ID: 1122953664

View in Genome Browser
Species Human (GRCh38)
Location 14:105060139-105060161
Sequence TCCCTCGGGTGCCTGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 146}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122953655_1122953664 23 Left 1122953655 14:105060093-105060115 CCCCCTGAGTGGAGATGGTGGGG 0: 1
1: 0
2: 6
3: 22
4: 192
Right 1122953664 14:105060139-105060161 TCCCTCGGGTGCCTGTGTGCTGG 0: 1
1: 0
2: 1
3: 9
4: 146
1122953659_1122953664 20 Left 1122953659 14:105060096-105060118 CCTGAGTGGAGATGGTGGGGCAG 0: 1
1: 0
2: 3
3: 30
4: 314
Right 1122953664 14:105060139-105060161 TCCCTCGGGTGCCTGTGTGCTGG 0: 1
1: 0
2: 1
3: 9
4: 146
1122953658_1122953664 21 Left 1122953658 14:105060095-105060117 CCCTGAGTGGAGATGGTGGGGCA 0: 1
1: 0
2: 2
3: 15
4: 222
Right 1122953664 14:105060139-105060161 TCCCTCGGGTGCCTGTGTGCTGG 0: 1
1: 0
2: 1
3: 9
4: 146
1122953657_1122953664 22 Left 1122953657 14:105060094-105060116 CCCCTGAGTGGAGATGGTGGGGC 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1122953664 14:105060139-105060161 TCCCTCGGGTGCCTGTGTGCTGG 0: 1
1: 0
2: 1
3: 9
4: 146
1122953652_1122953664 27 Left 1122953652 14:105060089-105060111 CCAGCCCCCTGAGTGGAGATGGT 0: 1
1: 0
2: 2
3: 14
4: 134
Right 1122953664 14:105060139-105060161 TCCCTCGGGTGCCTGTGTGCTGG 0: 1
1: 0
2: 1
3: 9
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122953664 Original CRISPR TCCCTCGGGTGCCTGTGTGC TGG Intronic
900167128 1:1248281-1248303 TCCCAGGGCTGCCTGTGTCCCGG - Intergenic
900167190 1:1248479-1248501 TCCCAGGGCTGCCTGTGTCCCGG - Intergenic
900167250 1:1248677-1248699 TCCCAGGGCTGCCTGTGTCCCGG - Intergenic
900474324 1:2869167-2869189 TCCCTGGGGTGCCCGGCTGCAGG + Intergenic
900554363 1:3272415-3272437 TCCAGCGCGTGCCTGTGGGCCGG - Intronic
902186103 1:14726531-14726553 TTCCTCGAGTGTCTGTGGGCTGG + Intronic
905484188 1:38284133-38284155 TCCCTCAGGTGCCTGAGTGTGGG + Intergenic
905863159 1:41363385-41363407 GCCCTGTGGTGCCTGTGAGCTGG + Intronic
905988396 1:42309808-42309830 TCCCTCAGGGGCCAGTGTGAAGG + Intronic
906189255 1:43885428-43885450 TGCCTCGCGTGCCGGGGTGCTGG + Intronic
907523439 1:55039909-55039931 TCCCGCGGGCGCCCGTGCGCAGG + Exonic
909776974 1:79493772-79493794 TCCCCTGGGTGCAGGTGTGCTGG + Intergenic
913220224 1:116654237-116654259 GCCCTCAGGAGCCTCTGTGCAGG - Intronic
917428578 1:174941522-174941544 TGCCTCGGGTGACACTGTGCAGG - Intronic
918296672 1:183163539-183163561 TCCATCATGTGTCTGTGTGCAGG - Intergenic
924742045 1:246800024-246800046 TCCCTCAGGGGCCTGAGTGACGG + Intergenic
1064150205 10:12856511-12856533 TCCCTCAGCTGCAGGTGTGCTGG - Intergenic
1065754900 10:28922216-28922238 TCTCTAGGCTGCCTGTCTGCTGG + Intergenic
1065846149 10:29745218-29745240 TCACTCAGGTGGCTGAGTGCTGG - Intergenic
1069862686 10:71481358-71481380 TCCCAAGGGTGGCTGTGAGCTGG - Intronic
1071188480 10:83073333-83073355 TCCCTCGGGTCCCTTTGGCCAGG - Intergenic
1072637573 10:97187538-97187560 TCTCAGGGGTGCCTGTGTGGTGG + Intronic
1073135048 10:101215751-101215773 TCAGTCGGGGGCCTGTGTGGAGG + Intergenic
1076012264 10:126999532-126999554 TCCCTGGGATGCCTGTATACAGG + Intronic
1076013057 10:127006105-127006127 TCCCACCTGTGCCTGTTTGCAGG + Intronic
1076238380 10:128883449-128883471 TGCCTGGTGTGCCTGTGAGCAGG - Intergenic
1076589301 10:131572175-131572197 TCCCTTGGGTGCTTCTGGGCTGG - Intergenic
1080015343 11:27500262-27500284 TCCTTCAGGAGCCTTTGTGCAGG + Intronic
1082091141 11:48090780-48090802 TCTCTCAGGTGCCTGTGCCCTGG + Intronic
1083552999 11:63604948-63604970 TCCCTCTGGTTTCTGGGTGCTGG + Intronic
1084021889 11:66422709-66422731 TCCCTCAGGCGCCAGAGTGCAGG + Exonic
1085644885 11:78216541-78216563 TCCCTCGGGTGCAAGTGTAGGGG - Exonic
1085887039 11:80533312-80533334 TCGATGGGCTGCCTGTGTGCTGG + Intergenic
1088578893 11:111298238-111298260 TCTGTGGGGTGCCTGTGTGCAGG + Intergenic
1091018142 11:132072821-132072843 TCACTGTGGTGCCTGTGTGTGGG + Intronic
1091461582 12:647156-647178 TCCCTCAGGTGTCTGTGCCCAGG + Intronic
1097825838 12:64173780-64173802 TCCCTCCGGTGCCTGTGGATTGG - Intergenic
1098157606 12:67615769-67615791 TGCCTCTAATGCCTGTGTGCAGG + Intergenic
1100333020 12:93603256-93603278 TACCTGGGGTCACTGTGTGCAGG + Intergenic
1102759321 12:115371807-115371829 TCCCTCGGTTGTCTCTCTGCTGG + Intergenic
1103073965 12:117967695-117967717 TGCCACGGGGGCTTGTGTGCCGG - Intronic
1105027177 12:132857005-132857027 GCCCTCACGTGCCTGGGTGCTGG + Intronic
1105027238 12:132857202-132857224 GCCCTCACGTGCCTGGGTGCTGG + Intronic
1106146340 13:27053046-27053068 TCCCTCGAGTGTGTGTGTCCGGG - Intergenic
1106349976 13:28921003-28921025 CCCCTGGGGTCCCTGAGTGCAGG - Intronic
1113178334 13:107594467-107594489 TCCCCTGTGTCCCTGTGTGCAGG + Intronic
1113856971 13:113452114-113452136 TCCCACAGGTGTCTGTGTGTGGG + Intronic
1114525657 14:23365799-23365821 TTCCAGGGGTGCCTGCGTGCTGG - Intergenic
1116417247 14:44693805-44693827 CCCCTCTGCTGCCAGTGTGCTGG - Intergenic
1117315029 14:54565728-54565750 GCCCTCGGGTCCCTTTCTGCCGG + Intergenic
1122953664 14:105060139-105060161 TCCCTCGGGTGCCTGTGTGCTGG + Intronic
1123449013 15:20348991-20349013 TCCCTCCTGTGCCTGTGAGCTGG + Intergenic
1124394551 15:29290074-29290096 TCCCTCTGGTACCTGTGCCCTGG - Intronic
1128300503 15:66563908-66563930 CACCTCGGATGCCTGTGGGCAGG + Exonic
1129692688 15:77722821-77722843 TCCATCGGGTGCCCTTGTGATGG - Intronic
1130330857 15:82921303-82921325 TCCCTCATGTGCCACTGTGCAGG + Intronic
1136187216 16:28595535-28595557 TCCCTCAGGTGTGTGTGTCCTGG - Exonic
1136271439 16:29151141-29151163 TGCCTTGGTTGCCTGTGTGTGGG + Intergenic
1137566705 16:49537906-49537928 CCCATCTGGTCCCTGTGTGCTGG - Intronic
1141736029 16:85854010-85854032 TACCTTGGCTGCCTGTATGCAGG - Intergenic
1141771765 16:86093962-86093984 TCCTTTGGGTGCCTGTGGCCTGG + Intergenic
1143770857 17:9167782-9167804 TTCCTTGGGTCACTGTGTGCAGG + Intronic
1144930007 17:18851403-18851425 TGCCACGGGGGCCTGTGTGTGGG + Intronic
1145234056 17:21196301-21196323 CCCCTCAGGTGTCTGAGTGCTGG - Intergenic
1145961033 17:28886662-28886684 TCCCTAGGCAGTCTGTGTGCAGG + Intronic
1146957188 17:36942602-36942624 GCCCTCGCGGGCCTGGGTGCAGG - Intronic
1147588031 17:41664155-41664177 TGCCTCAGGAGCCTGTGGGCAGG - Intergenic
1151461850 17:74259020-74259042 TCCCCAGGTAGCCTGTGTGCAGG + Intronic
1151815493 17:76469556-76469578 TCCCCTGGGTGCCTGTGGTCAGG - Intronic
1152693442 17:81732226-81732248 TGCCTCGGGAGCCTCTCTGCAGG + Intergenic
1153819270 18:8819215-8819237 TCCCTCTCGGGCCTGTGGGCTGG - Exonic
1154095685 18:11413174-11413196 TCCCTCTGATGCCTGTGAGAGGG - Intergenic
1158532798 18:58278633-58278655 TCCCTGTGGCCCCTGTGTGCAGG + Intronic
1160751162 19:735319-735341 GCCCACAGGTGCCTGTGTCCGGG + Intronic
1161320539 19:3638773-3638795 ACACTCACGTGCCTGTGTGCAGG + Intronic
1161627271 19:5334609-5334631 GCCCTGGGGTGTGTGTGTGCGGG + Intronic
1164671447 19:30074374-30074396 TGCCTGAGGTGCCTGTGTGTGGG - Intergenic
1166533264 19:43554978-43555000 TCCCTCTGGGGCCTGTGTCAGGG - Intronic
1166792072 19:45404483-45404505 TCCCTCCGGAGGCTGTGTCCCGG - Intronic
1167150660 19:47707474-47707496 ACCCTCTGGTGGCTGTTTGCGGG + Intergenic
1168290126 19:55353520-55353542 TCCTCCGTGTGCCTGTGTCCGGG - Intronic
1168293963 19:55369914-55369936 TCCCTCCGGAGCCTCTCTGCCGG + Intronic
926313091 2:11688559-11688581 TCGCTCGGGTCCCGGTGTCCTGG + Intronic
927839705 2:26432023-26432045 TCACTAGGGTGCCTGGGTGGCGG + Intronic
933253896 2:80059152-80059174 GCCCTCGGGTGTATATGTGCTGG - Intronic
935593724 2:104863795-104863817 TCGCTCGGGTCCCCATGTGCGGG + Intergenic
936831351 2:116652182-116652204 TCCATCCAGTGCCTGTGTGATGG - Intergenic
937603646 2:123771049-123771071 TCCCTCAGGTTCCTGTGACCAGG - Intergenic
942491071 2:176490371-176490393 TCCCTCGGTGGCCGGTGCGCAGG + Intergenic
944464891 2:199991281-199991303 TCCCTCTGGTGACTTTTTGCTGG - Intronic
946325923 2:218984760-218984782 TCCTTCGGGTCCCTGAGTCCCGG + Intronic
948262246 2:236613024-236613046 TCCCTCTGCTCCATGTGTGCAGG + Intergenic
948499345 2:238380405-238380427 TCCCCCGGGTCCCTGAGTGGTGG + Intronic
948909205 2:240994560-240994582 GCCCTCAGGTGCCTGGGTCCGGG + Intergenic
1168824806 20:802949-802971 TCACTCGGGTACCTTTCTGCTGG - Intergenic
1170603554 20:17859665-17859687 TCCCTCAGGAGCCTGGGCGCGGG - Intergenic
1174486882 20:50866723-50866745 CTCCGGGGGTGCCTGTGTGCTGG + Intronic
1175444921 20:59013370-59013392 TCCCTCTGGTGACTGTGGGAAGG + Intergenic
1176096028 20:63344993-63345015 ACCCCCGGGTGCCTGTGACCGGG - Exonic
1176150341 20:63587689-63587711 TCCCTAGGGCGCCTCTGAGCAGG + Exonic
1178096250 21:29218905-29218927 TTCCTAGTGTGCCTGTGTGTGGG + Intronic
1178439023 21:32583749-32583771 TCCCACGGGTCCCTGTGGCCAGG - Intronic
1179578085 21:42320169-42320191 TGCCTCCGGTGCCTGGGTGAGGG - Intergenic
1180821524 22:18832256-18832278 GCCCTCAGGAGCCTCTGTGCAGG - Intergenic
1181191454 22:21143789-21143811 GCCCTCAGGAGCCTCTGTGCAGG + Intergenic
1181207744 22:21266721-21266743 GCCCTCAGGAGCCTCTGTGCAGG - Intergenic
1184098467 22:42329267-42329289 GCCCTTGGCAGCCTGTGTGCTGG - Intronic
1185085362 22:48737944-48737966 TCCTGCGGTTGCCTGTGTGGGGG + Intronic
1185205245 22:49534112-49534134 TCCCTCGGGTGCAGATGTGGTGG - Intronic
1185223640 22:49641217-49641239 TCCCTGGGGTGTCTGTGGGCAGG - Intronic
1203219176 22_KI270731v1_random:28695-28717 GCCCTCAGGAGCCTCTGTGCAGG + Intergenic
1203271649 22_KI270734v1_random:58132-58154 GCCCTCAGGAGCCTCTGTGCAGG - Intergenic
957090318 3:75723675-75723697 GCCCTCTGGTGGCTGTGTCCGGG - Intronic
966126029 3:176577707-176577729 TCCCTCTGTTCCCCGTGTGCAGG + Intergenic
966859844 3:184224603-184224625 TCCTTCGGGTGCATCTGTGAGGG - Intronic
967878201 3:194281004-194281026 TCCCTGGGGTGCCTGTGTGGAGG + Intergenic
968278474 3:197458392-197458414 GCCTTAGGGTGCCTGTGTGCAGG - Intergenic
968278480 3:197458443-197458465 GCCTTAGGGTGCCCGTGTGCAGG - Intergenic
968521094 4:1035182-1035204 TCCCTGGGGTGCCCATGTGCAGG - Intergenic
969593028 4:8132675-8132697 TCCCTCGGGTGACTCAGTCCTGG + Intronic
971918846 4:32910247-32910269 TCCTGCAGGTGCCTGTGGGCGGG + Intergenic
972689085 4:41379247-41379269 TCCCTCATGTGCCTGTATGCAGG + Intronic
976172874 4:82322789-82322811 TCACTCTGGTGCCAGTGTGGAGG - Intergenic
978903584 4:113980605-113980627 TCCCTCTGCTGCCTTTGAGCAGG - Intergenic
981103755 4:140857694-140857716 CTCCTCGGGAGGCTGTGTGCAGG + Intergenic
981281884 4:142967855-142967877 TCCCTCTGGCGTCTGTGTGTTGG - Intergenic
983576933 4:169270714-169270736 GCCCTCGGGTCCCCGTGGGCCGG - Intronic
988975268 5:36508913-36508935 TCCCTCAGGTGCAGGTGTGTTGG - Intergenic
996738632 5:126778609-126778631 TCCCTCGGGTGGTTCTGCGCAGG + Intronic
998586379 5:143431749-143431771 CCCCTAGGGTGGCTGTGTACAGG - Intronic
1006300750 6:33192539-33192561 TCCCTTCGGTGGCTGTGGGCGGG - Intergenic
1011392290 6:86867501-86867523 TTCCTAGGGTGCCTTTGGGCTGG + Intergenic
1012448941 6:99334702-99334724 TCCCTCTGGTGGCAGTGTGGAGG - Intronic
1018099729 6:160426833-160426855 TCCCTTGGGTCCTGGTGTGCAGG + Intronic
1022813912 7:33895522-33895544 TCTCTCGGGAGTCTGGGTGCTGG + Intergenic
1023905779 7:44520875-44520897 TCTCTGGGGTGGCTGTGGGCTGG - Intronic
1027265321 7:76492014-76492036 CTCCTTGGGTGCCTGTGTGGAGG - Intronic
1027316689 7:76990130-76990152 CTCCTTGGGTGCCTGTGTGGAGG - Intergenic
1032160285 7:129504303-129504325 CCCCTTGGCTGCCTGTGGGCTGG + Intronic
1034137843 7:148787819-148787841 TCCTTTGCGTGCCTGTGTGTCGG + Intronic
1035884470 8:3277329-3277351 TCACCTGGGTGCCTGTGCGCAGG + Intronic
1037537283 8:19836383-19836405 AGCCTCGAGTGCCTCTGTGCAGG - Intronic
1040379041 8:46854548-46854570 TCACAAGGGTCCCTGTGTGCAGG - Intergenic
1048111888 8:131476615-131476637 ACCCTGGGGTGCCTCTGTGTGGG + Intergenic
1048451908 8:134540972-134540994 CCCCTCTGGTGCCAGTGGGCAGG - Intronic
1049270401 8:141692669-141692691 TCCCTTCGGTGCCTGTGGGCCGG + Intergenic
1049521417 8:143093223-143093245 GCCCACTGGTGCCTGTGTCCCGG - Intergenic
1050797243 9:9560211-9560233 TTCCTCTAGTGCCTGTGTCCTGG - Intronic
1053111340 9:35462501-35462523 TGCTTTGGTTGCCTGTGTGCTGG - Intergenic
1059661324 9:116404646-116404668 TCCCTCGGGTGGCAGTGTGAAGG + Intergenic
1061021010 9:128014758-128014780 CCCCTGGGGAGCCTGTGGGCTGG - Intergenic
1062331834 9:136048266-136048288 TCCCTGGGGTGGCTGTCAGCAGG + Intronic
1062403301 9:136381846-136381868 TCTCTGGGAAGCCTGTGTGCAGG + Exonic
1062459068 9:136655311-136655333 GCCCTAGGGTGACTGTGTGAAGG - Intergenic
1187660967 X:21545809-21545831 TCCCTCTGGTGCAGGTCTGCTGG - Intronic
1187669657 X:21656482-21656504 GCCGTCGGGGGCCTGGGTGCGGG - Exonic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic