ID: 1122951556

View in Genome Browser
Species Human (GRCh38)
Location 14:105047816-105047838
Sequence CCCTCCGCCCACAGCCCTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122951542_1122951556 30 Left 1122951542 14:105047763-105047785 CCGTAACCTCCACCTCCCCAGCT No data
Right 1122951556 14:105047816-105047838 CCCTCCGCCCACAGCCCTCGAGG No data
1122951547_1122951556 14 Left 1122951547 14:105047779-105047801 CCCAGCTGCGCCCGTCCTGCAGG No data
Right 1122951556 14:105047816-105047838 CCCTCCGCCCACAGCCCTCGAGG No data
1122951552_1122951556 3 Left 1122951552 14:105047790-105047812 CCGTCCTGCAGGGACTCAACCTG No data
Right 1122951556 14:105047816-105047838 CCCTCCGCCCACAGCCCTCGAGG No data
1122951545_1122951556 18 Left 1122951545 14:105047775-105047797 CCTCCCCAGCTGCGCCCGTCCTG No data
Right 1122951556 14:105047816-105047838 CCCTCCGCCCACAGCCCTCGAGG No data
1122951546_1122951556 15 Left 1122951546 14:105047778-105047800 CCCCAGCTGCGCCCGTCCTGCAG No data
Right 1122951556 14:105047816-105047838 CCCTCCGCCCACAGCCCTCGAGG No data
1122951551_1122951556 4 Left 1122951551 14:105047789-105047811 CCCGTCCTGCAGGGACTCAACCT No data
Right 1122951556 14:105047816-105047838 CCCTCCGCCCACAGCCCTCGAGG No data
1122951544_1122951556 21 Left 1122951544 14:105047772-105047794 CCACCTCCCCAGCTGCGCCCGTC No data
Right 1122951556 14:105047816-105047838 CCCTCCGCCCACAGCCCTCGAGG No data
1122951553_1122951556 -1 Left 1122951553 14:105047794-105047816 CCTGCAGGGACTCAACCTGCTGC No data
Right 1122951556 14:105047816-105047838 CCCTCCGCCCACAGCCCTCGAGG No data
1122951549_1122951556 13 Left 1122951549 14:105047780-105047802 CCAGCTGCGCCCGTCCTGCAGGG No data
Right 1122951556 14:105047816-105047838 CCCTCCGCCCACAGCCCTCGAGG No data
1122951543_1122951556 24 Left 1122951543 14:105047769-105047791 CCTCCACCTCCCCAGCTGCGCCC No data
Right 1122951556 14:105047816-105047838 CCCTCCGCCCACAGCCCTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122951556 Original CRISPR CCCTCCGCCCACAGCCCTCG AGG Intergenic
No off target data available for this crispr