ID: 1122950639

View in Genome Browser
Species Human (GRCh38)
Location 14:105042586-105042608
Sequence ACACCCGGCTTCCCAGCGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122950635_1122950639 -10 Left 1122950635 14:105042573-105042595 CCTCCTCAGTCCCACACCCGGCT No data
Right 1122950639 14:105042586-105042608 ACACCCGGCTTCCCAGCGACAGG No data
1122950629_1122950639 19 Left 1122950629 14:105042544-105042566 CCATCAGTGACACCACAAGGAGG No data
Right 1122950639 14:105042586-105042608 ACACCCGGCTTCCCAGCGACAGG No data
1122950633_1122950639 7 Left 1122950633 14:105042556-105042578 CCACAAGGAGGCAGGGACCTCCT No data
Right 1122950639 14:105042586-105042608 ACACCCGGCTTCCCAGCGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122950639 Original CRISPR ACACCCGGCTTCCCAGCGAC AGG Intergenic
No off target data available for this crispr