGTTACTGG - Intronic
1007097691 6:39224106-39224128 ATGTTCCACTCAAAAGTTGAGGG - Intronic
1007633773 6:43286219-43286241 ATTTCCCAGTGGGAAGTTGGAGG + Exonic
1008929488 6:56923660-56923682 ATGTTCCAGTTGAAATCTGAAGG + Intronic
1009202785 6:60766134-60766156 ATTTTGCAGAGGTAAGTTGAAGG + Intergenic
1010329223 6:74602654-74602676 CTGTTTCAATGTCAAGTTGAAGG - Intergenic
1010538106 6:77055857-77055879 ATGTACCGGTGGCAATTTAAGGG + Intergenic
1010578230 6:77560839-77560861 TTGCTTCAGTGGCAAGTTGATGG - Intergenic
1012348116 6:98217096-98217118 ATATTCTAGTAGCAAGTTGTGGG + Intergenic
1013560398 6:111297579-111297601 CTGCTCCATTGGCAAGATGAGGG + Intergenic
1015545058 6:134353368-134353390 ATGTTCAAGTGGCTAATAGATGG + Intergenic
1017132351 6:151118483-151118505 ATACCCCAGTGGCATGTTGAAGG + Intergenic
1018013061 6:159689275-159689297 ATGTTTCAGTGGAGACTTGAAGG - Intronic
1018642109 6:165914210-165914232 ATGTTCCATTGCCTAGGTGATGG + Intronic
1019407948 7:893731-893753 CTGTCCCAGTGGGAAGCTGACGG + Exonic
1026122889 7:67552866-67552888 ATGTTCCAGGTGAAAGTTCAGGG - Intergenic
1028370778 7:90089435-90089457 TTGGTCCAGTGTCAAGTTTAAGG - Intergenic
1030513235 7:110511143-110511165 ATTTCCCATTGGCAAGTTGTTGG + Intergenic
1031091392 7:117359708-117359730 ATATTCCAGGTGCAAGATGATGG - Intergenic
1031461216 7:122051857-122051879 GTGTTCCAGTGGAAAGATCAAGG + Exonic
1033939594 7:146635934-146635956 CTGTTCCAGTGGCAAGTGAATGG + Intronic
1037389173 8:18374708-18374730 CTGTTCCAGTGGCTACTTGGGGG - Intergenic
1037392086 8:18403730-18403752 CTGTTCCAGTGGCTACTTGGTGG - Intergenic
1043225920 8:77729831-77729853 ATGTTCCAGTGTAATGCTGACGG - Intergenic
1043744387 8:83855361-83855383 ATCTTAAAATGGCAAGTTGAGGG - Intergenic
1043747700 8:83897188-83897210 ATGTACATGTGGCAAGTTGAAGG - Intergenic
1044842497 8:96348942-96348964 AAGTTCCAGTGTCAACTTAAAGG - Intergenic
1046548547 8:115682919-115682941 ATGTTCCAGTGGAATGATGAGGG + Intronic
1047200572 8:122761717-122761739 ATGTTCCAGTGACACCATGATGG - Intergenic
1048480331 8:134784114-134784136 ATCTCCCAGGAGCAAGTTGAGGG + Intergenic
1055302108 9:74892447-74892469 CTCTGCCTGTGGCAAGTTGAAGG + Intergenic
1056510696 9:87302325-87302347 GTTTTCCAGTGGCTAGATGATGG - Intergenic
1057000457 9:91504194-91504216 ATGTTGAACTGGCATGTTGAAGG + Intergenic
1059726743 9:117015707-117015729 ATGTTCCAGTGGTTATTTTAAGG + Intronic
1186840508 X:13480258-13480280 ATGTGCCAGTGATAAGTTGGGGG - Intergenic
1186843702 X:13510176-13510198 CAGTTCCAGGGGGAAGTTGATGG - Intergenic
1189760368 X:44315935-44315957 ATATTCCAGTGGCCTGATGAGGG - Intronic
1193307308 X:79964297-79964319 ATATTTCAGTGGTAAGTTGCAGG - Intergenic
1197179411 X:123518145-123518167 GTATTCCAGGGGCAAGATGATGG + Intergenic
1197367516 X:125582381-125582403 ATGTTCCTGTGGGGATTTGAGGG - Intergenic