ID: 1122952907

View in Genome Browser
Species Human (GRCh38)
Location 14:105055694-105055716
Sequence CCTTCCTTTCAAAGGCGGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 150}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122952898_1122952907 6 Left 1122952898 14:105055665-105055687 CCTCCTGTTGCAGCGTGTGCCAG 0: 1
1: 0
2: 0
3: 5
4: 155
Right 1122952907 14:105055694-105055716 CCTTCCTTTCAAAGGCGGGATGG 0: 1
1: 0
2: 1
3: 13
4: 150
1122952896_1122952907 16 Left 1122952896 14:105055655-105055677 CCTCAAGCTCCCTCCTGTTGCAG 0: 1
1: 0
2: 2
3: 36
4: 279
Right 1122952907 14:105055694-105055716 CCTTCCTTTCAAAGGCGGGATGG 0: 1
1: 0
2: 1
3: 13
4: 150
1122952900_1122952907 3 Left 1122952900 14:105055668-105055690 CCTGTTGCAGCGTGTGCCAGGAT 0: 1
1: 0
2: 0
3: 15
4: 73
Right 1122952907 14:105055694-105055716 CCTTCCTTTCAAAGGCGGGATGG 0: 1
1: 0
2: 1
3: 13
4: 150
1122952897_1122952907 7 Left 1122952897 14:105055664-105055686 CCCTCCTGTTGCAGCGTGTGCCA 0: 1
1: 0
2: 2
3: 14
4: 112
Right 1122952907 14:105055694-105055716 CCTTCCTTTCAAAGGCGGGATGG 0: 1
1: 0
2: 1
3: 13
4: 150
1122952895_1122952907 25 Left 1122952895 14:105055646-105055668 CCACAGTGTCCTCAAGCTCCCTC 0: 1
1: 0
2: 5
3: 39
4: 319
Right 1122952907 14:105055694-105055716 CCTTCCTTTCAAAGGCGGGATGG 0: 1
1: 0
2: 1
3: 13
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122952907 Original CRISPR CCTTCCTTTCAAAGGCGGGA TGG Exonic
903147528 1:21384534-21384556 CTTTTCTTTCAATGGAGGGATGG - Intergenic
905550662 1:38835950-38835972 CCTTCCTTTCCTAGTAGGGAGGG - Intergenic
907539059 1:55195603-55195625 CCTTCTTTTTAAAGGCTGAATGG - Intronic
909790130 1:79666414-79666436 ACTTCCTTTCAAAGCTGTGAAGG - Intergenic
911154642 1:94625933-94625955 CCTTCCTTTCAAATGCAGCCTGG - Intergenic
912709247 1:111937957-111937979 CCTTCCTTCCAAAGGCAACAAGG - Intronic
915772188 1:158438182-158438204 CCTTCTTTTTAAAGGCTGAATGG + Intergenic
917931715 1:179826933-179826955 CCTGTCTTTCATAGGCTGGAGGG + Intergenic
918088988 1:181271524-181271546 CCTGTTTTTCAAGGGCGGGAGGG - Intergenic
920967668 1:210714699-210714721 CCTTCCTTTGAAGGCAGGGATGG - Intronic
922352210 1:224743613-224743635 ACTTCCCTTCAAAGAGGGGAAGG + Intergenic
922595093 1:226807376-226807398 CCTTCATTCCAAAGGCCAGAAGG + Intergenic
923114362 1:230921092-230921114 CCTTCACTTGAAAGGCAGGATGG - Intronic
924508599 1:244710038-244710060 CCTTCCTGTCAAAGCCAAGAGGG + Intergenic
1063103426 10:2971646-2971668 CCTTCCTTTCAAGGGGAAGAAGG - Intergenic
1063460923 10:6214681-6214703 CCATCCTTTCAAAAGAGGGGAGG - Intronic
1064439338 10:15339693-15339715 CCTTCCTGACAAAGGTGGGAAGG - Intronic
1065353562 10:24817317-24817339 CTTTCCTTTTAAAGGCTGCAGGG + Intergenic
1065614640 10:27507369-27507391 CCTTCATTTCAAAAGCGAGGGGG + Intronic
1068910026 10:62369259-62369281 CCTTCCTTTCACAGTCATGATGG + Intergenic
1070972154 10:80576662-80576684 CCTACCTCTCAAAGGGAGGAGGG - Intronic
1071878331 10:89866593-89866615 CCTGGCTTTCAAAGGCTGTAAGG + Intergenic
1075497673 10:122940225-122940247 CCTTCTTCTCAAAGGCTGAATGG - Intronic
1076677185 10:132153257-132153279 GTTTCCTCCCAAAGGCGGGAAGG + Intronic
1077708245 11:4509634-4509656 CCTACCAATCAAAGGCAGGAAGG - Intergenic
1081376742 11:42368233-42368255 CCTTCCCATCAAAGGCCAGAAGG + Intergenic
1085429718 11:76437500-76437522 CCTTCCCTTCTCAGGTGGGATGG + Intergenic
1089906973 11:122049966-122049988 CCTTCCTTTAAAAGGCTGAATGG + Intergenic
1090582148 11:128172180-128172202 CCTTCCTTACTAATGCAGGATGG - Intergenic
1093080095 12:14800779-14800801 CTTTCCTTTAAAAGGAGAGAGGG + Exonic
1102552660 12:113702974-113702996 CTTGCCTTTCAAAGGCATGACGG + Intergenic
1104136183 12:125941130-125941152 CCTTCCTTTCTATGGTTGGATGG - Intergenic
1107027971 13:35823012-35823034 CTTTCCTTTCAAAGGCTCGAAGG + Intronic
1109159216 13:58950838-58950860 CCTTCTTTTTAAAGGCTGAATGG + Intergenic
1110874546 13:80492100-80492122 CTTTCTTTTCAAAGTCTGGATGG + Intergenic
1118620462 14:67609962-67609984 CCTTCCTTTCAACCTTGGGAGGG + Intergenic
1119547166 14:75480317-75480339 CCTTCCTTTCTAATGAGGGAAGG - Intergenic
1119696926 14:76720570-76720592 CCAGACTTTCAAAGGAGGGAAGG + Intergenic
1122952907 14:105055694-105055716 CCTTCCTTTCAAAGGCGGGATGG + Exonic
1123007598 14:105331689-105331711 CCTTCCTTTGGAGGGTGGGAGGG - Intronic
1124642123 15:31402261-31402283 TCTTCCTTTCAGAGGCTGGCGGG - Intronic
1124652882 15:31485924-31485946 CCTTCCTATCCCAGGTGGGAAGG - Intronic
1125315879 15:38430594-38430616 CCTTCCCCTCAAATGTGGGAAGG - Intergenic
1128034818 15:64515552-64515574 TCTTCTTTTTAAAGGGGGGAGGG + Intronic
1131505298 15:93012812-93012834 CCTTCCATACAAAAGCTGGAAGG - Intronic
1132186223 15:99804173-99804195 CCTTCATTTTAGAGGGGGGAGGG + Intergenic
1132429450 15:101748533-101748555 CCTTCATTTTAGAGGGGGGAGGG - Intergenic
1135920147 16:26642372-26642394 CCCTCCTTTCAAAGGCTGTATGG - Intergenic
1137951511 16:52788264-52788286 GCTTCCCTTGAAAGGAGGGAGGG + Intergenic
1140455989 16:75105898-75105920 CCTTCCTGCAAGAGGCGGGAGGG - Intronic
1140827039 16:78716300-78716322 CATTCCCTCCAAAGGCTGGAGGG - Intronic
1143107558 17:4537158-4537180 CCTTCCTTTCAAGGGCTGGGTGG + Intronic
1145953986 17:28842233-28842255 CCCTCTTTTGAAAGCCGGGAGGG - Intronic
1146560158 17:33861649-33861671 CCTTCCTCTCAGAGGCAGAAAGG - Intronic
1146642663 17:34552986-34553008 CTTTCCTTTCCAGGGCAGGAGGG - Intergenic
1146986684 17:37226835-37226857 CCTTCTTTCCAAAAGTGGGAGGG - Intronic
1146989181 17:37252000-37252022 CCTACCTTTCTAAGGAGTGAAGG + Exonic
1148111167 17:45145198-45145220 CAGTCCTCTCAAAGCCGGGAAGG + Intergenic
1148398622 17:47332746-47332768 CCTTCTTTTTAAAGGCTGTATGG + Intronic
1149156113 17:53631660-53631682 CCTTCCTTACACCGGTGGGAAGG + Intergenic
1151329357 17:73397850-73397872 CCTTCCTCTCATCGGCGGGCGGG + Intronic
1152198932 17:78934051-78934073 GCTTCCTTTCATGGGCGGGTTGG + Intergenic
1156690877 18:39705404-39705426 CCTGCATTTCAAAAGCAGGAAGG + Intergenic
1157528189 18:48401053-48401075 CCTTCCGTTCAAGGTAGGGAAGG + Intronic
1158962615 18:62598779-62598801 CATTCCTTTCAATGGCATGACGG + Intergenic
1161678159 19:5664825-5664847 CCTTACTTTCAAAAGAGGGCAGG - Intronic
1165372569 19:35418575-35418597 CCTTCATTTCCAGTGCGGGAGGG + Intergenic
1166253810 19:41588254-41588276 CCTTCCTTACAAATGAGAGAGGG - Intronic
1168012842 19:53547365-53547387 CCTTCTTTATAAAGGCTGGATGG + Intronic
1168152342 19:54455866-54455888 CTTTCCTTTCGGAGGCGGGTCGG + Intronic
925691218 2:6525349-6525371 CCTTCCTTTCAAATCTGGGTGGG + Intergenic
925835030 2:7936091-7936113 CCTCCCTCTCAAAGGGGGAATGG + Intergenic
926797040 2:16627701-16627723 CCTTCCTTCAAAAGGAGAGAAGG + Intronic
927018975 2:18997924-18997946 GCTTTATTTCAAAGGTGGGATGG - Intergenic
928244698 2:29617068-29617090 CTTTCTTTTCAAAGAGGGGAAGG - Intronic
931441991 2:62296550-62296572 GCTTCCCTGCAAGGGCGGGAGGG + Intergenic
932223411 2:70019571-70019593 CCTTCCTTTTAAAGGATGAATGG - Intergenic
932563075 2:72889049-72889071 CTTTCCTGTCAAGGGAGGGAAGG - Intronic
933150323 2:78906639-78906661 CTTTCCTCTCCAAGGCTGGAAGG - Intergenic
936380935 2:111985334-111985356 TCTTCCTTTCCCAGGTGGGAAGG - Intronic
937408025 2:121648991-121649013 CCTTCCTTTCAAACGCGCCCCGG + Intronic
937680634 2:124640659-124640681 CCTTCCTTTTAAAGGTCGGGCGG + Intronic
940748221 2:157595245-157595267 CTTGCCTTCCAAAGGCAGGAAGG - Intronic
942427701 2:175877116-175877138 CCTTCCTTCCAGAGGCTGAAAGG - Intergenic
942938517 2:181588430-181588452 CCTTCTCTTCAAAGGCTGAATGG + Intronic
944358291 2:198820207-198820229 CCTCCCTTCCAAAGGAGGGACGG + Intergenic
945172154 2:207008051-207008073 CCTTCCTTTCAGAGGATGAAGGG + Intergenic
946467853 2:219928278-219928300 CCTGCCTTTCAAAGGCCAGCAGG - Intergenic
946928474 2:224648909-224648931 CCTTTCTTTCAAAGGCAGTGAGG - Intergenic
948623233 2:239250025-239250047 GCCTCCTTCCAGAGGCGGGAGGG - Intronic
949032181 2:241802431-241802453 CCTTCCTTACAAAGGAAGCAGGG + Intronic
1171131718 20:22660168-22660190 CCTTTCTTTCATAGGCAGGCAGG + Intergenic
1172908701 20:38389236-38389258 CCCTCCGTTCCAAGGTGGGATGG - Intergenic
1173421123 20:42902033-42902055 TCTTCCTTCCAAAGGCCTGAAGG + Intronic
1176112276 20:63416081-63416103 CCTTCCTTCCAGAAGCCGGAAGG - Intronic
1177716105 21:24841346-24841368 TCTTCCTTACAAAGGGAGGAGGG + Intergenic
1179271694 21:39856424-39856446 CCTTCCTTTCACAGCCAGGAAGG - Intergenic
1181669450 22:24419389-24419411 CCTTCCTCACAAACACGGGAGGG - Intronic
1181749640 22:24980107-24980129 CCTTCTTTTTAAAGGCTGGATGG + Intronic
1183644744 22:39118227-39118249 CCTTCCTTTGTAAGGTGGGTAGG - Intergenic
950160137 3:10754259-10754281 CCTTCCTTTAAAAGTCAGAAGGG - Intergenic
953771499 3:45781382-45781404 CCTTCCTTTCTGGGGTGGGAGGG + Intronic
953963370 3:47283287-47283309 CTTTCCTTTCAAGGGCTGAAAGG - Intronic
955487558 3:59449846-59449868 CCTTCATTTCAAGGGGAGGAGGG + Intergenic
955774474 3:62418721-62418743 CCTTGAGTTCAAAGGTGGGAGGG - Intronic
955900249 3:63745980-63746002 CTTTCCTTTCAAAGACAGGGAGG - Intergenic
961459424 3:127040816-127040838 CCTTCCTTTCAAAGGCTGAATGG - Intergenic
962760029 3:138502934-138502956 CCTTTCTTGGAAAGGCAGGAGGG + Intronic
963142705 3:141960946-141960968 CCTTCCTTTGAGTGGAGGGAAGG - Intronic
965168546 3:165229012-165229034 CCTTCTTTTTAAAGGCTGAATGG + Intergenic
971629927 4:28977911-28977933 CCTTCCTTGCAAAGCAGGCAGGG - Intergenic
972290660 4:37686866-37686888 GCTTCCTTTCCAAGCCGGGCCGG + Intergenic
973938480 4:55877644-55877666 CATTCCTTTAAAAGACGGAATGG + Intronic
976864657 4:89709421-89709443 GCTTATTTTCAGAGGCGGGAGGG + Intergenic
977850690 4:101823850-101823872 TCTTTCTTTCAAATGCAGGAAGG - Intronic
979107437 4:116705674-116705696 CCTTCCTTGCAGAGGCTGCAGGG - Intergenic
979123191 4:116928726-116928748 CCTTCTTTTTAAAGGCTGAATGG + Intergenic
979601506 4:122590983-122591005 CCTACATTTCAAAGGCTGAATGG - Intergenic
982983120 4:162166235-162166257 CCTTCCTTTGAAAGATGGAAAGG + Intergenic
983609147 4:169623847-169623869 TCTTCCTTTTAAAGGCTGTATGG + Intronic
988368149 5:30329423-30329445 CATACCTTTCAAATGCTGGAAGG - Intergenic
990076214 5:51848906-51848928 CCTACATTTCAATGGGGGGAGGG + Intergenic
994483125 5:100361167-100361189 CCTTGCTTTCAAAGGCCCCAAGG - Intergenic
999435707 5:151561839-151561861 TCTTCCTTTCAACTGCAGGAAGG + Intronic
1000514554 5:162224355-162224377 TCTTCCTTTCAAAGAAGGAATGG + Intergenic
1002209628 5:177589827-177589849 CCATCCTTTCTAAGGCTGAAAGG + Intergenic
1002458414 5:179359576-179359598 ACTCCCATTCAAAGGAGGGAAGG + Intergenic
1003539496 6:7005865-7005887 CCTTCCTTTTACAGGCTGAAGGG - Intergenic
1003787071 6:9498432-9498454 GCTTCCTTCCAAAGGGAGGACGG + Intergenic
1004381059 6:15132936-15132958 CCTTTCTGTCAAAGGGCGGAAGG + Intergenic
1004789792 6:19012099-19012121 CCTTCATTGCAAAGGCTGAAGGG + Intergenic
1005427135 6:25714635-25714657 CCTTCCTGATAAAGGCAGGATGG - Intergenic
1010922068 6:81694265-81694287 CCTTCCTTTCTAGGGCTGAATGG + Intronic
1014316745 6:119876311-119876333 CCTTCCCTTCCAAGGTGTGATGG + Intergenic
1014693853 6:124594875-124594897 CCTTCCTGTCACAGGAGGGAAGG + Intronic
1016192388 6:141287130-141287152 CCTGCCTTACAAAGGCTGAAAGG - Intergenic
1018250294 6:161862734-161862756 CCTTCCATTCAGAGGCGAGAAGG + Intronic
1026486203 7:70823792-70823814 CCTTCTTTTTAAAGGCTGAATGG - Intergenic
1026686702 7:72516277-72516299 CCTTCCTTTTCAAGGCTGAATGG + Intergenic
1027857840 7:83535263-83535285 CCTTGCTTTCTAAGGAGGGGTGG + Intronic
1028621727 7:92834663-92834685 CCTCCCTTTCAAAGGGTGGGGGG + Intronic
1029054140 7:97722548-97722570 CCTTCCTTTTTAAGGCTGAATGG - Intergenic
1030935695 7:115583313-115583335 CCTTTCTTTCAGATACGGGATGG - Intergenic
1035829825 8:2683242-2683264 CCTTCATTTTAAAGGCAGGTAGG + Intergenic
1036762052 8:11516071-11516093 CCTTCCTTTCAAAGGCTGAGTGG - Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038490287 8:27965729-27965751 CCTTCCTTTCAAAGGGAGTCAGG + Intronic
1041483267 8:58346361-58346383 ATTTCCCTTAAAAGGCGGGAAGG + Intergenic
1047027148 8:120836387-120836409 CTGTCCTTTCAAAGCTGGGAAGG + Intergenic
1047068054 8:121309402-121309424 CCTTCTTTTTAAAGGCTGAACGG + Intergenic
1049482973 8:142835466-142835488 CCTTGCTTTCGAAGGAGAGAAGG + Intronic
1051056327 9:12991534-12991556 TCTTCCTTTTAAAGGATGGAAGG + Intergenic
1052326429 9:27220699-27220721 CCTTCCTAGCGAAGGAGGGACGG + Intronic
1052830278 9:33209626-33209648 CATTCCTTTCAAAGGCCCCAGGG + Intergenic
1053109892 9:35449608-35449630 CCTTCCTTTCACAGGAGAAATGG + Intergenic
1055384921 9:75750628-75750650 CCCTCCTTTTAAAGGTGGAATGG + Intergenic
1057551831 9:96056844-96056866 CCTCCCTTTGAAAGGATGGAAGG + Intergenic
1057591078 9:96373994-96374016 ACTTACTTTCAAAGGCTGGAGGG + Intronic
1059427490 9:114230333-114230355 CCTTCCTTGCAGAGGAAGGAAGG + Intronic
1062492427 9:136812740-136812762 CCTTTCTTTCAAATGGGAGAGGG + Intronic
1187571076 X:20502695-20502717 CCTTCTTTTAAAAGGCTGAATGG + Intergenic
1188951854 X:36385799-36385821 CCTTCTTTTTAAAGGCTGAACGG + Intergenic
1196932393 X:120695226-120695248 CCTTCTTTTGAAAGGCTGAATGG + Intergenic
1197391046 X:125865141-125865163 CCTTCCCTTCAAGGCCAGGAAGG + Intergenic
1197843963 X:130780816-130780838 CCTTCCCTGCAAACGAGGGAGGG - Intronic