ID: 1122953903

View in Genome Browser
Species Human (GRCh38)
Location 14:105061118-105061140
Sequence CGGTGGGAACAACCCAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122953898_1122953903 -9 Left 1122953898 14:105061104-105061126 CCCAGCAGGAGGCCCGGTGGGAA 0: 1
1: 0
2: 0
3: 14
4: 168
Right 1122953903 14:105061118-105061140 CGGTGGGAACAACCCAAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 131
1122953889_1122953903 23 Left 1122953889 14:105061072-105061094 CCTGGCGAGGATGCCTGGAAAGA 0: 1
1: 0
2: 0
3: 39
4: 150
Right 1122953903 14:105061118-105061140 CGGTGGGAACAACCCAAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 131
1122953899_1122953903 -10 Left 1122953899 14:105061105-105061127 CCAGCAGGAGGCCCGGTGGGAAC 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1122953903 14:105061118-105061140 CGGTGGGAACAACCCAAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 131
1122953892_1122953903 10 Left 1122953892 14:105061085-105061107 CCTGGAAAGAGTCAGTGGGCCCA 0: 1
1: 0
2: 2
3: 12
4: 184
Right 1122953903 14:105061118-105061140 CGGTGGGAACAACCCAAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 131
1122953887_1122953903 29 Left 1122953887 14:105061066-105061088 CCACAGCCTGGCGAGGATGCCTG 0: 1
1: 0
2: 0
3: 17
4: 214
Right 1122953903 14:105061118-105061140 CGGTGGGAACAACCCAAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122953903 Original CRISPR CGGTGGGAACAACCCAAGGC AGG Intronic
900174915 1:1287380-1287402 TGCTGGGAGCCACCCAAGGCTGG + Intronic
902814125 1:18906412-18906434 CTTGGGGAACAACCCAGGGCCGG + Exonic
903536747 1:24071925-24071947 CAGTGGGAACTGCACAAGGCTGG + Intronic
904567223 1:31435096-31435118 CGGTGGTAACAATTCCAGGCAGG - Intergenic
904586956 1:31585938-31585960 AGGTTGTAAGAACCCAAGGCAGG - Intronic
906658662 1:47567044-47567066 CAGTGAGACCAGCCCAAGGCTGG - Intergenic
912445139 1:109730054-109730076 AGGTGGGGACAACTCAAAGCAGG + Intronic
918044759 1:180935217-180935239 CGGTGGGCACAGGCCGAGGCGGG + Exonic
1063505933 10:6599784-6599806 CTGTGGGATCAACCCCAGGGAGG + Intergenic
1064013365 10:11754287-11754309 GGATGGGAATACCCCAAGGCAGG - Intronic
1066102907 10:32133678-32133700 CAGTGGGGACAACTCAAAGCAGG - Intergenic
1066326836 10:34368690-34368712 AGGTGGGAGCAGCCCAAGTCAGG + Intronic
1069229895 10:65996246-65996268 CAGTGGGAGCAGCCCCAGGCAGG + Intronic
1069838316 10:71323362-71323384 TGGTCGGGACAGCCCAAGGCTGG + Intronic
1070612207 10:77941020-77941042 GGGTGGAAACAACCCCAGGAAGG - Intergenic
1072953667 10:99870291-99870313 CTGTGGGTACAACCCATGGAGGG - Intergenic
1077411253 11:2404959-2404981 GGCTGGGAACAACCCGGGGCTGG - Exonic
1078993997 11:16678604-16678626 CAGTGGGTACAACCCAAGGATGG + Intronic
1081682461 11:45017801-45017823 CAGTGGGTACAGCCCAAGGAGGG - Intergenic
1083202509 11:61129137-61129159 CTCTGGCACCAACCCAAGGCAGG + Intergenic
1083343535 11:61974089-61974111 CAGTGGGAACAGCCACAGGCTGG - Intergenic
1083466889 11:62853630-62853652 GGGTGGGAACAACATAATGCGGG - Intergenic
1085324261 11:75594661-75594683 TGGTGGGAAAAACACATGGCTGG + Intronic
1089388963 11:118087000-118087022 CAGTGGGGAAAACCCAAGGGAGG - Intronic
1091958660 12:4672069-4672091 CGGTGGGTGCAGCCCAAGGAGGG + Intronic
1093078937 12:14787416-14787438 TGGTGGGAACAGCCCAGGGGGGG + Exonic
1096711991 12:53464386-53464408 CTGTGGGAACAATCCATGACAGG - Intronic
1097463733 12:59896408-59896430 CTGTGGTACCAACCCAGGGCAGG - Intergenic
1102884192 12:116508979-116509001 CGCTGGGAACAGCCCAAGCGTGG - Intergenic
1106326394 13:28694196-28694218 CAGTGGGAACAGCCCACGGAGGG - Intergenic
1106410397 13:29507338-29507360 CGGTGGGAGTGACCCAAGCCTGG - Intergenic
1113676237 13:112209694-112209716 CGGTGGGAAGACCCCAGAGCCGG + Intergenic
1118428269 14:65691316-65691338 AGTTGGGAACAACACAAGGATGG - Intronic
1118903976 14:70010200-70010222 GGGTGGGGAGAAGCCAAGGCTGG + Intronic
1120764319 14:88314745-88314767 CTGTGAGAACAGCACAAGGCAGG + Intronic
1122953903 14:105061118-105061140 CGGTGGGAACAACCCAAGGCAGG + Intronic
1123012741 14:105357213-105357235 AGGAGGGGACAGCCCAAGGCTGG - Intronic
1202936703 14_KI270725v1_random:94256-94278 CGGGGGGAACAAGCCGCGGCGGG + Intergenic
1124600314 15:31128288-31128310 CGGTGGGCACAGCCCAGGACAGG - Intronic
1129862732 15:78875225-78875247 CTGTGGGAACAACCTAAGGATGG + Intronic
1133970238 16:10562423-10562445 CTGTGTGAACAAGCCCAGGCTGG + Intronic
1135277684 16:21127588-21127610 CAGTGGGACAAACCCCAGGCTGG + Intronic
1136716978 16:32289046-32289068 GGGAGGGAACAGCCCAAGGGTGG + Intergenic
1136835355 16:33495291-33495313 GGGAGGGAACAGCCCAAGGGTGG + Intergenic
1203009448 16_KI270728v1_random:228741-228763 GGGAGGGAACAGCCCAAGGGTGG - Intergenic
1203145526 16_KI270728v1_random:1795612-1795634 GGGAGGGAACAGCCCAAGGGTGG + Intergenic
1143294146 17:5857938-5857960 TGGTGGGGACAACCCAGGTCTGG + Intronic
1145289828 17:21534356-21534378 TGGTGGGATCAGCCGAAGGCAGG - Exonic
1148047648 17:44753804-44753826 CGGTGGTATCACCCCAGGGCTGG + Intergenic
1148756127 17:49973830-49973852 CTCTGGGATCTACCCAAGGCAGG + Exonic
1149478915 17:56985982-56986004 CAGTGGGAGTGACCCAAGGCTGG - Intronic
1150741899 17:67785836-67785858 CACTGGGAAGAACACAAGGCTGG + Intergenic
1153006040 18:499868-499890 CAGTGGGCACACCCCAAGGCGGG + Intronic
1153728213 18:7979903-7979925 GGGAGGGATCAACCCAGGGCGGG - Intronic
1153982997 18:10328500-10328522 CTTTGGGAAGAAGCCAAGGCAGG + Intergenic
1160452321 18:78974036-78974058 CGGTGGGAACAGCCCGCGCCGGG + Intergenic
1160993749 19:1872490-1872512 CGGAGGGAACAGGCCCAGGCGGG - Intergenic
1161376010 19:3939219-3939241 AGCTGGGATCAACCCAAGTCTGG + Intronic
1161687675 19:5711431-5711453 TGGTGGGAAGAAGCCAGGGCTGG + Intronic
1164047627 19:21555949-21555971 CAGTGGGTACAACCCATGGAGGG - Intronic
1167750495 19:51376634-51376656 AGGTGGGGACAACTCAAAGCAGG - Intergenic
926483537 2:13428102-13428124 CGGTGGGTGCAACCCATGGATGG - Intergenic
927037431 2:19193613-19193635 CTGAGGAAAAAACCCAAGGCTGG - Intergenic
928296058 2:30085110-30085132 GGGAGGAAACCACCCAAGGCTGG + Intergenic
931808632 2:65832427-65832449 TTGAGGGAAGAACCCAAGGCAGG + Intergenic
933900875 2:86849248-86849270 AGAGGGGAACAAGCCAAGGCTGG + Intronic
935779667 2:106499983-106500005 AGAGGGGAACAAGCCAAGGCTGG - Intergenic
946242932 2:218367884-218367906 CGGTGGGAGGAGCCCAAGGCCGG - Exonic
946357784 2:219199353-219199375 CGGTGGGAACAACAAGCGGCAGG - Intronic
1171255456 20:23686345-23686367 CAGAGGGAAGAACCCAGGGCAGG + Intronic
1171262798 20:23748267-23748289 CAGAGGGAAGAACCCAGGGCAGG + Intronic
1171275807 20:23855773-23855795 CAGAGGGAAGAACCCAGGGCAGG + Intergenic
1173873756 20:46357232-46357254 GGAGGGGACCAACCCAAGGCCGG - Intronic
1177540906 21:22493297-22493319 CGGTGGGTACAGCCCACAGCGGG + Intergenic
1179086524 21:38223081-38223103 AGGTGGGGACAACTCAAAGCAGG + Intronic
1179420169 21:41229166-41229188 CAGTGGAAACAACACAGGGCTGG - Intronic
1183725766 22:39588774-39588796 CGTTGGGGAGTACCCAAGGCAGG - Intronic
1183749340 22:39710907-39710929 GGGTGGCACCAATCCAAGGCTGG - Intergenic
1184478204 22:44732637-44732659 GGGTGGGCACAGCCCCAGGCTGG - Intronic
949683497 3:6541793-6541815 CAGTGGGCGCAACCCAAGGAGGG - Intergenic
950521949 3:13502511-13502533 GGGTCGCAAGAACCCAAGGCAGG - Intronic
951808832 3:26677387-26677409 CAGTGGTCACAACCCCAGGCAGG + Intronic
954804025 3:53204935-53204957 CTGAGGAAACCACCCAAGGCTGG + Intergenic
957041833 3:75341712-75341734 CGGTGGGAAGAACCCAGAGAAGG - Intergenic
958023295 3:88021924-88021946 AGGTGGGACCAACTCAAAGCAGG + Intergenic
958482909 3:94667039-94667061 AGGTGGCAACAACCCCAAGCAGG + Intergenic
961033943 3:123629352-123629374 TGCTAGGAACGACCCAAGGCGGG + Intronic
961127569 3:124434257-124434279 CCGTGGGAACAACCCAGGCGTGG - Intronic
965709121 3:171538580-171538602 CTGTGGGATCAGGCCAAGGCAGG - Intergenic
968425703 4:521920-521942 GGGTGGAAACACCCCAAGGAAGG + Exonic
974044255 4:56884445-56884467 CAGTGGGTACAGCCCAAGGAGGG + Intergenic
977220048 4:94327634-94327656 CTGTGGCAACAGCCCCAGGCAGG + Intronic
977897900 4:102384622-102384644 CAGTGGGTACAGCCCAAGGAGGG - Intronic
978701572 4:111652935-111652957 AGGTGGGGACAACTCAAAGCAGG + Intergenic
978928899 4:114287164-114287186 CAGTGGGTACAGCCCAAGGAGGG + Intergenic
986581571 5:9271703-9271725 CAGTGGGTGCAACCCAAGGAGGG + Intronic
999492384 5:152063917-152063939 AGGTGGGATAAACCCAGGGCAGG + Intergenic
1004540386 6:16544249-16544271 CTGTGGGAACAATGCAAGGAAGG - Intronic
1004968659 6:20883405-20883427 GGGAGGGAACAACACAAGGTAGG - Intronic
1006025557 6:31144686-31144708 CGGAGGGAGCATGCCAAGGCCGG - Exonic
1009673536 6:66787914-66787936 CGGTGGCAACAGTCCAAGTCAGG - Intergenic
1017877555 6:158536941-158536963 CGGCGGGACCAGGCCAAGGCCGG - Intronic
1022292992 7:29022060-29022082 CAGTGGCAACAGCCCCAGGCAGG - Intronic
1025306756 7:57868273-57868295 CGGGGGGAAAAAGCCACGGCGGG + Intergenic
1026842927 7:73680776-73680798 CTTTGGGATCCACCCAAGGCGGG - Intergenic
1027232002 7:76278188-76278210 CAGAGGGGCCAACCCAAGGCCGG + Intronic
1028970999 7:96858803-96858825 CGGTGGGATCAGCTGAAGGCAGG - Intergenic
1032198551 7:129803808-129803830 CGGTGGAAAGAACCCTGGGCTGG + Intergenic
1034375827 7:150643072-150643094 AGGAGGGAATATCCCAAGGCTGG - Intergenic
1035831288 8:2697187-2697209 CAGTGGGAAGACCCCAAGGCTGG - Intergenic
1036289514 8:7475104-7475126 CGGAGGGAATCACCCCAGGCAGG + Intergenic
1036331960 8:7836427-7836449 CGGAGGGAATCACCCCAGGCAGG - Intergenic
1045967334 8:108040439-108040461 AGGGGGAAAAAACCCAAGGCAGG + Intronic
1051670557 9:19505384-19505406 CAGTGGGTACAGCCCAAGGAGGG - Intergenic
1052647047 9:31250089-31250111 AGGTTGGAACATACCAAGGCTGG - Intergenic
1053036826 9:34833238-34833260 CAGTGTGAACAACCCCAGCCTGG - Intergenic
1055162006 9:73141882-73141904 AGGTGGGGACAACTCAAAGCAGG - Intergenic
1055345129 9:75327461-75327483 CAGTGGGTACAGCCCAAGGAGGG - Intergenic
1058694142 9:107545083-107545105 AGGTGAGAACAAGCCATGGCAGG + Intergenic
1061953689 9:133950491-133950513 CGGTGGGTTTAAGCCAAGGCGGG + Intronic
1185609460 X:1385949-1385971 CGGGGGGTAGAAACCAAGGCTGG - Intergenic
1186020809 X:5253013-5253035 AGGTGGGGACAACTCAAAGCAGG - Intergenic
1187770606 X:22691751-22691773 CAGTGGGGACAACAGAAGGCTGG - Intergenic
1188012069 X:25067439-25067461 AGGTGGAAACAACCCAAGTATGG - Intergenic
1189928926 X:45987209-45987231 CCCTGGGATCAACCCAGGGCCGG - Intergenic
1190118910 X:47644675-47644697 CGGTGTGAAGGGCCCAAGGCTGG + Intronic
1190575766 X:51836530-51836552 CAGAGGCAACTACCCAAGGCAGG - Intronic
1190766602 X:53480644-53480666 CCGTGGGCACAACCCCAGGGTGG - Intergenic
1190937615 X:55010561-55010583 CAGAGGGAACATCCTAAGGCAGG - Intronic
1194631534 X:96291530-96291552 CAGTGGGTGCAACCCAAGGAGGG + Intergenic
1195004060 X:100669416-100669438 CGGGGGGAGAAACCCTAGGCAGG + Intronic
1195150251 X:102060571-102060593 AGGCGGGAACAACTCAAAGCAGG - Intergenic
1195947363 X:110229659-110229681 CAGTGGGAACAGCCCACGGAGGG + Intronic
1196383876 X:115126332-115126354 CGATAGGAACAACCCACTGCAGG + Intronic
1197004170 X:121475203-121475225 CAGTGGGTACAGCCCAAGGAGGG - Intergenic
1197728840 X:129793838-129793860 CGGTGGCAATAGGCCAAGGCTGG + Exonic
1198216418 X:134559226-134559248 CAGTGGGAACACCAGAAGGCAGG - Intergenic