ID: 1122950629

View in Genome Browser
Species Human (GRCh38)
Location 14:105042544-105042566
Sequence CCTCCTTGTGGTGTCACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122950629_1122950643 30 Left 1122950629 14:105042544-105042566 CCATCAGTGACACCACAAGGAGG No data
Right 1122950643 14:105042597-105042619 CCCAGCGACAGGAGCGAGCTTGG No data
1122950629_1122950634 4 Left 1122950629 14:105042544-105042566 CCATCAGTGACACCACAAGGAGG No data
Right 1122950634 14:105042571-105042593 GACCTCCTCAGTCCCACACCCGG No data
1122950629_1122950639 19 Left 1122950629 14:105042544-105042566 CCATCAGTGACACCACAAGGAGG No data
Right 1122950639 14:105042586-105042608 ACACCCGGCTTCCCAGCGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122950629 Original CRISPR CCTCCTTGTGGTGTCACTGA TGG (reversed) Intergenic
No off target data available for this crispr