ID: 1122950635

View in Genome Browser
Species Human (GRCh38)
Location 14:105042573-105042595
Sequence AGCCGGGTGTGGGACTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122950635_1122950639 -10 Left 1122950635 14:105042573-105042595 CCTCCTCAGTCCCACACCCGGCT No data
Right 1122950639 14:105042586-105042608 ACACCCGGCTTCCCAGCGACAGG No data
1122950635_1122950647 7 Left 1122950635 14:105042573-105042595 CCTCCTCAGTCCCACACCCGGCT No data
Right 1122950647 14:105042603-105042625 GACAGGAGCGAGCTTGGAAGGGG No data
1122950635_1122950646 6 Left 1122950635 14:105042573-105042595 CCTCCTCAGTCCCACACCCGGCT No data
Right 1122950646 14:105042602-105042624 CGACAGGAGCGAGCTTGGAAGGG No data
1122950635_1122950645 5 Left 1122950635 14:105042573-105042595 CCTCCTCAGTCCCACACCCGGCT No data
Right 1122950645 14:105042601-105042623 GCGACAGGAGCGAGCTTGGAAGG No data
1122950635_1122950643 1 Left 1122950635 14:105042573-105042595 CCTCCTCAGTCCCACACCCGGCT No data
Right 1122950643 14:105042597-105042619 CCCAGCGACAGGAGCGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122950635 Original CRISPR AGCCGGGTGTGGGACTGAGG AGG (reversed) Intergenic
No off target data available for this crispr