ID: 1122951544

View in Genome Browser
Species Human (GRCh38)
Location 14:105047772-105047794
Sequence GACGGGCGCAGCTGGGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122951544_1122951558 22 Left 1122951544 14:105047772-105047794 CCACCTCCCCAGCTGCGCCCGTC No data
Right 1122951558 14:105047817-105047839 CCTCCGCCCACAGCCCTCGAGGG No data
1122951544_1122951556 21 Left 1122951544 14:105047772-105047794 CCACCTCCCCAGCTGCGCCCGTC No data
Right 1122951556 14:105047816-105047838 CCCTCCGCCCACAGCCCTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122951544 Original CRISPR GACGGGCGCAGCTGGGGAGG TGG (reversed) Intergenic
No off target data available for this crispr