ID: 1122951558

View in Genome Browser
Species Human (GRCh38)
Location 14:105047817-105047839
Sequence CCTCCGCCCACAGCCCTCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122951546_1122951558 16 Left 1122951546 14:105047778-105047800 CCCCAGCTGCGCCCGTCCTGCAG No data
Right 1122951558 14:105047817-105047839 CCTCCGCCCACAGCCCTCGAGGG No data
1122951543_1122951558 25 Left 1122951543 14:105047769-105047791 CCTCCACCTCCCCAGCTGCGCCC No data
Right 1122951558 14:105047817-105047839 CCTCCGCCCACAGCCCTCGAGGG No data
1122951551_1122951558 5 Left 1122951551 14:105047789-105047811 CCCGTCCTGCAGGGACTCAACCT No data
Right 1122951558 14:105047817-105047839 CCTCCGCCCACAGCCCTCGAGGG No data
1122951552_1122951558 4 Left 1122951552 14:105047790-105047812 CCGTCCTGCAGGGACTCAACCTG No data
Right 1122951558 14:105047817-105047839 CCTCCGCCCACAGCCCTCGAGGG No data
1122951545_1122951558 19 Left 1122951545 14:105047775-105047797 CCTCCCCAGCTGCGCCCGTCCTG No data
Right 1122951558 14:105047817-105047839 CCTCCGCCCACAGCCCTCGAGGG No data
1122951547_1122951558 15 Left 1122951547 14:105047779-105047801 CCCAGCTGCGCCCGTCCTGCAGG No data
Right 1122951558 14:105047817-105047839 CCTCCGCCCACAGCCCTCGAGGG No data
1122951544_1122951558 22 Left 1122951544 14:105047772-105047794 CCACCTCCCCAGCTGCGCCCGTC No data
Right 1122951558 14:105047817-105047839 CCTCCGCCCACAGCCCTCGAGGG No data
1122951553_1122951558 0 Left 1122951553 14:105047794-105047816 CCTGCAGGGACTCAACCTGCTGC No data
Right 1122951558 14:105047817-105047839 CCTCCGCCCACAGCCCTCGAGGG No data
1122951549_1122951558 14 Left 1122951549 14:105047780-105047802 CCAGCTGCGCCCGTCCTGCAGGG No data
Right 1122951558 14:105047817-105047839 CCTCCGCCCACAGCCCTCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122951558 Original CRISPR CCTCCGCCCACAGCCCTCGA GGG Intergenic
No off target data available for this crispr