ID: 1122953665

View in Genome Browser
Species Human (GRCh38)
Location 14:105060140-105060162
Sequence CCCAGCACACAGGCACCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122953665_1122953673 17 Left 1122953665 14:105060140-105060162 CCCTCGGGTGCCTGTGTGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 209
Right 1122953673 14:105060180-105060202 CTGCTCTGCCAAGATCCGTGTGG 0: 1
1: 0
2: 2
3: 12
4: 115
1122953665_1122953675 30 Left 1122953665 14:105060140-105060162 CCCTCGGGTGCCTGTGTGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 209
Right 1122953675 14:105060193-105060215 ATCCGTGTGGCCCTGTCGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122953665 Original CRISPR CCCAGCACACAGGCACCCGA GGG (reversed) Intronic