ID: 1122953672

View in Genome Browser
Species Human (GRCh38)
Location 14:105060173-105060195
Sequence GATCTTGGCAGAGCAGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122953672_1122953675 -3 Left 1122953672 14:105060173-105060195 CCAGCTGCTGCTCTGCCAAGATC 0: 1
1: 0
2: 5
3: 22
4: 245
Right 1122953675 14:105060193-105060215 ATCCGTGTGGCCCTGTCGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 54
1122953672_1122953679 18 Left 1122953672 14:105060173-105060195 CCAGCTGCTGCTCTGCCAAGATC 0: 1
1: 0
2: 5
3: 22
4: 245
Right 1122953679 14:105060214-105060236 GGCTGCTGCGCCCAGCTCCAAGG 0: 1
1: 0
2: 5
3: 30
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122953672 Original CRISPR GATCTTGGCAGAGCAGCAGC TGG (reversed) Intronic
900206605 1:1434418-1434440 GATCTTGGCAGTGGAGGTGCTGG - Intergenic
902843257 1:19088884-19088906 GACCTTGGCAGAGAACCTGCTGG - Exonic
904485172 1:30820005-30820027 CATCTGGACAGAGGAGCAGCTGG + Intergenic
904910873 1:33933234-33933256 TAAGTTGGCAGAGCAGAAGCAGG + Intronic
906508951 1:46400383-46400405 GACCTGGGCAGGGCAGCAGTTGG + Intronic
908114492 1:60927563-60927585 AATGTAGGCAGAGAAGCAGCTGG + Intronic
911771495 1:101748308-101748330 GCTGTTGGCAGACCAGAAGCTGG + Intergenic
913194944 1:116448509-116448531 GAACTAGGCAGAGCAGCAACAGG - Intergenic
915834933 1:159169217-159169239 GATCACTGCAGAGCAGCAGATGG + Intergenic
917970391 1:180202249-180202271 AGTCTTGCCAAAGCAGCAGCTGG - Exonic
920381351 1:205536315-205536337 GGTGGTGGTAGAGCAGCAGCAGG + Intergenic
920433389 1:205933066-205933088 GATCTTGGCTGAGGAACATCTGG + Exonic
923218863 1:231875023-231875045 GATCCAGGCAGAGCATCATCAGG + Intronic
924741291 1:246795489-246795511 TCTCCAGGCAGAGCAGCAGCTGG - Intergenic
1070982499 10:80660689-80660711 GATGGTGGCAGCGCAGGAGCAGG + Intergenic
1071333450 10:84583399-84583421 GAGCTTGGCACAGCAGCAGAGGG - Intergenic
1071447319 10:85760838-85760860 GTTGTTGCCAGAGCATCAGCAGG + Intronic
1071704681 10:87984464-87984486 GATCTTAGCAGAAAAGCATCTGG - Intergenic
1072894808 10:99357788-99357810 TATCTTGCCACAGCAGCACCTGG - Intronic
1074674508 10:115832852-115832874 GATCTTGTCAGAGCTGGGGCAGG - Intronic
1076663210 10:132069136-132069158 TGTCTGGGAAGAGCAGCAGCTGG - Intergenic
1077036949 11:499863-499885 GTCCTTCGCAGAGCAGCTGCAGG + Exonic
1077123482 11:921896-921918 GAATTTGGCCCAGCAGCAGCCGG + Intergenic
1077236323 11:1483641-1483663 CAAGTTGGCAGAGCAGCAGCTGG - Intronic
1077860359 11:6172599-6172621 GTGCTTGACAGAGGAGCAGCAGG - Intergenic
1078364567 11:10695312-10695334 GATCTTGTGAGTCCAGCAGCAGG + Intergenic
1078993339 11:16670814-16670836 GATCATGCCAGAGCTGCAGTGGG + Intronic
1079437720 11:20474517-20474539 AGTCCTGGCAGAGCAGCCGCTGG - Intronic
1079510901 11:21208936-21208958 GAGCTTAGCAGAGAATCAGCAGG + Intronic
1079698185 11:23510438-23510460 GCTCCTAGCAGAGCAGCAACTGG - Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1082213472 11:49535829-49535851 GATCTTGGAAGTGCAGAAGCAGG + Intergenic
1083008253 11:59368780-59368802 GATCTCCCCAGAGCTGCAGCAGG + Intergenic
1083022146 11:59518153-59518175 GATCTTAGCAGAGTATCAGCTGG - Intergenic
1083200914 11:61120559-61120581 GGTCCTGGAACAGCAGCAGCTGG + Intronic
1083901804 11:65646954-65646976 GACCTTCTCCGAGCAGCAGCTGG + Exonic
1085840185 11:80002520-80002542 CATCTGGTCAGAGCTGCAGCTGG - Intergenic
1086636137 11:89088605-89088627 GATCTTGGAAGTGCAGAAGCAGG - Intergenic
1090662739 11:128893286-128893308 CTTCTTGGAAGAGCAGCAGCAGG + Intronic
1091325741 11:134685868-134685890 GTTCCTGGGAGAGCAGCAACTGG - Intergenic
1093658609 12:21726570-21726592 GATGTTTGCAGAACAGCTGCAGG + Intronic
1097998110 12:65912466-65912488 GTTCTAGACAGAGCAGGAGCAGG - Intronic
1101017878 12:100520450-100520472 GATTTTGGCAGAAAAGCAACCGG - Intronic
1101260697 12:103026752-103026774 GATCTCGGAGGTGCAGCAGCTGG + Intergenic
1101260853 12:103028148-103028170 GATCTCGGAGGTGCAGCAGCTGG - Intergenic
1102045682 12:109828759-109828781 GCTCATGGCAGAGCTGGAGCTGG - Intronic
1102488279 12:113272942-113272964 TATTTTGGCAGAGGAGCAGTGGG + Intronic
1103928140 12:124435054-124435076 GAACCTGGCAGGCCAGCAGCAGG - Intronic
1104690686 12:130823740-130823762 GATTTTGTTACAGCAGCAGCAGG + Intronic
1107041405 13:35951786-35951808 GATGGTGGCAGAGCAAGAGCTGG - Intronic
1108139889 13:47409280-47409302 GGCCTTGGCAAAGCAGCAGCAGG + Intergenic
1109961950 13:69643366-69643388 CATCTTGGCATGGCAGGAGCAGG - Intergenic
1111226468 13:85279067-85279089 AATCTAGGAAGAACAGCAGCAGG - Intergenic
1113636916 13:111925703-111925725 GAGCTGGGCAGAGTCGCAGCGGG + Intergenic
1114253685 14:20983472-20983494 GATCCAGGCAGAGCAGCACCTGG - Intergenic
1118251207 14:64163321-64163343 GATTTTGATGGAGCAGCAGCGGG + Intronic
1120947324 14:90010804-90010826 CATTTTGTTAGAGCAGCAGCAGG + Intronic
1121314561 14:92953306-92953328 GCTCTGGTCAGAGCAGCAGGAGG - Intronic
1121778589 14:96607257-96607279 GTTCTGGGCAGAGCAACTGCAGG + Intergenic
1122019788 14:98828185-98828207 GATCTTCACATGGCAGCAGCTGG + Intergenic
1122051838 14:99066173-99066195 GAACTTGCCGGAGCAGCAGAGGG - Intergenic
1122241960 14:100375090-100375112 GATCCTGGCTGAGCAGTCGCGGG - Intronic
1122816574 14:104316944-104316966 GATGTGGGCAGAGCAGAGGCAGG + Intergenic
1122953672 14:105060173-105060195 GATCTTGGCAGAGCAGCAGCTGG - Intronic
1123072075 14:105646831-105646853 GACCAGGGCAGAGCAGCGGCAGG - Intergenic
1123091642 14:105744742-105744764 GACCAGGGCAGAGCAGCCGCAGG - Intergenic
1123091667 14:105744821-105744843 GACCAGGGCAGAGCAGCCGCAGG - Intergenic
1123091692 14:105744900-105744922 GACCAGGGCAGAGCAGCCGCAGG - Intergenic
1123091717 14:105744979-105745001 GACCAGGGCAGAGCAGCCGCAGG - Intergenic
1123091739 14:105745058-105745080 GACCAGGGCAGAGCAGCCGCAGG - Intergenic
1123091808 14:105745295-105745317 GACCAGGGCAGAGCAGCCGCAGG - Intergenic
1123091831 14:105745374-105745396 GACCAGGGCAGAGCAGCCGCAGG - Intergenic
1123091937 14:105745809-105745831 GATCAGGGCAGAGCAGCCACAGG - Intergenic
1123092078 14:105746358-105746380 GACCAGGGCAGAGCAGCCGCAGG - Intergenic
1123097548 14:105773641-105773663 GATCAGGGCAGAGCATCAGAAGG - Intergenic
1123114459 14:105888289-105888311 GATGTGGGCAGAGCCTCAGCAGG - Intergenic
1124328824 15:28789552-28789574 GATCATGGCGCCGCAGCAGCTGG + Intergenic
1124373213 15:29115155-29115177 GGTCTGGGGACAGCAGCAGCAGG + Intronic
1125267872 15:37904555-37904577 CAACATGGCAGAGGAGCAGCTGG + Intergenic
1125390315 15:39185313-39185335 GCCAGTGGCAGAGCAGCAGCAGG - Intergenic
1128941650 15:71792295-71792317 GATTTGGGCAGAGGAGCAACAGG + Intergenic
1130046615 15:80450740-80450762 GATGATGGCAGAGCGGCCGCAGG + Intronic
1131156022 15:90076094-90076116 GTTCTTAGCAAAGCAGCCGCTGG + Intronic
1132882791 16:2169872-2169894 AGGCTCGGCAGAGCAGCAGCTGG + Intronic
1132936459 16:2483738-2483760 CCTCTGGGCCGAGCAGCAGCCGG - Intronic
1133297576 16:4762420-4762442 GATCTTGGGTGGGCAGCCGCCGG - Intronic
1133403590 16:5506117-5506139 AAGCTTGGCAGACCAGCAGGAGG - Intergenic
1133441610 16:5825397-5825419 GCTCTTAACAGAGCAGCACCAGG + Intergenic
1133719773 16:8484070-8484092 GCTCTTGGCTGAGCAGAAGCTGG + Intergenic
1133843744 16:9435437-9435459 GATCAGGGCAGAGCATCAGAAGG + Intergenic
1134113119 16:11528356-11528378 GCTCTTATCACAGCAGCAGCGGG + Intergenic
1135714828 16:24753943-24753965 GGTTTTGGCAAAGCACCAGCTGG - Intronic
1135971364 16:27074299-27074321 CATCATGGCAGAGAAGCAGGAGG + Intergenic
1137671444 16:50281819-50281841 GCACTGGGCAGAGCAGCTGCTGG + Intronic
1137815992 16:51397858-51397880 GATCTTGGGTCAGCAGGAGCAGG + Intergenic
1138459266 16:57138415-57138437 GTTTTTGGCAGGGCAGCGGCTGG - Intronic
1138636633 16:58344514-58344536 TATCTTGTCAGAGCAGAAGGGGG + Intronic
1138694823 16:58803297-58803319 GAACTGGGCTGAGCAGCAGGAGG + Intergenic
1139087078 16:63599800-63599822 AACCTTGACAGAGCAGCAGATGG - Intergenic
1141657370 16:85423354-85423376 GGCCACGGCAGAGCAGCAGCTGG - Intergenic
1141857605 16:86694519-86694541 GACCTTGGCAGGGGAGCAGCAGG + Intergenic
1142124534 16:88403595-88403617 GAGGGTGGCAGAGCAGCTGCTGG + Intergenic
1142232178 16:88905162-88905184 GAGCTCTGCACAGCAGCAGCTGG + Intronic
1144646879 17:16981121-16981143 ACTCCTGGCAGGGCAGCAGCAGG - Intergenic
1145279815 17:21458717-21458739 AATCTTGGAAGAGCTGCAGTGGG + Intergenic
1149334385 17:55620510-55620532 GATCTATGCAGGGCAGCAGAAGG - Intergenic
1149498429 17:57133807-57133829 GATCCTGGCAGACCAGCCCCAGG + Intergenic
1150503011 17:65669112-65669134 CATTTTGGGAGAGCGGCAGCTGG + Intronic
1150782571 17:68134941-68134963 GGCCTTGGCAGAGGCGCAGCTGG - Intergenic
1150796180 17:68239156-68239178 GCTCTATGCAAAGCAGCAGCAGG - Intergenic
1151163575 17:72185786-72185808 GATTACAGCAGAGCAGCAGCAGG + Intergenic
1152113150 17:78368474-78368496 GATCGTGGCAGAGCTCCAGCTGG + Intergenic
1153027740 18:686805-686827 GCTCTTTGCAAAGCAGCAGGGGG - Intronic
1153854945 18:9136663-9136685 GAGCCTGGCTGAGCAGCAGGAGG + Intronic
1153991578 18:10405296-10405318 GAACTTGTCGCAGCAGCAGCAGG + Intergenic
1154330889 18:13428332-13428354 GCTCTGGGCAGAGGAGCAGCAGG + Intronic
1156161090 18:34359020-34359042 GATCTCTGAAGGGCAGCAGCAGG - Intergenic
1156387155 18:36615891-36615913 GATCTTGGGAGAGAAGAAACTGG + Intronic
1160535764 18:79590494-79590516 GCTCTGGCCAGAGCAGCAGGAGG + Intergenic
1164683454 19:30151193-30151215 GAGCTTGGCCGAGAAGTAGCTGG - Intergenic
925097712 2:1220458-1220480 CAACAAGGCAGAGCAGCAGCAGG - Intronic
925140120 2:1544337-1544359 GTGCATGGCAGGGCAGCAGCTGG - Intergenic
925155979 2:1649194-1649216 GATCATGACAGAGAAGCAGGGGG + Exonic
925285400 2:2712424-2712446 GATGTTGGCAGAACAGCAGCTGG - Intergenic
927203088 2:20590525-20590547 GAGGTTGACAGAGCAACAGCTGG - Intronic
929432215 2:41896914-41896936 GATCCTGGGAGGGTAGCAGCAGG - Intergenic
929576220 2:43054529-43054551 GAGCTTATCAGAGCAGCTGCTGG + Intergenic
929604406 2:43225570-43225592 GAACTTGGGCGAGCAGCTGCCGG + Exonic
930257333 2:49107342-49107364 GATCTTAGCAGAGCCTAAGCAGG - Intronic
931070226 2:58638979-58639001 TATCTTGGGGAAGCAGCAGCAGG + Intergenic
931334698 2:61327707-61327729 GATCTTTGAAGTGCAGCATCGGG - Intronic
932340739 2:70961300-70961322 GAGGTGGGCAGAGCAGCAGCTGG + Intronic
932466082 2:71925322-71925344 GTTCTGGGCAGAGCAGGGGCCGG - Intergenic
936935605 2:117836147-117836169 ACGCTTGTCAGAGCAGCAGCTGG + Intergenic
937045141 2:118847149-118847171 GAGCATGGAAGAACAGCAGCCGG - Exonic
937955499 2:127419863-127419885 GGTGCAGGCAGAGCAGCAGCGGG + Intronic
939591370 2:144067597-144067619 GAGCCAGGCAGAGAAGCAGCTGG + Intronic
939933578 2:148260679-148260701 GACCTGGGTAGAGCAGCATCTGG - Intronic
940597680 2:155815790-155815812 GATCTCTGCAGAGGAGGAGCAGG - Intergenic
940790550 2:158026221-158026243 TATCCTCGCAGAGCAGCATCGGG + Intronic
941035994 2:160569885-160569907 GAGTTTCCCAGAGCAGCAGCAGG + Intergenic
941610136 2:167651548-167651570 GAACTTGGAATAGAAGCAGCTGG - Intergenic
941753233 2:169156127-169156149 GGTGTTGGAAGAGAAGCAGCTGG + Intronic
945016233 2:205520056-205520078 GATCTCTCCAGAGCAGCAGTGGG - Intronic
946848006 2:223878247-223878269 GCTGTTGTCAGAGCAGGAGCTGG - Exonic
947385003 2:229582317-229582339 GATTTTGTAAGAGAAGCAGCTGG + Intronic
947768197 2:232650945-232650967 GATGTTGGCAGAGAAGGAGCTGG + Intronic
947993131 2:234502844-234502866 GACCTTAGGAGAGCAGCTGCAGG - Intergenic
948154602 2:235771227-235771249 GAACTTGTTAGAGCAGCTGCAGG + Intronic
948565682 2:238884694-238884716 GACCGTGGGACAGCAGCAGCCGG - Intronic
948660157 2:239501958-239501980 GAGCTGGGCAGGGCTGCAGCTGG - Intergenic
1168904172 20:1390894-1390916 CATGTTTCCAGAGCAGCAGCAGG - Intronic
1171939207 20:31308327-31308349 TGTCTTGGCAGAGCAGAACCAGG + Intronic
1172022458 20:31924214-31924236 GAAGTGGGCAGAGCAGCGGCAGG - Intronic
1175650208 20:60715333-60715355 ATCCTCGGCAGAGCAGCAGCAGG + Intergenic
1176222361 20:63975689-63975711 GACCTTGGCTGAGCAGCTGCAGG + Exonic
1179887926 21:44322319-44322341 GCTCTGGGCAGACCACCAGCAGG - Intronic
1180709997 22:17832992-17833014 GTGCTTGGCAGTGCAGCAGCTGG - Intronic
1181943341 22:26496152-26496174 GAGCTTGGCAGAGGAGTCGCTGG + Exonic
1185302175 22:50087628-50087650 GGTCTGGGCAGAGCAGCATCCGG + Intergenic
951898411 3:27633014-27633036 GATCTAGGCCCTGCAGCAGCAGG + Intergenic
952775027 3:37037327-37037349 AAACTTGGTAAAGCAGCAGCAGG + Intronic
953349436 3:42203548-42203570 GCTCTTGGCAGAGTAGCAGCAGG - Intronic
954937198 3:54337367-54337389 AAGCTTGGCAGAGCAGATGCAGG + Intronic
956932706 3:74063649-74063671 GATCTTGTTTGGGCAGCAGCAGG - Intergenic
957724235 3:84044338-84044360 CCTCTTGTCAGATCAGCAGCAGG - Intergenic
959505317 3:107150735-107150757 GAGCTTGGCACTGCAGCAGTGGG + Intergenic
961537693 3:127580035-127580057 TGTCTTCGTAGAGCAGCAGCAGG + Exonic
961623557 3:128243674-128243696 GTTCTGGGCAAAGCAGGAGCAGG + Intronic
963065559 3:141260966-141260988 GCTCTTGGCAAAGGAGCACCAGG - Intronic
965061305 3:163788456-163788478 GATCTTGGGACATCAGCTGCAGG - Intergenic
965679614 3:171236559-171236581 GATGTTGGCAGGGCAGCGTCTGG - Intronic
966704153 3:182892490-182892512 GATCCTGGGAGAGGAGCAGGAGG + Intronic
968233758 3:197019301-197019323 GTTCTTGGCTGAGGAGAAGCGGG - Intronic
968292264 3:197547840-197547862 GATGAGGGCAGAGCAGGAGCCGG - Intronic
969838251 4:9860876-9860898 AATCCAGGCAGAGGAGCAGCTGG - Intronic
969849170 4:9943117-9943139 AGTCTTGGGAGAGCAGCAGAGGG - Intronic
969879220 4:10159117-10159139 GCTCTTGACAGGGCAACAGCTGG + Intergenic
970008881 4:11436868-11436890 GACCTGGGCAGAACAGCAGGAGG - Intergenic
972756315 4:42051044-42051066 AATCTGGGCAGAGAACCAGCAGG + Intronic
973598838 4:52520947-52520969 GAGCTTGTCAGAGCTGCAGGAGG - Intergenic
974227972 4:59072967-59072989 GAACTTGGCAGTGGAGCAGGAGG - Intergenic
976869342 4:89771913-89771935 GATCTTGGGAGCTCAGAAGCAGG - Intronic
978712453 4:111800751-111800773 CATCATGGCAGAGCTGAAGCGGG + Intergenic
980985695 4:139692304-139692326 GATCCTGGGTGAGCAGCAGGTGG - Intronic
982737513 4:159021441-159021463 GCTCCTGGGTGAGCAGCAGCTGG + Intronic
982827849 4:160022685-160022707 GATCTTTGCAGAGCTAGAGCAGG + Intergenic
983872173 4:172835112-172835134 GACCTTGGTAGGGCAGAAGCTGG - Intronic
984865718 4:184278722-184278744 AATGTTGGCAGAGCAGCTTCTGG - Intergenic
985589631 5:757835-757857 GAGCTAGGCAGTGCAGCAACGGG + Intronic
985746323 5:1650772-1650794 GCTCTTGGCCGTGCAGCAACAGG - Intergenic
985944251 5:3164190-3164212 CATGGTGGCAGAGCACCAGCAGG + Intergenic
986060525 5:4186000-4186022 CTTCATGGCAGAGCAGGAGCTGG + Intergenic
986581711 5:9272422-9272444 GTTTTTGGCAGAGCTTCAGCAGG + Intronic
987286714 5:16465080-16465102 GAAGTTGGCAAAGCAGCAGGAGG - Exonic
988394770 5:30682665-30682687 CCTCTTGGCAGAGAAGCAGGGGG + Intergenic
988859963 5:35267488-35267510 GAGTTGGGGAGAGCAGCAGCTGG + Intergenic
988984722 5:36606456-36606478 AATCTTGGCACACCAGAAGCAGG - Exonic
989761540 5:45022158-45022180 GATCTTGCAAGAACAGCACCAGG - Intergenic
989780681 5:45261985-45262007 TCTCTTGGAAGAGCAGCTGCTGG + Exonic
990727361 5:58771104-58771126 GATCTTGGTAGAGCAGGAGCTGG - Intronic
990731984 5:58819076-58819098 GATTTGGGAAGAGGAGCAGCTGG + Intronic
991301634 5:65134251-65134273 GCTCTTGCCAGAGCATCAGAAGG - Intergenic
991631677 5:68662254-68662276 GGTCATGGCAGAGCAGGAGGAGG - Intergenic
991958611 5:72020058-72020080 GATCTGAGCTGGGCAGCAGCTGG - Intergenic
993034793 5:82745011-82745033 TACCATGGCAGAGCAGGAGCGGG - Intergenic
994369192 5:98949382-98949404 GATCTTGACAGTGCTGCAGATGG + Intergenic
998430087 5:142063220-142063242 GCTCTGGGCAGAGCTGCAGCTGG - Intergenic
999705840 5:154271869-154271891 GAAGGAGGCAGAGCAGCAGCTGG - Intronic
1002164556 5:177336366-177336388 GCTCTGCGCAGAGCAGCAGGAGG + Intronic
1002194830 5:177496179-177496201 GAGCTTGGGAGAACAGCATCGGG + Intronic
1003643408 6:7894731-7894753 GATTTTGGCAGCCCAGCATCTGG - Intronic
1006143592 6:31945372-31945394 GATTCTGGCAGGGCAGCAGAGGG - Exonic
1006743770 6:36326963-36326985 GAGCTTGGCAGAGGAGGAGGAGG + Intronic
1008421344 6:51303174-51303196 CAGGTGGGCAGAGCAGCAGCTGG + Intergenic
1008568744 6:52794557-52794579 AATCTTGGCACAGCATCAGTGGG - Intronic
1009355627 6:62740500-62740522 CATGTTGGCAAAGCAGCAGGGGG - Intergenic
1009423417 6:63488110-63488132 TATCTTGTCAGAAAAGCAGCTGG - Intergenic
1010374697 6:75153669-75153691 GATCTGGGCAGAGCAGGAGCAGG - Intronic
1013414839 6:109915791-109915813 AAACTTGGTAAAGCAGCAGCAGG + Intergenic
1013758975 6:113494195-113494217 GACCTTGACAGAGCAGAATCAGG - Intergenic
1013758990 6:113494326-113494348 GACCTTGACAGAGCAGAATCAGG - Intergenic
1014211168 6:118709737-118709759 GGTCTTTGCAGAGCAGCATTTGG - Intronic
1017814561 6:158007406-158007428 GGTCTGGGCAGAGCATCTGCTGG - Intronic
1017948744 6:159117929-159117951 GATCTTGGCATGGCATCAACAGG - Intergenic
1018894408 6:168003457-168003479 GATGATGGCAGAGAAGCAGAGGG + Intronic
1022196409 7:28071574-28071596 AATCTTGGCAGATTAGGAGCTGG - Intronic
1022481149 7:30743964-30743986 GCATTGGGCAGAGCAGCAGCAGG - Intronic
1023993193 7:45142666-45142688 CATGTTCTCAGAGCAGCAGCAGG + Intergenic
1024094866 7:45975531-45975553 TAACATGGCAGAGAAGCAGCAGG + Intergenic
1024117527 7:46208087-46208109 GCTCTTGGCTGGGTAGCAGCAGG + Intergenic
1025058550 7:55784919-55784941 TATCCTGGCAGGGCAGGAGCTGG - Intergenic
1025827824 7:65024882-65024904 AATCCTGGCAGAGCAGCAGCTGG + Intergenic
1025915353 7:65861324-65861346 AATCCTGGCAGAACAGCAGCTGG + Intergenic
1026006052 7:66601199-66601221 TATCCTGGTAGAGCAGGAGCTGG - Intergenic
1026247776 7:68636427-68636449 GCTCCTGGCAGAGCAGCTCCAGG + Intergenic
1027238148 7:76310285-76310307 GGTCTGGGCAGGGCAGGAGCAGG + Intergenic
1029252991 7:99250331-99250353 GTTCTTGGCAGAGGAGAAACAGG + Intergenic
1029281603 7:99439130-99439152 GATCGCGGTGGAGCAGCAGCTGG + Exonic
1029691611 7:102185840-102185862 GATCTTGACAGAGCTGAGGCCGG - Intronic
1030668581 7:112309119-112309141 CACCTTGGAAGAGCAGAAGCAGG - Intronic
1032565806 7:132941674-132941696 GCTCTTAGCAGAGGAGCAGTTGG - Intronic
1034253650 7:149713208-149713230 GAGCTGGGCAGTGCAGCAGGAGG + Intergenic
1034564889 7:151905434-151905456 GCTCTGGGCATAGCAGCAGCAGG + Intergenic
1034734407 7:153414837-153414859 TCTATTGGAAGAGCAGCAGCTGG + Intergenic
1035024719 7:155818060-155818082 GAAGTGGGCAGAGCAGAAGCGGG - Intergenic
1037170578 8:15886930-15886952 ATGCTTGGCAGAGCAGCAGGAGG + Intergenic
1039797708 8:40929361-40929383 GATCTTAGCAGACCATCAGAAGG - Intergenic
1041389139 8:57333600-57333622 GATCTACGGAGAGGAGCAGCTGG + Intergenic
1043150151 8:76705255-76705277 GAGCTCAGCAGAGCAGCCGCTGG + Exonic
1043773761 8:84238635-84238657 GAGCTTGGCAGAGAAGCAAGGGG + Intronic
1044932887 8:97266677-97266699 GCACTTGGCAAAGCAGCACCAGG + Intergenic
1046579054 8:116068774-116068796 GTTCTTGGAAGAACAGCACCAGG - Intergenic
1049084861 8:140470737-140470759 GAGCTAGGCAGAGCTGGAGCAGG - Intergenic
1049682489 8:143925863-143925885 GAGGCTGGCTGAGCAGCAGCGGG - Exonic
1049758014 8:144319377-144319399 GATGTGAGCAGATCAGCAGCTGG - Intronic
1050890578 9:10819398-10819420 GGGCTTCACAGAGCAGCAGCGGG + Intergenic
1051694335 9:19751967-19751989 TTTCTTTGCAGAGAAGCAGCTGG - Intronic
1052574046 9:30268407-30268429 ATTCTGGGCAGAGCAGCAGGAGG - Intergenic
1053169719 9:35869840-35869862 GATCCTGGCAGTGCTGAAGCTGG - Exonic
1053236766 9:36462180-36462202 GACCTTGGCAGAGCAGTTTCAGG + Intronic
1055146789 9:72945324-72945346 TATCTCGGCAGGGCAGCAACTGG + Intronic
1056814595 9:89792169-89792191 GACCTGGGCTGAGCAGAAGCTGG + Intergenic
1059394874 9:114028030-114028052 GGTCTTGGGAGAGCATCAGTTGG - Intronic
1060662294 9:125411427-125411449 GATCAGGGCACAGCAGGAGCGGG - Intergenic
1062095118 9:134699067-134699089 GCTCTTGGCAGAACTGCAGGTGG + Intronic
1062153517 9:135033601-135033623 GGTCTTGGCAGAACAGCATAAGG + Intergenic
1062342940 9:136101856-136101878 GGTCCTGGCAGAGGAGCAGCGGG - Intergenic
1062481705 9:136755363-136755385 GTCCCTGGGAGAGCAGCAGCTGG + Intronic
1191739533 X:64422330-64422352 AATCATGGCAGTGAAGCAGCAGG + Intergenic
1197377908 X:125705115-125705137 CACTTTGGCAGGGCAGCAGCAGG + Intergenic
1200117525 X:153775871-153775893 CATCTTGGCAGTGCAGGAGGTGG + Exonic
1200140068 X:153896242-153896264 ATTTTTGGCACAGCAGCAGCAGG + Intronic