ID: 1122954512

View in Genome Browser
Species Human (GRCh38)
Location 14:105064306-105064328
Sequence TGGATGGGTGTGGTGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1028
Summary {0: 1, 1: 0, 2: 5, 3: 126, 4: 896}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122954512_1122954523 28 Left 1122954512 14:105064306-105064328 CCCTGCTCCACCACACCCATCCA 0: 1
1: 0
2: 5
3: 126
4: 896
Right 1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122954512 Original CRISPR TGGATGGGTGTGGTGGAGCA GGG (reversed) Intronic
900372977 1:2340439-2340461 TGGAGGGGTGTCATGGAGCGAGG - Intronic
900409918 1:2507822-2507844 GGGGTGGGGGTGGTGGGGCAAGG + Intergenic
900593544 1:3470239-3470261 TGCATGGGTGTGTGGGGGCAGGG + Intronic
900792601 1:4690107-4690129 TGGAGGGGTAGTGTGGAGCATGG + Intronic
900823304 1:4906837-4906859 TGGCTGGGCGTGGCGGTGCATGG + Intergenic
901363656 1:8726949-8726971 GAGCTGGGTGTGGTGGTGCATGG - Intronic
901559083 1:10055555-10055577 TGGCTGGGTGTGGTGGAGGAAGG - Intronic
902397988 1:16142855-16142877 TGGATGGATGGGGCGGAGGATGG + Intronic
902412013 1:16217379-16217401 TGGACGGGTGGGGTGGTGCCTGG - Intergenic
902610963 1:17596907-17596929 TAGATGGGCGTGGTGGCACACGG + Intronic
902696917 1:18146340-18146362 GGGATGGGTGGGGTGCAGTATGG + Intronic
902994712 1:20215055-20215077 TGTCTGTGTGTGGTGGAGCTGGG + Intergenic
903002127 1:20273914-20273936 TGGATGGGTGTGTGGGTGGATGG + Intergenic
903002167 1:20274090-20274112 TGGATGGGTGTGTGGGTGGATGG + Intergenic
903212479 1:21826213-21826235 TAGCTGGGTGTGGTGGCACATGG - Intronic
903234664 1:21942048-21942070 AGAATGGGTGTGGTTGAGAATGG - Intergenic
903241913 1:21988443-21988465 TGGCTGGGCGTGGTGCTGCATGG + Intronic
903434616 1:23337509-23337531 TAGCTGGGTGTGGTGGTGCATGG + Intronic
903904503 1:26674352-26674374 TGGCTGGGTGTGGTGGCTCATGG - Intergenic
904238991 1:29131944-29131966 TAGCTGGGTGTGGTGGTACATGG - Intergenic
904811638 1:33166992-33167014 TGGATGGGAGTGATGGGGGAGGG - Intronic
905138672 1:35822532-35822554 TGGCTGGGTGTGGTGGCTCACGG - Intronic
905201970 1:36321913-36321935 TGGGTGGGGGTGGTGCAGCTAGG + Intronic
905431694 1:37929263-37929285 TAGATGGGTGTAGTGGCACATGG - Intronic
905486373 1:38299807-38299829 TGGTTGTGAGTGGTGGAGCTGGG + Intergenic
905577029 1:39053012-39053034 TAGCTGGGTGTGGTGGTGCACGG + Intergenic
905591439 1:39167293-39167315 GGGCTGGGTGTGGTGGCTCATGG + Intronic
905674337 1:39815210-39815232 TGGATGGATGAGGTGGACAATGG + Intergenic
905911781 1:41660035-41660057 TGGGTGTGTGTAGAGGAGCAGGG + Intronic
906125344 1:43423904-43423926 TGGAAGGGTGTGGCTTAGCAGGG + Intronic
906460041 1:46029963-46029985 CCGATGGGTGGGGTGGAGGATGG + Intronic
906607929 1:47184316-47184338 GGGATGGGTTTAGTGGAGCATGG - Intronic
906797747 1:48711205-48711227 TGGGGGGCTGTGGAGGAGCAGGG + Intronic
906821617 1:48936005-48936027 TGGCTGGGTGTGGTGGCTCATGG + Intronic
907324202 1:53626298-53626320 GGGAGGGGTGTGGTGGAGGGAGG - Intronic
907515954 1:54993626-54993648 GGGAAGGGTGGGGTGCAGCAGGG - Intergenic
908041554 1:60119177-60119199 TGGCTGGGTGTGTTGGCACATGG - Intergenic
908206149 1:61851871-61851893 TGGAGGGGTGAGGGGGAGAAGGG + Intronic
909149018 1:71977040-71977062 TGGCTGGGAGTGGTGGCTCATGG + Intronic
909176653 1:72370447-72370469 TGGTTGGGTGTTCTGGTGCATGG + Intergenic
909565256 1:77046456-77046478 GGCATGGGTCTGGTGGAGGAAGG + Intronic
910082758 1:83360985-83361007 TGCATGGGTATGGTTGACCAAGG - Intergenic
910196144 1:84641436-84641458 AGGCTGGGTGTGGTGGCTCACGG - Intergenic
910663093 1:89694731-89694753 TAGCTGGGTGTGGTGGTGCATGG - Intronic
910895220 1:92062303-92062325 TGGCTGGGTGCGGTGGCTCACGG + Intronic
911176817 1:94825606-94825628 TGGCTGGGTGTGGTGGCTCACGG - Intronic
911587385 1:99706252-99706274 TAGCTGGCTGTGGTGGTGCACGG + Intergenic
911730019 1:101283119-101283141 TGGATAGGTGGAGAGGAGCAGGG + Intergenic
911739148 1:101368472-101368494 CTGATGGGTGGGATGGAGCAGGG - Intergenic
912357636 1:109068278-109068300 TAGCTGGGTGTGGTAGCGCATGG - Intronic
912448788 1:109757382-109757404 TGGAGGGGGATGGGGGAGCAGGG - Intronic
912771766 1:112470775-112470797 TGTGTGGGTGTGGGGGAGGAAGG + Intronic
913059339 1:115190451-115190473 TGGATGGGTCTGCTGGGGAATGG + Intergenic
913324534 1:117615281-117615303 TGGATAGCTTTGGTGGGGCAGGG - Intronic
913461140 1:119087048-119087070 GTGGTGTGTGTGGTGGAGCATGG - Intronic
913495445 1:119424082-119424104 TGGAGGGGTGGGGTGGAAGAAGG + Intergenic
914263726 1:146020218-146020240 TGGATAGGTATGGGGGAGCCAGG - Exonic
914328083 1:146640465-146640487 TGGATGGGCGCGGTGGTGCATGG + Intergenic
914750975 1:150534694-150534716 TTGCTGGGTGTGGTGGCGCGTGG + Intergenic
915172115 1:153985569-153985591 TGGCTGGGTGTGCTGGAGGGTGG - Intronic
915452212 1:156013929-156013951 TGGATGGGAGAGGTGTACCATGG - Intronic
915596817 1:156900917-156900939 TGGAAGGGGTTGGGGGAGCATGG + Intronic
915608591 1:156971820-156971842 GGGATGGGTGAGGAGGAGAAGGG + Intronic
916141764 1:161706047-161706069 TAGATGGGCATGGTGGTGCATGG - Intergenic
917128466 1:171714489-171714511 TGGCTAGGTGTGGTGGCTCAGGG + Intronic
917661616 1:177182115-177182137 AGGATGGGAGGGGTGGGGCAGGG - Intronic
917661627 1:177182138-177182160 AGGATGGGAGGGGTGGGGCAGGG - Intronic
917839086 1:178963143-178963165 AGGGTGGGTGTGGTGGCTCATGG - Intergenic
918081256 1:181209394-181209416 TGGATGGCAGGGGTGCAGCATGG + Intergenic
918455189 1:184704372-184704394 TGGCTGGGTGCGGTGGCTCATGG + Intronic
918945085 1:191053320-191053342 TGGGTGGGTTTGGTGGGGAATGG + Intergenic
919043641 1:192424393-192424415 TGGAGGATTGTAGTGGAGCAAGG + Intergenic
919969291 1:202562975-202562997 TTTCTGGGTGTGGTGGAGGAAGG - Intronic
920247487 1:204599504-204599526 TGTGTGTGTGTGATGGAGCAGGG + Intergenic
920247826 1:204601580-204601602 TGGATCACTGTGGTGGGGCACGG + Intergenic
920288707 1:204901093-204901115 AGGCTGTGTGTGGTGGGGCAGGG + Intronic
920429404 1:205907164-205907186 TAGCTGGGCGTGGTGGTGCACGG - Intergenic
920434559 1:205939629-205939651 GGGATGGGAGTGGTGGAAAAGGG + Intronic
920667312 1:207972468-207972490 TGGAGGGATGCGGTGGAGCCAGG + Intergenic
921712506 1:218387151-218387173 GGCATGGGTGTGGTGGTGCTTGG + Intronic
921938582 1:220816921-220816943 TGGATGGATAGGGTGGATCAGGG + Exonic
922063773 1:222116558-222116580 TGGAAGGCTGTGGTGGAGAGAGG + Intergenic
922124400 1:222708646-222708668 TGGTTGGGTGTGGTGGCTCACGG - Intronic
922163268 1:223094095-223094117 GGGGTGTGTGTGGTGGAACAGGG + Intergenic
922202262 1:223415505-223415527 TAGCTGGGTGTGGTGGCTCATGG + Intergenic
922218268 1:223538512-223538534 TAGCTGGATGTGGTGGTGCATGG + Intronic
922275075 1:224070010-224070032 TGAATGGGTGGGGTGTGGCATGG - Intergenic
922457264 1:225785214-225785236 TAGTTGGGCGTGGTGGTGCACGG - Intronic
922747931 1:228057271-228057293 TGCATCAGTGTGGTGGAGTAAGG + Intronic
923403767 1:233640848-233640870 TAGTTGGGTGTGGTGGCACAAGG - Intronic
923777691 1:236994914-236994936 TAGCTGGGTGTGGTGGCTCATGG + Intergenic
924927934 1:248701757-248701779 TGGAGGGGTGCAGGGGAGCAAGG - Intergenic
1063275012 10:4556485-4556507 TGCATGGGTATTCTGGAGCAAGG + Intergenic
1063471998 10:6295504-6295526 TGGCTGGGTGCGGTGGTTCACGG - Intergenic
1063524074 10:6768005-6768027 TGTATGTGTGTGGTGGAAGAGGG + Intergenic
1064039009 10:11941686-11941708 GGGGTGGGTTTGGTGGAGAATGG - Intronic
1064342759 10:14501404-14501426 TGGCTGTGTGTGTGGGAGCAGGG - Intergenic
1064790307 10:18951307-18951329 GGACTGGGTGTCGTGGAGCAGGG + Intergenic
1064870076 10:19927554-19927576 TAGCTGGGCGTGGTGGCGCATGG + Intronic
1064883268 10:20081055-20081077 CGGATGGCTCTGCTGGAGCAAGG + Intronic
1065233144 10:23619810-23619832 TGGATGGGAGTTTTGGAGCAAGG + Intergenic
1065768855 10:29057874-29057896 AGATTGGGTGTGGTGGAGGAGGG - Intergenic
1065962337 10:30743845-30743867 TGGATGGGTGTGGCTGACAAAGG + Intergenic
1066417027 10:35231153-35231175 TAGCTGGGTGTGGTGGCGCGCGG - Intergenic
1066486044 10:35845919-35845941 TGGCTGGGTGTGGCCGAGCATGG - Intergenic
1068876265 10:61999924-61999946 TGGATGGGTGAAGTGGGGCTGGG + Intronic
1068886977 10:62108066-62108088 TGGCTGGGTATGGTGGCTCACGG - Intergenic
1068902167 10:62280710-62280732 GGACTGGGTGCGGTGGAGCAGGG - Intergenic
1069177093 10:65305016-65305038 AGGCTGGGTGTGGTGGCTCATGG - Intergenic
1069392533 10:67951481-67951503 TGAAAGGGTTTGGTGGAGCAAGG - Intronic
1069494143 10:68887737-68887759 TAGCTGGGTGTTGTGGTGCATGG - Intronic
1069512575 10:69053241-69053263 AGGAAGGGTGTGGTGGAGGATGG + Intergenic
1069541939 10:69301328-69301350 TGGCTGGGTGTGGTGGTGAGTGG + Intronic
1069752720 10:70754474-70754496 TGGGTCGATGTGGTGGAGGATGG + Intronic
1069789943 10:71013119-71013141 TGGGTGGGGGTGGGGGAGGAAGG - Intergenic
1069829624 10:71274735-71274757 GGGATGGGTGGGCTGGAGCATGG + Intronic
1069951395 10:72020889-72020911 TGGCTGGGTGTGGTGGCTCATGG - Intergenic
1070262860 10:74874522-74874544 TAGCTGGGTGTGGTGGCGCATGG - Intronic
1070285174 10:75077825-75077847 TAGCTGGGCGTGGTGGTGCACGG - Intergenic
1070626990 10:78058264-78058286 TGGCTGGATGTGGTGGCTCACGG - Intergenic
1071173959 10:82901543-82901565 TGGATGGGAGTGGAGGTGAAAGG - Intronic
1071567406 10:86678782-86678804 TGGCAGGGTGTGGTGGTGCATGG - Intronic
1071631434 10:87221816-87221838 TAGCTGGGTGTGGTGGTGCATGG - Intergenic
1071744709 10:88403895-88403917 TAGTTGTGTGTGGTGGTGCATGG + Intronic
1071892474 10:90026140-90026162 TAGCTGGGTGTGGTGGCTCATGG + Intergenic
1072931940 10:99672583-99672605 GGGCTGGGTGTGGTGGCTCATGG - Intronic
1072974111 10:100042811-100042833 GGGCTGGGTGTGGTGGCTCATGG + Intronic
1073200936 10:101734844-101734866 TAGCTGGGCGTGGTGGTGCATGG + Intergenic
1073426699 10:103459370-103459392 GGGATGGCAGTGGTGGTGCAGGG + Intergenic
1074140206 10:110665837-110665859 TGGCTGGGTGTTGTGGCTCATGG + Intronic
1074360155 10:112819438-112819460 TGGCTGGGTGTGTTGTTGCAGGG + Intergenic
1074400175 10:113135183-113135205 TGGATGGGTGTGTGGGCGCTTGG + Intronic
1074703940 10:116115248-116115270 GGGATGGGTGTGGGGGAGTGTGG + Intronic
1074786543 10:116847230-116847252 TGGTTGGATGTGGTGGAGTTGGG - Intergenic
1074896959 10:117785538-117785560 TAGCTAGGTGTGGTGGTGCATGG - Intergenic
1075105637 10:119538443-119538465 AGGGTGGGTCTGTTGGAGCAGGG + Intronic
1075120474 10:119660811-119660833 TGGCTGGGCGTGGTGGCTCACGG + Intronic
1075398038 10:122141813-122141835 GGGATGTGTGTGGTGGAGGGGGG + Intronic
1075857332 10:125640946-125640968 GAGATGGGTGTGGGGGAGGAAGG - Intronic
1075874236 10:125793345-125793367 TGGGTGGGTGGGGTGGAGGTGGG + Intronic
1076547966 10:131258458-131258480 TGGGTGGGTGTGGTGCTGCCAGG - Intronic
1076670801 10:132120263-132120285 TGGATGTTGGTGGTGGGGCAGGG - Intronic
1077044534 11:538559-538581 TGGGTGGGAGTGTTGGAGCGGGG - Intronic
1077312093 11:1893406-1893428 TGGATGGGTGGGTGGGAGGATGG + Intergenic
1077356210 11:2119986-2120008 TGGATGGGTGGGTTGGTGGATGG - Intergenic
1077636387 11:3844184-3844206 TAGCTGGGTGTGATGGTGCATGG + Intergenic
1077760487 11:5090593-5090615 TGGCTGGGCGTGGTGGCTCAAGG - Intergenic
1077898669 11:6473376-6473398 AGGGTGGGGGTGGGGGAGCAAGG + Intronic
1078064390 11:8068417-8068439 TGCAGGGGTGTGGTGGTGCTGGG - Intronic
1079110053 11:17600285-17600307 TGGGTGGGTGGGGTAGAGAAGGG + Intronic
1079405645 11:20143031-20143053 TTGAGGGGTGTGGGGGAGCAGGG + Intergenic
1079650758 11:22925920-22925942 TGGCTGGGGGTGGTGGAGAAAGG + Intergenic
1080009172 11:27440242-27440264 TGGAGGGGTGTGGAGAGGCACGG + Intronic
1080367564 11:31593385-31593407 TAGCTGGGTGTGGTGGCACATGG - Intronic
1081240457 11:40699060-40699082 TGTATGTGTGTGGTGGGACAGGG - Intronic
1081492711 11:43580141-43580163 TGGATGGATGGGATGGAGGAGGG + Intronic
1081634881 11:44714448-44714470 TGGCTAGGTGTGGTGAGGCAGGG + Intergenic
1081704537 11:45173474-45173496 TAGCTGGGCGTGGTGGCGCACGG + Intronic
1081776876 11:45681724-45681746 TGGGAGGGTGTGCAGGAGCAAGG + Intergenic
1082067395 11:47911727-47911749 TTGATGGGGATGATGGAGCATGG + Intergenic
1082873078 11:57961562-57961584 TGGTTGGGGGTGGTGCAGGAAGG - Intergenic
1082991848 11:59213365-59213387 TGCATAGGTATGGTGGAGCCAGG - Intergenic
1083000930 11:59289989-59290011 TGCATGGGTATGGTGGAGGCAGG - Intergenic
1083337591 11:61933734-61933756 TGGCTGGGTGTGGTGGCTCACGG + Intergenic
1083373010 11:62196594-62196616 TAGCTGGGCGTGGTGGTGCATGG - Intergenic
1083929578 11:65833492-65833514 GGGATGTGGGTGGTGGACCAGGG - Intronic
1083956279 11:65984730-65984752 TGGTTGGGTGTGGTGGCTCATGG - Intergenic
1084130942 11:67133837-67133859 TACCTGGGTGTGGTGGCGCAGGG - Intronic
1084725352 11:70938232-70938254 TGTGTGGGTGTGGTGGAGGGGGG + Intronic
1084796554 11:71509896-71509918 TGGGTAGGTGGGGAGGAGCAGGG + Intronic
1084908638 11:72369412-72369434 AGGATGGGGGTGGGGGAGGAGGG - Intronic
1085070165 11:73536539-73536561 TAGTTGGGCGTGGTGGTGCATGG + Intronic
1085660062 11:78355883-78355905 TGGCTGGGTGTGGTGGCTCGTGG + Intronic
1086387681 11:86326150-86326172 TAGCTGGGTGTGGTGGTGCATGG + Intronic
1086954583 11:92922981-92923003 ATGAGGGGTGTGGTGGAGCAGGG + Intergenic
1087098456 11:94342505-94342527 TAGTTGGGTGTGGTGGCACATGG - Intergenic
1087415688 11:97852583-97852605 AGGTTGGGTGTGGTGGCTCATGG - Intergenic
1087953081 11:104249353-104249375 AGGCTGGGTGGGGTGGAGTAGGG + Intergenic
1088504664 11:110516357-110516379 TAGCTGGGTGTGGTGGTGCACGG - Intergenic
1089281684 11:117379277-117379299 TGGATGGGTGAGGAAGGGCAGGG - Intronic
1089285189 11:117402497-117402519 AGGCTGGGTGTGGTGGCTCAGGG - Intronic
1089619008 11:119711920-119711942 TGGATGGGTGTGGTGGTGCTAGG + Intronic
1089933999 11:122344501-122344523 TGCATGGGTGTGGTGAAGACAGG + Intergenic
1090006341 11:123005977-123005999 TAGCCGGGTGTGGTGGCGCATGG + Intergenic
1090642991 11:128745377-128745399 TGGATGGGAGTGATGGAGGGAGG - Intronic
1090650131 11:128799188-128799210 AGGCTGGGTGTGGTGGCTCAGGG - Intronic
1090747755 11:129720914-129720936 TGGATCAGTGTGGGGCAGCATGG - Intergenic
1090958157 11:131532230-131532252 TGGAGGAGTGGGGTGGAGAATGG - Intronic
1091300018 11:134501890-134501912 TGGCTGAGTGTGGAGGAGCATGG + Intergenic
1091397240 12:161540-161562 TGGAGTGGTGGGGTGGAGCTGGG + Intronic
1091572720 12:1703453-1703475 TGGCTGGGTGTGGTGGCTCATGG + Intronic
1091591473 12:1845378-1845400 GGGATGGGTGGGGGGGAGGAGGG + Intronic
1091725952 12:2846461-2846483 GGGAGGGGTGTGCTGGAGCGGGG - Intronic
1091835219 12:3581033-3581055 TTGAGGGATGTGGTGGAGGAAGG + Intronic
1092290000 12:7154451-7154473 TGGATGGGTGTGAGAGAGAATGG + Intronic
1092361782 12:7842872-7842894 TAGCTGGGTGTGGTGGCACATGG - Intronic
1092591620 12:9957340-9957362 TAGCTGGGTGTGGTGGTGCACGG + Intronic
1092615411 12:10212096-10212118 TAGCTGGGCGTGGTGGCGCATGG - Intergenic
1092745399 12:11667978-11668000 TGGCTGGGCGTGGTGGCTCACGG - Intronic
1092816341 12:12315511-12315533 TAGCTGGGCGTGGTGGCGCATGG - Intergenic
1094198441 12:27774000-27774022 TAGCTGGGTGTGGTGGCACACGG + Intergenic
1095211812 12:39503064-39503086 TGTATGTGTGTGGTGGGGCTTGG - Intergenic
1095595142 12:43950416-43950438 GTGATGGGTGTGGTGGAGGCTGG + Intronic
1095733972 12:45536092-45536114 TGGATGGGTGGGTAGGTGCATGG - Intergenic
1096111487 12:49031682-49031704 TGGATGGGTGGGAGGGAGCTGGG + Exonic
1097248249 12:57618367-57618389 TGAATGGGGGTGGAGGATCATGG + Intronic
1097278694 12:57830892-57830914 TAGCTGGGCGTGGTGGCGCATGG - Intronic
1097366306 12:58717571-58717593 TGGATGGGTGCAGTGGAGTTGGG - Intronic
1097450189 12:59728577-59728599 TAGCTGAGCGTGGTGGAGCATGG + Intronic
1097551965 12:61084418-61084440 TGGCTTGGTGTGGTGGCTCAGGG + Intergenic
1097704813 12:62857124-62857146 TGTGTGCGTGTGGTGGAGAAAGG + Intronic
1097716259 12:62969913-62969935 TGGCTGGGTGTGGGGGCGCGGGG + Intergenic
1098308274 12:69123096-69123118 TGGATGGCTCTGCTGGACCAAGG - Intergenic
1098742099 12:74185420-74185442 TGGATGGGGGTGGTGTTGCAAGG - Intergenic
1098991329 12:77067116-77067138 TAGCTGGGCGTGGTGGCGCACGG - Intergenic
1099478709 12:83140397-83140419 GGACGGGGTGTGGTGGAGCAGGG - Intergenic
1099524503 12:83702988-83703010 TAGTTGGGTGTGGTGAAGTAAGG + Intergenic
1099831024 12:87842859-87842881 TGGTTGGTTGTGGGGGTGCAAGG + Intergenic
1100383764 12:94086376-94086398 TAGCTGGGTGTGGTGGCACATGG + Intergenic
1100396233 12:94188602-94188624 TGGCTGGGCGTGGTGGCTCACGG - Intronic
1101003492 12:100379287-100379309 TATCTGGGTGTGGTGGCGCATGG + Intronic
1101682679 12:106984900-106984922 AGGCTGGGTGTGGTGGCTCATGG - Intronic
1101971091 12:109312958-109312980 AGGCTGGGTGTGGTGGCTCAGGG + Intergenic
1102071806 12:110026429-110026451 TAGCTGGGTGTGGTGGCCCATGG + Intronic
1102092195 12:110200802-110200824 TAGCTGGGTGTGGTGGCACATGG + Intronic
1102213775 12:111145810-111145832 AAGCTGGGTGTGGTGGCGCATGG - Intronic
1102394173 12:112573973-112573995 GGGAGAGGTGTGGTGGGGCAGGG + Intronic
1102394422 12:112574760-112574782 GAGAAGGGTGTGGTGGAGGAGGG + Intronic
1102647595 12:114413959-114413981 TGGGTGGGTGGGATGGAGCCGGG + Intergenic
1102705603 12:114877777-114877799 TAGCTGGGTGTGGTGGCACATGG - Intergenic
1102882723 12:116498034-116498056 TAGCTGGGCGTGGTGGCGCATGG + Intergenic
1102895593 12:116595734-116595756 TGGATGGATGTGTGGGAGGATGG + Intergenic
1103272971 12:119688707-119688729 GGGATGGGTGTGGAAGACCAGGG - Intronic
1103548134 12:121716160-121716182 TTGCTGGGTGTGGTGGTGCATGG + Intronic
1104261577 12:127188076-127188098 TGGGTAGGTATGGTAGAGCAAGG - Intergenic
1104492995 12:129210439-129210461 TGGATGTGTGTGGTGCATCGTGG - Intronic
1104695655 12:130861890-130861912 TAGCTGGGTGAGGTGGTGCATGG - Intergenic
1104733396 12:131121524-131121546 TAGCTGGGCGTGGTGGCGCATGG - Intronic
1104762706 12:131306793-131306815 TGGATGGGTTTTGTGGAGGAGGG + Intergenic
1104762729 12:131306899-131306921 TGGATGGGTTTTGTGGAGGAGGG + Intergenic
1104762764 12:131307053-131307075 TGGATGGGTTTTGTGGAGGAGGG + Intergenic
1104762777 12:131307105-131307127 TGGATGGGTTTTGTGGAGGAGGG + Intergenic
1104817150 12:131654275-131654297 TGGATGGGTTTTGTGGAGGAGGG - Intergenic
1104817163 12:131654327-131654349 TGGATGGGTTTTGTGGAGGAGGG - Intergenic
1104817198 12:131654481-131654503 TGGATGGGTTTTGTGGAGGAGGG - Intergenic
1104888170 12:132124325-132124347 TGGATGGGTGTGTGGGTGGATGG - Intronic
1104894965 12:132159547-132159569 TGGCTGGGCGTGGAGGGGCATGG + Intergenic
1104925741 12:132313229-132313251 TGGATGGGTGAGTTGGTGGATGG - Intronic
1104941313 12:132396782-132396804 GGGATGGTTGCGGTGTAGCAGGG - Intergenic
1105819512 13:24067112-24067134 TGGTGGGGTGTGGGGCAGCATGG - Intronic
1107378266 13:39828222-39828244 TAGCTGGGTGTGCTGGCGCATGG + Intergenic
1107891945 13:44921654-44921676 TGGGAGGGTGGTGTGGAGCAAGG - Intergenic
1108083766 13:46763405-46763427 TAGCTGGGTGTGGTGGTGCACGG - Intergenic
1108751329 13:53451061-53451083 TGGAGTTGTGTGGTGGAACAGGG + Intergenic
1109666311 13:65543127-65543149 TAGCTGGGTGTGGTGGCACATGG + Intergenic
1109845654 13:67987103-67987125 TTGATGGGTGAGGTAGGGCAGGG + Intergenic
1109975531 13:69827582-69827604 TAGCTGGGTGTGGTGGTGCATGG + Intronic
1109989267 13:70032194-70032216 TGGAGTGGTGAAGTGGAGCAAGG + Intronic
1110016991 13:70418266-70418288 TAGCTGGGTGTGGTGGTGCATGG + Intergenic
1110226882 13:73129081-73129103 TGGTGGGGGGTGGTGGAGCGGGG - Intergenic
1111007513 13:82267537-82267559 GAGATGGGTGCGGTGGATCATGG + Intergenic
1111364017 13:87217206-87217228 AGGATGGGAGAGGTAGAGCATGG + Intergenic
1111662444 13:91228149-91228171 TGGTGGGGGGTGGTAGAGCAAGG - Intergenic
1112277472 13:98034671-98034693 AGTATGGGTGTGGTGGCTCACGG - Intergenic
1112848559 13:103674334-103674356 TAGCTGGGTGTGGTGGTGCACGG + Intergenic
1113186785 13:107696040-107696062 TAGCTGGGCGTGGTGGTGCATGG - Intronic
1113366024 13:109676610-109676632 TAGCTGGGTGTGGTGGCACATGG + Intergenic
1113745901 13:112744286-112744308 TGGGAGGGTGTGATGGAGTATGG + Intronic
1114209788 14:20604998-20605020 TGGATGGGGATGGTGGCCCACGG - Intronic
1114217986 14:20671747-20671769 TGGCTGGGTGTGGTGGCTCGCGG - Intergenic
1114788304 14:25626275-25626297 TGTATGTGTGTGTTGGAGAAGGG + Intergenic
1114994169 14:28326772-28326794 CGGATGTCTGTGGTGGAGGATGG - Intergenic
1117101524 14:52353449-52353471 TAGCCGGGTGTGGTGGCGCATGG + Intergenic
1117216253 14:53555337-53555359 TGGGTGGGTGTGGAGGAAGATGG + Intergenic
1117386239 14:55215756-55215778 TAGCAGGGTGTGGTGGCGCATGG + Intergenic
1118246347 14:64114761-64114783 TAGCCGGGTGTGGTGGTGCAGGG - Intronic
1118306364 14:64658462-64658484 GGACTGGGCGTGGTGGAGCAGGG - Intergenic
1118437403 14:65784269-65784291 TGGGTGGGGGGAGTGGAGCAAGG + Intergenic
1118629945 14:67693794-67693816 TAGCTGGGCGTGGTGGCGCATGG - Intronic
1119170364 14:72530405-72530427 TGGCTGGGTGTGGTGGCTCATGG + Intronic
1119843013 14:77807485-77807507 TAGCTGGGCGTGGTGGCGCACGG - Intronic
1119868782 14:77995284-77995306 AGGCTGGGTGTGGTGGCTCAGGG + Intergenic
1120836095 14:89039714-89039736 TGGCTGGGTGCGGTGGCTCATGG - Intergenic
1121050582 14:90816673-90816695 GGGATGGGGGTGGGGGAGCGGGG + Intergenic
1121197926 14:92091303-92091325 TAGCTGGGTGTGGTGGTGCGTGG + Intronic
1121366517 14:93317149-93317171 TAGTTGGGTGTGGTGGCACATGG - Intronic
1121447860 14:93989507-93989529 AGGAAGGGTGTGGAGGAGAAAGG - Intergenic
1122289039 14:100669654-100669676 TGTGTGTGTGTGTTGGAGCAAGG - Intergenic
1122397209 14:101441969-101441991 AGGAGGGGTGTGGTGGAGGGCGG - Intergenic
1122504123 14:102220914-102220936 TAGCCGGGTGTGGTGGCGCACGG - Intronic
1122524508 14:102371212-102371234 GGGTTGGGTGAGGTGGAACATGG + Intronic
1122916183 14:104860052-104860074 TGGATGGTGGTGATGGAGGATGG - Intergenic
1122916224 14:104860232-104860254 TGGATGGTGGAGATGGAGCATGG - Intergenic
1122954512 14:105064306-105064328 TGGATGGGTGTGGTGGAGCAGGG - Intronic
1124159985 15:27259583-27259605 TGGAAGGGTGTGGAGGAGCTGGG - Intronic
1124382749 15:29180516-29180538 TAGCTGGGTGTGGTGGCACACGG + Intronic
1124583717 15:30986034-30986056 GGGCTGGGTGTGGTGGCTCACGG + Intronic
1125293598 15:38177177-38177199 TGGGAGGGAGTGGTGGAGAAGGG - Intergenic
1125535078 15:40437866-40437888 TGGTTGTGTGTGGTGGGGGAAGG + Intergenic
1126643251 15:50849798-50849820 TAGCTGGGTGTGGTGGTGCATGG + Intergenic
1127859764 15:62983658-62983680 TGGTTGGGAGTGGTGGAGAGGGG - Intergenic
1128833967 15:70794429-70794451 TGAAGGGGTGTGGGAGAGCAGGG - Intergenic
1128861749 15:71080096-71080118 AGGATGGGTGAGGTGGCTCATGG + Intergenic
1128963753 15:72036863-72036885 TAGCTGGGTGTGGTGGTGCATGG - Intronic
1128981232 15:72188056-72188078 TGGCTGGGCGTGGTGGCTCATGG + Intronic
1129131022 15:73496071-73496093 TGGCTGGGTGCGGTGGCTCACGG + Intronic
1129150075 15:73683151-73683173 TGGGTAGGGGTGGTGGTGCATGG - Intergenic
1129338016 15:74865468-74865490 AGGGTGGGTGTGGTGGGGTAGGG + Intronic
1129660472 15:77550282-77550304 TGGGAGGGTGGGGTGGGGCACGG + Intergenic
1129968740 15:79758903-79758925 TGGATGTGAGTGGTGGAGCCTGG - Intergenic
1130585820 15:85181118-85181140 TAGCTGGGCGTGGTGGATCATGG - Intergenic
1130832534 15:87616309-87616331 TGGATGGGTGGATTGGAGGAAGG - Intergenic
1130907849 15:88252677-88252699 TGGTTGGGTGTGGCTGCGCATGG + Intronic
1131074402 15:89486233-89486255 TGGGTGGGGGCGGTGAAGCAAGG + Intronic
1131109669 15:89757388-89757410 TAGCTGGGTGTGGTGATGCACGG - Intergenic
1131135820 15:89934243-89934265 GGGATGTGTGTGGCAGAGCAAGG - Intergenic
1131229154 15:90647434-90647456 AGGAGGGGTGTGGAGGAGGAGGG - Intergenic
1131229169 15:90647477-90647499 AGGAGGGGTGTGGAGGAGGAGGG - Intergenic
1131229241 15:90647676-90647698 AGGAGGGGTGTGGAGGAGGAGGG - Intergenic
1131613750 15:93991644-93991666 GGGAGGAGTGTGGGGGAGCAGGG - Intergenic
1131981756 15:98001049-98001071 TGTGTGTGTGTGGTGGAGGATGG + Intergenic
1132151048 15:99459315-99459337 TGGCTGGGTGTGGTGGCGGGGGG + Intergenic
1132678732 16:1131101-1131123 TTGCTGGGTATGGTGGACCAGGG - Intergenic
1133077202 16:3289117-3289139 GGAATGGGTGGGATGGAGCAGGG - Intronic
1133181276 16:4056532-4056554 TGGCTGGGTGTGGTGGCTCACGG - Intronic
1133414248 16:5593968-5593990 AGGATGGGGGTGGTGTATCACGG - Intergenic
1133456125 16:5943959-5943981 TGGATGGGTGGGGGGGTGGATGG - Intergenic
1133523813 16:6584511-6584533 TAGCTGGGTGTGGTGGGGAAGGG - Intronic
1133683101 16:8139173-8139195 TGGCTGGATGTGGTGGCTCACGG - Intergenic
1134061156 16:11200469-11200491 TGGAAGGGTGGGGTGGGGAAGGG + Intergenic
1134249728 16:12565907-12565929 CAGATGGCTGTGGTGGATCACGG - Intronic
1134638815 16:15812725-15812747 TAGCCGGGTGTGGTGGTGCATGG + Intronic
1134728730 16:16442401-16442423 TAGCTGGGTGTGGTGGTACATGG - Intergenic
1134938713 16:18269523-18269545 TAGCTGGGTGTGGTGGTACATGG + Intergenic
1135041630 16:19121931-19121953 TGGGTATGTGTGGGGGAGCAGGG - Intronic
1135087832 16:19488986-19489008 AGCAAGGGTGTTGTGGAGCAAGG - Intronic
1135111856 16:19696489-19696511 TGTTTGGGTGTGGTGGAGCTGGG + Intronic
1135417151 16:22277280-22277302 TAGTTGGGTATGGTGGTGCATGG - Intronic
1135780412 16:25295021-25295043 TGGCTGGGTGTGTTGGCTCATGG + Intergenic
1135934171 16:26765276-26765298 GGGCTGGGTGTGGTGGTTCATGG + Intergenic
1135954175 16:26941928-26941950 TGGATGGGCATGGTGGCTCACGG + Intergenic
1136077640 16:27827957-27827979 TGGATAGGTGTGTTGGTGGATGG - Intronic
1136168768 16:28474819-28474841 TGGCTGGGTGTGGTGGCTCATGG + Intergenic
1137238924 16:46638468-46638490 GTGATGGGGGTGGTGGAGGAGGG - Intergenic
1137266038 16:46869840-46869862 TAGCTGGGTGTGGTGGTACATGG + Intergenic
1137354705 16:47749699-47749721 TGGAAGGGGGTGGAGGTGCAGGG + Intergenic
1137573049 16:49579207-49579229 TGGGTGGGGGTGGGGGGGCAGGG - Intronic
1137597794 16:49736383-49736405 TGGGTGGGTGTGGTGTAGTGGGG - Intronic
1137664669 16:50242861-50242883 CGGCTGGGTGTGGTGGCTCATGG + Intergenic
1137736436 16:50727222-50727244 TGGCTGGTAATGGTGGAGCAGGG - Intronic
1137924434 16:52526543-52526565 GGGATGGGGGTGGTGGGGGAGGG + Intronic
1138444812 16:57056937-57056959 TGGCTGGGTGCGGTGGCTCAAGG - Intronic
1138576725 16:57912115-57912137 TGTGTGTGTGTGGAGGAGCAGGG + Intronic
1138682867 16:58698922-58698944 TAGTTGGGTGTGGTGGCACACGG - Intergenic
1138836501 16:60442427-60442449 TGGATGAGTGTGGGGGTGAATGG + Intergenic
1139236543 16:65345487-65345509 TGGATGGCGGTGGTGGAGAGAGG - Intergenic
1139565944 16:67776314-67776336 TAGCCGGGTGTGGTGGAACATGG + Intronic
1139616991 16:68102224-68102246 TAGCTGGGTGTGGTGGTGCGTGG + Intronic
1139709389 16:68764113-68764135 TGGTTGGGTTTGGTGGGGGATGG + Intronic
1139809989 16:69606572-69606594 TGGCTGGGTATGGTGGCTCACGG + Intronic
1140005477 16:71070472-71070494 TGGATGGGCGTGGTGGTGCATGG - Intronic
1140511122 16:75509191-75509213 TAGCTAGGTGTGGTGGTGCATGG + Intergenic
1141113899 16:81292075-81292097 TAGCTGGGTGTGGTGGCGCATGG - Intergenic
1141458601 16:84162320-84162342 TGGCTGGATGTGGTGGCTCACGG + Intronic
1141599089 16:85114411-85114433 TGGAGGAGTGTGTTGGAGGAGGG - Intergenic
1141999394 16:87655497-87655519 TAGCTGGGCGTGGTGGTGCACGG - Intronic
1142049293 16:87947532-87947554 TAGCCGGGTGTGGTGGCGCATGG - Intergenic
1142128843 16:88423141-88423163 TGGATGGGTGGGTTGGTGGATGG + Intergenic
1203137943 16_KI270728v1_random:1741350-1741372 TGGCCGGGCGTGGTGGTGCATGG - Intergenic
1142553676 17:757199-757221 TGGCTGGGTGTGGTGGCACGTGG + Intronic
1142721155 17:1776771-1776793 TGGGTGGATGGGGTGGGGCAGGG + Intronic
1143008142 17:3850560-3850582 GGGCTGGGTGTGGTGGTTCACGG - Intergenic
1143110875 17:4552155-4552177 TGGAAGGAGGTGGTGGAACAAGG - Exonic
1143432616 17:6898300-6898322 TGGATGGGTGAAGGGGAGGATGG + Intronic
1143686169 17:8517808-8517830 AGGATGGGTGAGAGGGAGCAAGG - Intronic
1143708130 17:8714694-8714716 AAGATGGGTGTGGTGGGGTAAGG + Intergenic
1143901793 17:10180058-10180080 TGGCTGGGCGTGGTGGCTCATGG + Intronic
1144222022 17:13108181-13108203 TGGCCGGGTGTGGTGGCTCACGG + Intergenic
1145251921 17:21301456-21301478 CGGGTGGGTGTGGGTGAGCAGGG + Intronic
1145387032 17:22421799-22421821 TGGTTGCTTGGGGTGGAGCATGG - Intergenic
1145763590 17:27442725-27442747 TGGATGGGTGAGGTGGCAGAAGG + Intergenic
1145879010 17:28340480-28340502 TACATGGGTGGGGCGGAGCAGGG + Intronic
1145995661 17:29103448-29103470 TGGCTGGGCGGGGTGGAGCTGGG + Intronic
1146021741 17:29285152-29285174 TAGCTGGGCGTGGTGGCGCATGG + Intronic
1146047259 17:29519228-29519250 TGGCTGGGTGTGATGGTTCATGG + Intronic
1146062495 17:29614521-29614543 TGGGTGGGTGAGGTGGGGCAGGG - Exonic
1146564869 17:33904015-33904037 TAGCTGGGTGTGGTGGTGCATGG + Intronic
1146644442 17:34567778-34567800 TGGATGGGGGAGGTGGTGCAGGG - Intergenic
1146767508 17:35536659-35536681 TAGCTGGGTGTGGTGGTGCATGG + Intronic
1146877010 17:36422031-36422053 TAGCTGGGTGTGGTGGCACATGG - Intronic
1146999503 17:37350985-37351007 TAGAGGGGCGTGGTGGAGCGTGG + Intronic
1147062374 17:37890824-37890846 TAGCTGGGTGTGGTGGCACATGG + Intergenic
1147118743 17:38322421-38322443 TGGGTGGGTGGGTGGGAGCAAGG + Intronic
1147594597 17:41708755-41708777 TAGCTGGGTGTGGTGGTGCGTGG - Intergenic
1147666576 17:42152631-42152653 TAGCTGGGCGTGGTGGTGCATGG + Intronic
1148006298 17:44433104-44433126 CGGCTGGGTGCGGTGGATCACGG - Intronic
1148079205 17:44958366-44958388 AGGATGGCAGTGGTGGAGTAAGG + Intergenic
1148105253 17:45115312-45115334 GGGATGGGTGGGGTGGGGAAGGG - Intronic
1148118330 17:45191563-45191585 TAGCTGGGTGTGGGGGTGCATGG + Intergenic
1148428198 17:47619218-47619240 TGTATGGGTGTAGTGAATCATGG - Intronic
1148469573 17:47884881-47884903 CAGCTGGGTTTGGTGGAGCAAGG - Intergenic
1148751394 17:49947590-49947612 GGGATGGGGGTAGTGGAGCAAGG - Intergenic
1148774973 17:50090170-50090192 TGGCTGGATGGGGTGGGGCAGGG - Intronic
1148879445 17:50714489-50714511 TGGCTGGGCGTGGTGGCTCATGG + Intergenic
1148934660 17:51155266-51155288 GGGCTGGGTGTGGTGGCTCATGG + Intronic
1148936653 17:51168523-51168545 TAGCTGGGTGTGGTGGTGCACGG + Intronic
1149279181 17:55083254-55083276 TGGCCGGGTGTGGTGGCTCATGG - Intronic
1149630561 17:58118666-58118688 TAGCTGGGCGTGGTGGTGCACGG - Intergenic
1149754024 17:59172854-59172876 GCGATGGGTGCTGTGGAGCAGGG - Intronic
1149967048 17:61175259-61175281 TAGCTGGGTGTGGTGGTGCATGG + Intronic
1150170799 17:62991882-62991904 TGGATGGGTGGAGTGGTGGAGGG + Intergenic
1150332474 17:64305438-64305460 TGGCTGGGTGTGGTGGCTCATGG + Intergenic
1150346498 17:64408451-64408473 TGGTTGGGTGCGGTGGCTCACGG - Intronic
1150449550 17:65255188-65255210 TAGCTGGGTGTGGTGGCACATGG + Intergenic
1150456250 17:65309048-65309070 TGGAGGGTTGAGGCGGAGCAGGG - Intergenic
1151381295 17:73727470-73727492 TGGGTGTGTGTGGAGGAGAAAGG + Intergenic
1151398372 17:73839938-73839960 TGGAGAGCTGTGGTTGAGCATGG - Intergenic
1151541210 17:74765403-74765425 TTGCTGGGCGTGGTGGCGCATGG - Intronic
1152082654 17:78197966-78197988 TAGCTGGGTGTGGTGGTGCTTGG + Intronic
1152082971 17:78199903-78199925 AGGATGGGAGAGGTGGAGCATGG + Intronic
1152863527 17:82709387-82709409 TGGGTGGGGCAGGTGGAGCAGGG - Intergenic
1152874627 17:82779701-82779723 TAGATGGATGTGCTGGAACAAGG + Intronic
1153563332 18:6394185-6394207 TGGCTGAGTGTGGTGGCTCACGG + Intronic
1153882560 18:9434059-9434081 TGCAGGGGTGGGGTGGAGCCGGG - Intergenic
1154043122 18:10878051-10878073 GGAATGGGTGTGGAGGGGCAAGG - Intronic
1154113393 18:11589975-11589997 TGGCTGGGTGCGGTGGCTCATGG - Intergenic
1154307868 18:13243738-13243760 TGGATGGATGTGCGGGTGCATGG - Intronic
1154481830 18:14836411-14836433 TGGATGGGTGACATGGAGAAGGG - Intronic
1155018931 18:21876753-21876775 TGGCTGGGTGTGGTGGCTCAGGG + Intergenic
1155154983 18:23150494-23150516 TGGCTGGGCGTGGTGGCTCACGG - Intronic
1155961065 18:31995321-31995343 TAGCTGGGCGTGGTGGTGCATGG + Intergenic
1156273353 18:35557689-35557711 TGGCCGGCTGTGGTGGAACATGG - Intergenic
1156336003 18:36172050-36172072 TGGCTGGGTGTGTTGGCTCATGG + Intronic
1156684661 18:39630244-39630266 TGTAGGGGTGTGTTGGATCAAGG - Intergenic
1157673456 18:49550099-49550121 TGGATGGGTGTGATAGAGGAGGG + Intergenic
1157844413 18:50989576-50989598 TAGCTAGGTGTGGTGGTGCATGG + Intronic
1158277675 18:55786189-55786211 AGGCTGGGTGTGGTGGTACATGG + Intergenic
1159198381 18:65148873-65148895 AGCATTGGTGTGGTGGAGAAAGG + Intergenic
1160233530 18:77067467-77067489 TGGATGGTGGTTGTGGAGCCTGG - Intronic
1160860197 19:1234435-1234457 GGGCGGGGTGGGGTGGAGCAGGG - Intronic
1161000379 19:1907775-1907797 TGGGTGGGTGTGGTAGAGGGAGG + Intronic
1161107304 19:2450775-2450797 TAGCTGGGCGTGGTGGTGCACGG - Intronic
1161241388 19:3225463-3225485 TGAATGGGGGTGGGGGGGCAGGG - Intronic
1161324769 19:3658306-3658328 TGGCTGGGAGTGATGGTGCAGGG + Intronic
1161351865 19:3797654-3797676 TGGCTGTGTGTGGTGGCTCACGG + Intronic
1161418940 19:4164852-4164874 TAGCTGGGCGTGGTGGCGCATGG - Intronic
1161489369 19:4553489-4553511 TGGATGGGTGTGTGGGTGGATGG + Intronic
1161489426 19:4553741-4553763 TGGGTGGGTGTGTTGGTGGATGG + Intronic
1161801326 19:6418115-6418137 TGGGGGGGTGTGGGGCAGCAGGG - Intronic
1162412795 19:10516858-10516880 TGGATGTTTGTGTGGGAGCATGG - Intronic
1162539569 19:11286421-11286443 TAGCTGGGTGGGGTGGTGCATGG + Intergenic
1162664747 19:12200998-12201020 TAGCTGGGTGTGGTGGCACACGG - Intergenic
1162872227 19:13595218-13595240 TGGATGGGTGAGTTGGTGGATGG + Intronic
1163026860 19:14517839-14517861 TGCATGGGGGTGGGGGAGCCGGG - Intronic
1163152685 19:15424467-15424489 TGGATGGGTGGGATGGGGGATGG + Intronic
1163203068 19:15782213-15782235 TGAATGGGGGTGGAGCAGCACGG - Intergenic
1163350545 19:16774077-16774099 TGGATGGGTGGGTGGGAGGACGG - Intronic
1163545046 19:17936377-17936399 AGGATGGGGATGGGGGAGCAGGG - Intronic
1163754960 19:19101140-19101162 GGGAGGGCTGTGGGGGAGCAGGG + Intronic
1163756527 19:19109808-19109830 TGTGTGGGTGTGGAGGAGGAAGG - Intronic
1163765661 19:19161951-19161973 TAGCTGGGTGTGGTAGCGCATGG - Intronic
1163774012 19:19207389-19207411 TGGCTGGGTGTGGTTGTGCATGG + Intergenic
1163774016 19:19207409-19207431 TGGCTGGGTGTGGTTGTGTACGG + Intergenic
1163774027 19:19207489-19207511 TGGCTGGGTGTGGTTGTGCATGG + Intergenic
1163774031 19:19207509-19207531 TGGCTGGGTGTGGTTGTACATGG + Intergenic
1163774060 19:19207709-19207731 TGGCTGGGTGTGGTTGTGTATGG + Intergenic
1163774066 19:19207749-19207771 TGGCTGGGTGTGGTTGTGTATGG + Intergenic
1163774073 19:19207789-19207811 TGGCTGGGTGTGGTTGTGCATGG + Intergenic
1163774076 19:19207809-19207831 TGGCTGGGTGTAGTTGTGCATGG + Intergenic
1163774084 19:19207848-19207870 TGGCTGGGTGTGGTTGTGCATGG + Intergenic
1163774088 19:19207868-19207890 TGGCTGGGTGTGGTTGTGTATGG + Intergenic
1164728518 19:30483482-30483504 TGGATGGGTGGGGTGGGGTGGGG - Intronic
1164980134 19:32607601-32607623 GTGTTGGGGGTGGTGGAGCAGGG - Intronic
1165231306 19:34388815-34388837 GGGCTGGGTGTGGTGGCTCATGG + Intronic
1165370257 19:35401002-35401024 TGAATGGGTGTGGAGACGCATGG + Intergenic
1165689497 19:37852397-37852419 AGGCTGGGTGTGGTGGCTCATGG - Intergenic
1165690602 19:37860106-37860128 TAGATGGGTGTGGCTGGGCATGG + Intergenic
1165754952 19:38287605-38287627 TGGCCGGGTGTGGTGGCTCATGG - Intronic
1165872557 19:38983289-38983311 TAGCTGGGTGTGGTGGTACATGG - Intergenic
1165987982 19:39787306-39787328 TGGGGGAGTGTGGTGGAGGAAGG - Intergenic
1166017698 19:39995504-39995526 TAGCTGGGTGTGGTGGTGCGTGG - Intronic
1166137137 19:40784345-40784367 TAGCTGGGTGTGGTGGCTCATGG + Intronic
1166382436 19:42362052-42362074 TGGATGGGTGTGAGTGAGCCAGG + Intronic
1166407174 19:42529324-42529346 TGGAAGGGTGTTTTGGAGCAAGG + Intronic
1166600774 19:44092861-44092883 TAGCTGGGTGTGGTGGCGCATGG + Intergenic
1166791385 19:45400737-45400759 TAGCTGGGTGTGGTGGTGCGAGG - Intronic
1167118805 19:47504108-47504130 GGGCTGGGTGTGGTGGTTCATGG + Intronic
1167201899 19:48071575-48071597 TGGCCGGGTGTGGTGGCTCATGG - Intronic
1167508897 19:49885534-49885556 AGGCTGGGTGTGGTGGTTCATGG + Intronic
1167554697 19:50187193-50187215 TATCTGGGTGTGGTGGTGCAAGG + Intergenic
1167606942 19:50486333-50486355 TGGCTGGGTGTGGTGGCACACGG - Exonic
1167954768 19:53055892-53055914 TAGCCGGGTGTGGTGGTGCATGG - Intergenic
1168061094 19:53892634-53892656 TGGATGGCTGGTGAGGAGCAGGG + Exonic
925351918 2:3207129-3207151 TGGATGGGTGTGTGGGTACATGG - Intronic
925414144 2:3657562-3657584 AGGGTGGCTGTGGTGAAGCAAGG + Intergenic
925634088 2:5925684-5925706 ATGATGGGTGTGGTGGGGGAAGG + Intergenic
926780670 2:16468525-16468547 TGGATGTGTGTGCTGGTGAAGGG - Intergenic
926904407 2:17792542-17792564 TGGATGGATGGGGTGGTGGATGG - Intronic
927054893 2:19358668-19358690 GGGGTGGGGGTGGTGGAGGAGGG - Intergenic
927140276 2:20125443-20125465 AGGCTGGGTGTGGTGGCTCATGG + Intergenic
927385570 2:22529568-22529590 AGGCTGGGTGTGGTGGCTCATGG - Intergenic
927617084 2:24609472-24609494 AGGCTGGGTGTGGTGGAGCAGGG + Intronic
927663822 2:25015492-25015514 GGGAGGGGAGTGGTGGAGCGGGG + Intergenic
927679459 2:25130334-25130356 TGGATGTGTGTGGTGAAGCTGGG - Intronic
928024198 2:27726748-27726770 TAGCTGTGTGTGGTGGCGCATGG + Intergenic
928448912 2:31360350-31360372 TAGCTGGGCGTGGTGGGGCAGGG + Intronic
929106858 2:38374035-38374057 TAGCTGGGTGTGGTGGCGCATGG - Intronic
929206147 2:39296002-39296024 TGGCTGGGTGTGATGGCTCACGG - Intronic
929496154 2:42446005-42446027 TGGCTGGGTGTGGTGGCTCATGG - Intronic
929530198 2:42745957-42745979 TAGCTGGGCGTGGTGGCGCATGG - Intronic
929814759 2:45221777-45221799 GGGATGGGGGTGGTGAAGCCAGG + Intergenic
930243782 2:48962820-48962842 TGGATGGGTGTTGTGGACAGTGG + Exonic
930474512 2:51864145-51864167 TAGCTGGGTGTGGTGGCACATGG + Intergenic
930549597 2:52815482-52815504 TGCAGAGGTGTGGTGAAGCAGGG - Intergenic
930929432 2:56862471-56862493 AGAATGGCTGTGGTGGAGCATGG - Intergenic
931230041 2:60366390-60366412 AGGATGGGGGTGGGGGAGAAAGG - Intergenic
931348088 2:61465192-61465214 AGGGTGGGTGTGGTGGGGCAAGG + Intronic
931688510 2:64815458-64815480 GGGATGGGTGTTGGGGAACACGG - Intergenic
932113684 2:69025123-69025145 AAGATGGGTGTGGTGGTGAAGGG - Intronic
933282214 2:80344628-80344650 TAGCTGGGCGTGGTGGCGCAGGG - Intronic
933289935 2:80426737-80426759 TTGTTGGGGGTGGTGGAGGAAGG - Intronic
933690132 2:85173290-85173312 TGCAGGGGTGTGGAGGAGCAGGG + Intronic
934138337 2:89019478-89019500 TGGAGGGGGGAGGTGGAGGAGGG + Intergenic
935145616 2:100393146-100393168 AGGAGGGGTGTGGTGGAGGAAGG + Exonic
935166004 2:100569233-100569255 TAGCTGGGTGTGGTGGTGAACGG + Intronic
935281520 2:101521942-101521964 TGGAGGGCTGTGGTGGTCCAGGG + Intergenic
935336785 2:102023765-102023787 TGGCTGGGCGTGGTGGCTCATGG + Intronic
936099555 2:109563190-109563212 TGGCCGGGTGTGGTGGTTCATGG - Intronic
936503090 2:113081986-113082008 TGGGTGGGAGTAGTGGAGAAAGG + Intergenic
936820892 2:116519421-116519443 GGGATGGGTGTGGTGGTGGGCGG + Intergenic
936919947 2:117677536-117677558 TGGATGGGAGTGGTGGCACTTGG + Intergenic
937296818 2:120814499-120814521 GTGTTGGGTGGGGTGGAGCAGGG + Intronic
937646252 2:124269058-124269080 TAGATGGGTGGTGGGGAGCAGGG - Intronic
937894789 2:126970710-126970732 TGGCAGGGAGTGGAGGAGCAGGG - Intergenic
937914435 2:127092090-127092112 TGTAGGGGTGTGGTGGAGGGTGG - Intronic
938008980 2:127813182-127813204 GGGCTGGGCGTGGTGGCGCATGG - Intergenic
938017834 2:127882737-127882759 TGGCCGAGTGTGGTGGTGCATGG - Intronic
938022067 2:127914088-127914110 TGGCTGGGTGTGGTGGCTCACGG + Intergenic
938058751 2:128236125-128236147 TAGCTGGGCGTGGTGGTGCACGG - Intergenic
939472636 2:142643761-142643783 TAGCTGGGTGTGGTGGTGGATGG + Intergenic
939520153 2:143220285-143220307 TGGATGGGGGTGGAGGAGGCTGG - Intronic
941075668 2:161003682-161003704 TGGATGGGAGTGGTACAGGATGG - Intergenic
942494219 2:176522110-176522132 TTGATGAGAGAGGTGGAGCATGG - Intergenic
942821994 2:180125301-180125323 TAGCTGGGCGTGGTGGTGCACGG + Intergenic
943607043 2:189987996-189988018 TGGATGGGGGTGGTGGCGGGGGG + Intronic
943884119 2:193190360-193190382 AGGCTGGGTGTGGTGGTTCATGG - Intergenic
943986710 2:194631043-194631065 TGGATGTGTGTGGTGGGGGGAGG + Intergenic
944259812 2:197664637-197664659 TAGCTGGGTGTGGTGGTACATGG + Intronic
944588724 2:201197255-201197277 TGGCTGGGCGTGGTGGTACATGG - Intronic
944717410 2:202389245-202389267 AGGCTGGGTGTGGTGGCTCAGGG + Intronic
944802908 2:203253829-203253851 TGGATGGGGGTGGTGGTGTTTGG + Intronic
945223261 2:207505833-207505855 GAGGTGGGTGTGGTGGAGCAGGG - Intergenic
946334539 2:219028412-219028434 TGTCTGTGTGTGGTGGGGCATGG + Intronic
946352253 2:219162767-219162789 TTGTTGGGGGTGGTGGTGCAGGG + Intronic
946415384 2:219537489-219537511 GGGATGGGTGAGGAGGAGGAGGG + Intronic
946452635 2:219794193-219794215 TGGGAGGGGGTGGTGGGGCAGGG + Intergenic
947254428 2:228146168-228146190 AGGATGTGTGTGGAGGAGCAGGG - Intronic
947787696 2:232838614-232838636 TGATTAGGTGTGGTGGAGCCAGG + Intronic
947829337 2:233127752-233127774 TAGCTGGTTGTGGTGGCGCATGG - Intronic
948108811 2:235437726-235437748 TGGAAGGGTATGGGGGAGAAGGG - Intergenic
948421585 2:237863665-237863687 TGGGTGGCTTTGTTGGAGCAGGG + Intronic
948463718 2:238142408-238142430 TGGATGGCTGTGGGAGAGCCTGG + Intronic
948467680 2:238160006-238160028 TGGCTGGGTGTGATGGGGCCGGG - Intronic
948516130 2:238504989-238505011 TGGGTGGGGGTGGAGGTGCAAGG - Intergenic
949007206 2:241656434-241656456 TGGAAGGGTGTGGTGGGGGCTGG - Intronic
1168949360 20:1786126-1786148 TGTATGTGTGTGTTGGAGGAGGG + Intergenic
1169134210 20:3186980-3187002 TGGCTGGGCGTGGTGGCTCATGG + Intergenic
1169375601 20:5064428-5064450 TAGCTGGGTGTGGTGGGGCGTGG + Intergenic
1169812780 20:9625445-9625467 TCCATGGGCGTGGTGTAGCAAGG - Intronic
1169814671 20:9644141-9644163 TGGATGGGTGTGATGCATGAAGG + Exonic
1170150237 20:13220875-13220897 TGGGTGGGTGGGGTGGTGCCTGG - Intergenic
1170155997 20:13269914-13269936 TGGATGGGTGTGTGGGTGGAAGG + Intronic
1170444746 20:16414717-16414739 TAGATGTGTGTGTCGGAGCAGGG + Intronic
1170974379 20:21148827-21148849 TGGATAGGTGTGGAGGACCAGGG + Intronic
1171055563 20:21903263-21903285 AGGGTGGGTTTGTTGGAGCATGG - Intergenic
1171321606 20:24249030-24249052 GGGATGGGTGGGGTGGAGCATGG + Intergenic
1171353239 20:24521752-24521774 TAGCTGGGTGTGGTGGTGCATGG + Intronic
1171810149 20:29740934-29740956 TGGAGGGGTGTTGGGGAGGAGGG + Intergenic
1171852251 20:30316951-30316973 TGGCTGGGTGTGGGGGTGCGGGG - Intergenic
1171990376 20:31691570-31691592 AGGCTGGGTGTGGTGGCGCCCGG + Intronic
1172042751 20:32057452-32057474 TAGCTGGGTGTGGTGGCACATGG + Intronic
1172252951 20:33492654-33492676 TAGCTGGGTGTGGTGGCGCCTGG - Intronic
1172275548 20:33677070-33677092 TAGGTGGGTGGGGTGGGGCAGGG - Intronic
1172303381 20:33865080-33865102 TGGAGGGGAGTGGGGGAGCCTGG - Intergenic
1172425263 20:34851548-34851570 TGGATGGGTGGGGTGGATGGGGG + Intronic
1172792712 20:37517242-37517264 GGGATGGGGGAGGGGGAGCAGGG - Intronic
1173285842 20:41670879-41670901 TGGGAGTGTGTGGTGGAGAAGGG - Intergenic
1173974815 20:47179267-47179289 TGGATGGGTGTGTGGGTGGATGG + Intronic
1174015611 20:47485753-47485775 TGGCTGGGTGTGGTAGCTCACGG + Intergenic
1174022185 20:47539610-47539632 TGAATGGGTGTGAGGGAGGAAGG + Intronic
1174232799 20:49060334-49060356 TAGCTGGGCGTGGTGGTGCACGG + Intronic
1174571657 20:51506482-51506504 TGGGTGGGTGGGGAGGAACACGG - Intronic
1175136900 20:56830976-56830998 TAGCTGGGCGTGGTGGAGCACGG + Intergenic
1175249863 20:57602795-57602817 TGGAGGGATTTGGTGGGGCATGG - Intergenic
1175407514 20:58744521-58744543 TGGATGGGTGGGTTGAAGGATGG + Intergenic
1175464265 20:59179323-59179345 CGGATGGGTGCGGAGGAGGAAGG - Intergenic
1175516359 20:59572736-59572758 TAGTTGGGTTTGGTGGCGCAAGG - Intergenic
1175691181 20:61067105-61067127 TGGGTGGGTGGGGAGGAGCAGGG + Intergenic
1175907371 20:62387450-62387472 GGGAGGGGTGTGGGGGAACAAGG - Intronic
1175932321 20:62498647-62498669 TGGGTGGGTGTTGGGGTGCATGG + Intergenic
1175953993 20:62598902-62598924 TGGCTGGGTGTGGTGTGGCGTGG + Intergenic
1176129945 20:63492503-63492525 TGGATGGGTGGGGAGGTGGATGG + Intronic
1176414643 21:6467637-6467659 GGGCTGGGTGGGGTGGAGGAGGG - Intergenic
1176798772 21:13400205-13400227 TGGATGGGTGACATGGAGAAGGG + Intergenic
1177084583 21:16687497-16687519 TAGCTGGGTGTGATGGCGCAGGG + Intergenic
1177144936 21:17397408-17397430 TGGATAGGTGTGGTGAAGATGGG + Intergenic
1177429750 21:20976411-20976433 TAGCCGGGTGTGGTGGCGCATGG + Intergenic
1177941155 21:27413013-27413035 TAGCTGGGAGTGGTGGCGCATGG - Intergenic
1178501070 21:33125842-33125864 GGGGTGGGTGTGGGGCAGCAGGG - Intergenic
1178848371 21:36192523-36192545 TAGCTGGGTGTGGTGGCACATGG - Intronic
1179400808 21:41081292-41081314 TGGTTGGGAGAGATGGAGCATGG - Intergenic
1179690143 21:43075959-43075981 GGGCTGGGTGGGGTGGAGGAGGG - Intronic
1180191070 21:46162729-46162751 TGGCTGGGTGTGGTGGCACGCGG - Intronic
1180208661 21:46279845-46279867 TGGTTGGGGGTGGAGGGGCAGGG - Intronic
1180651447 22:17380633-17380655 GTGATGGGTGGGGAGGAGCAAGG - Intronic
1180909850 22:19442069-19442091 TGGCTGGATGTGGTGGCTCACGG - Exonic
1181002602 22:19994816-19994838 TGGATGGGTGGGTAGGAGGATGG + Intronic
1181102268 22:20549458-20549480 TGGATGGGGGTGGGGGTGGATGG + Intronic
1181162261 22:20965789-20965811 TGGGAGGGTCAGGTGGAGCAGGG + Intronic
1181177041 22:21043826-21043848 GGGAGGGGTGTGGTGGGGCCAGG - Intergenic
1182100684 22:27655529-27655551 TGCATGGGTGGGATGGAGGATGG + Intergenic
1182120855 22:27785766-27785788 TGGATGGCCGTGGTGGGGCTGGG - Intronic
1182369051 22:29798204-29798226 AGAATGGGTGAGGTGCAGCATGG - Intronic
1182501088 22:30748155-30748177 AGGCTGGGTGTGGTGGCTCATGG - Intronic
1182536366 22:31006719-31006741 TGGCCGGGTGTGGTGGCTCATGG - Intergenic
1182623303 22:31629575-31629597 TGTATGGGTGTGTAGGTGCAAGG + Intronic
1182671834 22:32002597-32002619 TGGGTGGGTGCGGTGGCTCATGG - Intergenic
1183343670 22:37295358-37295380 TGCATGTGTGTGGTGGGGGAGGG - Intronic
1183352172 22:37340429-37340451 AGGATGGTTGCGGTGGAGAAGGG - Intergenic
1183367037 22:37412450-37412472 TGGATGGAGGTGCTGGAGGAGGG - Intronic
1183379753 22:37485001-37485023 TTGATGGGGGAGGTGGAGAATGG - Intronic
1183398608 22:37587891-37587913 TGGATGGGTGAGGAGGTGGAGGG + Intergenic
1183561177 22:38574693-38574715 TAGCTGGGTGTCGTGGAGCGTGG + Intergenic
1183612386 22:38918101-38918123 GGGCTGGGTGTGGTGGCTCATGG + Intergenic
1183764737 22:39862267-39862289 TGGCTGGGTGCGGTGGCTCATGG + Intronic
1184027919 22:41871744-41871766 TAGCTGGGTATGGTGGTGCATGG + Intronic
1184077103 22:42188146-42188168 TAGCTGGGTGTGGTGGTGCATGG + Intronic
1184460637 22:44635888-44635910 AGGTTGGGTGTGGTGGCTCATGG + Intergenic
1184766431 22:46574950-46574972 TGGAGGGGTGTGGGGCAGGAGGG + Intergenic
1184852313 22:47127990-47128012 GGGATGGGTGGGGTGGAGGGAGG - Intronic
1184852327 22:47128018-47128040 AGGATGGGTGGGGTGGAGGGAGG - Intronic
1184852366 22:47128112-47128134 GGGATGGGTGGGGTGGAGGGAGG - Intronic
1184852379 22:47128139-47128161 GGGATGGGTGGGGTGGAGGGAGG - Intronic
1184852392 22:47128166-47128188 GGGATGGGTGGGGTGGAGGGAGG - Intronic
1184855027 22:47142186-47142208 TGGATGGGTGTGTGGGTGGATGG - Intronic
1185411163 22:50683770-50683792 TGGAGGGGGGTGGTGGAGAGGGG + Intergenic
1185411190 22:50683825-50683847 TGGAGGGGGGTGGTGGAGAGGGG + Intergenic
950016746 3:9759869-9759891 AGGTTGGGTGGGGTGGGGCATGG - Intronic
950363477 3:12466425-12466447 TGGCTGGGCGTGGTGGCTCATGG + Intergenic
950425478 3:12922831-12922853 TGGAAGGGTGTGCCGGGGCAGGG - Intronic
950872485 3:16241826-16241848 TGGCCGGGTGTGGTGGCTCACGG - Intergenic
952039249 3:29241511-29241533 TGGGGGGGTGTGGTGGGCCAGGG + Intergenic
952335040 3:32396636-32396658 TGGATGAGTGTGAGGGGGCAAGG + Intronic
953400347 3:42608843-42608865 AGGCTGGGTGTGGTGGCTCATGG + Intronic
953563025 3:44009829-44009851 TGGCTGGGCGTGGTGGCTCATGG - Intergenic
953828586 3:46276195-46276217 TAGCTGGGTGTGGGGGTGCATGG + Intergenic
953991694 3:47488923-47488945 TACCTGGGTGTGGTGGTGCATGG - Intergenic
954075864 3:48179645-48179667 TGGCTGGGTGTGGTGGCTCATGG - Intronic
954079267 3:48203464-48203486 TAACTGGGTGTGGTGGTGCAAGG + Intergenic
954079337 3:48204042-48204064 TTGCTGGGTGTGGTGGCTCATGG + Intergenic
954156741 3:48689296-48689318 TGGCTGGGCGTGGTGGTGCACGG - Intronic
954312898 3:49784139-49784161 TAGCTGGGCGTGGTGGTGCATGG - Intronic
954575646 3:51674592-51674614 TGGATGGGCCTGGTGGGCCAGGG + Intronic
954596456 3:51829632-51829654 AATATGGGTGTGGGGGAGCATGG - Intronic
954647233 3:52139110-52139132 AGGATGGATGTGGTGGCTCACGG - Intronic
954676495 3:52318499-52318521 TGGATGGGCAAGGTGGAGAAAGG - Intronic
955294501 3:57722671-57722693 TAGATGGGTGTGATGGCACATGG - Intergenic
955295641 3:57732630-57732652 TGGCTGGGTGTGGTGGCACATGG + Intergenic
955352529 3:58204419-58204441 TGGCTGGGTGCGGTGGCGCATGG - Intronic
955434622 3:58889438-58889460 TGCATGGGGGTTGTGGAGCTAGG - Intronic
955571570 3:60312421-60312443 TGGCTGGGTGAGGTGGCTCATGG - Intronic
955638221 3:61053510-61053532 TAGCCGGGTGTGGTGGCGCATGG + Intronic
956358927 3:68425263-68425285 TGAATTGCTGTGGTGGATCAGGG + Intronic
957560116 3:81812036-81812058 GGGCTGGGTGCCGTGGAGCAGGG + Intergenic
957586238 3:82136113-82136135 GGGTTGGGTGTGGTGGCTCATGG + Intergenic
957587320 3:82148758-82148780 TGGCTGGGCGTGGTGGCTCATGG - Intergenic
959459268 3:106604567-106604589 TGGAAGGGTGGGGTGCTGCATGG + Intergenic
959988315 3:112601534-112601556 TGGCTGGGCATGGTGGAGCATGG + Intergenic
960685538 3:120290002-120290024 GGACTGGGTGTCGTGGAGCAGGG - Intergenic
960897620 3:122521775-122521797 TAGCTGGGTGTGGTAGCGCATGG + Intergenic
961265697 3:125640516-125640538 TAGCTGGGTGTGGTGGTGCCTGG + Intergenic
961490736 3:127255331-127255353 TAGCTGGGTGTGGTGGCACATGG + Intergenic
961533157 3:127552332-127552354 TGGCTGGGGGTGGTGGAGTAGGG - Intergenic
961555007 3:127691332-127691354 TGGATAGGTGGGAGGGAGCAAGG - Exonic
961649784 3:128411538-128411560 CTGATGGGTGGGGTGGGGCATGG + Intergenic
961929551 3:130518178-130518200 TGGATGGGTGTGGGGGTGATAGG + Intergenic
962671945 3:137717183-137717205 TAGCTGGGTGTGGTGGTGCATGG - Intergenic
963213219 3:142717107-142717129 TAGCTGGGCGTGGTGGTGCACGG + Intergenic
963509104 3:146225459-146225481 GGACTGGGTGCGGTGGAGCAGGG + Intronic
963784591 3:149521155-149521177 TGGATAGGTGTGGTCCAGAATGG + Intronic
964517829 3:157531903-157531925 TGGGTGGGTGGTGTGGGGCAGGG - Intronic
965031870 3:163380719-163380741 TGGCCGGGTGTGGTGGCTCACGG + Intergenic
965220847 3:165924364-165924386 GGACTGGGTGCGGTGGAGCAGGG + Intergenic
965243494 3:166233048-166233070 TGGGTGGGGGTGGTTGAGCAAGG + Intergenic
965581592 3:170273849-170273871 GGGCTGGGTGTGGTGGCTCACGG + Intronic
965581759 3:170276077-170276099 TAGCTGGGTGTGGTGGCACAGGG - Intronic
965771028 3:172181252-172181274 TGGCTGGGTGTGGTGGCGTGTGG + Intronic
966076736 3:175945060-175945082 TGAATGGGTGTGGTGAAAAATGG - Intergenic
966754190 3:183353372-183353394 TGGATGTGTCTGGTGGAACTGGG - Intronic
967090501 3:186130776-186130798 TGGGTGTGTTTGGAGGAGCATGG + Intronic
967162615 3:186752314-186752336 GGGCTGGGTGTGGTGGCTCATGG + Intergenic
967205664 3:187118540-187118562 AAGATGGGTGTGGTGGCTCATGG + Intergenic
967315452 3:188148530-188148552 TGTATGTGTGTGGTGGAGGAGGG + Intergenic
967407932 3:189138139-189138161 TGGGTGGGTGTGTTAGAGCTGGG + Intronic
967780706 3:193436730-193436752 AGGCTGGGTGTGGTGGCTCATGG - Intronic
968081992 3:195852982-195853004 AGGAAGTGTGTGGTGAAGCAGGG + Intergenic
968085936 3:195873896-195873918 TGGCTGTGTGTGGTGGGGCCAGG - Intronic
968116264 3:196092454-196092476 TAGCTGGGCGTGGTGGCGCATGG - Intergenic
968324095 3:197797181-197797203 TAGCTGGGCGTGGTGGTGCATGG + Intronic
968771327 4:2509361-2509383 TAGCTGGGTGTGGTGGCGCGTGG - Intronic
968796183 4:2706440-2706462 TAGCCGGGTGTGGTGGTGCATGG - Intronic
968862122 4:3180822-3180844 TGGGGGGGTGTGGTGGAGTTGGG + Intronic
968869673 4:3235241-3235263 TGGATGGGGGTGGCTGAGCCTGG + Intronic
968928079 4:3560512-3560534 TGGATGGGTGTGTGGGTGGATGG - Intergenic
969508010 4:7600100-7600122 AGGCTGGGTGTGGTGGCTCATGG - Intronic
969565412 4:7974455-7974477 TGGATGGGTGTGTGGGTGGATGG - Intronic
970337049 4:15058939-15058961 AGGATGGAGGTGGTGGAGGATGG - Intronic
970666629 4:18343756-18343778 TAGCTGGGTGTGGTGGTGCACGG - Intergenic
971176111 4:24284151-24284173 TAGCTGGGCGTGGTGGGGCAGGG + Intergenic
971203321 4:24534064-24534086 AGGATGGGTGAGGTGGAGATAGG + Intronic
971317581 4:25580416-25580438 TAGCTGGGCGTGGTGGTGCAAGG - Intergenic
971690560 4:29829028-29829050 TAGCTGGGTGTGGTGGCACATGG + Intergenic
971780456 4:31027566-31027588 TAGTTGGGCGTGGTGGTGCATGG - Intronic
972490492 4:39582516-39582538 TAGCTGGGTGTGGTGGTGCACGG + Intronic
972506804 4:39727505-39727527 GGTGTGGGTGTGGTGGTGCATGG - Intronic
973202066 4:47515239-47515261 GGGCTGGGTGTGGTGGCTCACGG - Intronic
973727710 4:53792431-53792453 TAGCTGGGTGTGGTGGTGCCTGG - Intronic
973845757 4:54911508-54911530 TGTGTGGGTATGGTGGAGAAGGG - Intergenic
974438625 4:61888599-61888621 AGGATGGGTATGGGGGATCAGGG + Intronic
977238495 4:94538467-94538489 TGGAGTAGTGTGGTGGAGGAGGG + Intronic
977690466 4:99902383-99902405 GGGATGGGTGGGGTGGGGGAAGG + Intronic
978121066 4:105079875-105079897 TGGAAGGGTGTGGTTGGGAAAGG + Intergenic
979193505 4:117892393-117892415 GGGATGGTGGTGGTGGAGGAGGG - Intergenic
979306244 4:119147593-119147615 TGGCTGGGTGTGGTGGTGGCAGG + Intronic
979472638 4:121118758-121118780 TTGATTGGTGAGGTGGAGAAAGG - Intergenic
980688726 4:136263270-136263292 TGTGTGTGTGTGGTGGAGCGAGG - Intergenic
982026499 4:151257634-151257656 TGGCTGGGTGCGGTGGCTCAAGG + Intronic
982059117 4:151585323-151585345 TAGCTGGGTGTGGTGGCACAAGG - Intronic
982256910 4:153459652-153459674 AGGCTGGGTGTGGTGGCTCATGG + Intergenic
982714611 4:158793704-158793726 TGCATGGGGGTTGTGGAGCTAGG + Intronic
983715714 4:170778823-170778845 TGGCTGGGTGCGGTGGCTCATGG + Intergenic
984925272 4:184800996-184801018 TAGTTGGGTGTGGTGGCTCATGG - Intronic
985291458 4:188392221-188392243 TGGCCGGGCGTGGTGGTGCACGG - Intergenic
985655617 5:1130153-1130175 TTGATGGGGGTGGTGGAAAAGGG - Intergenic
985726690 5:1519955-1519977 TGGAGGGGTGGGGTGGGCCAAGG - Intronic
986462277 5:7983914-7983936 TGGATGGGTCGGGTGGGGCCAGG + Intergenic
986484720 5:8224123-8224145 TGAATAGGAGTGGTGGAGGAGGG - Intergenic
986755660 5:10833692-10833714 TGCAAACGTGTGGTGGAGCATGG + Intergenic
987310630 5:16678277-16678299 GGGCTGGGTGTGGTGGCTCAAGG + Intronic
989056129 5:37367927-37367949 TAGCTGGGTGTGGTGGCTCATGG - Intronic
989922505 5:49825190-49825212 TTGAGGGCTGTGGTGGAGAAGGG + Intergenic
990102068 5:52202825-52202847 TAGCTGGGTGTGGTGGAGGAAGG + Intergenic
990374849 5:55159160-55159182 TAGCTGGTTGTGGTGGTGCATGG - Intronic
990864108 5:60361572-60361594 TGGATGGTTTTGGTGGGGCCAGG + Intronic
991058612 5:62346592-62346614 TAGCTGGGTGTGGTGATGCATGG + Intronic
991582839 5:68174639-68174661 TAGCTGCGTGTGGTGGTGCAAGG - Intergenic
991990491 5:72334001-72334023 TAGCTGGGTGTGGTGGCACAAGG - Intronic
992175662 5:74146562-74146584 GGGGTGAGTGTGGGGGAGCAGGG + Intergenic
993420896 5:87700120-87700142 TGGCTGGGTGCGGTGGCTCATGG - Intergenic
993803493 5:92374920-92374942 GGAATGGGCGTTGTGGAGCAGGG + Intergenic
994057054 5:95428926-95428948 TAGATGGCTGTGTTGGAACACGG - Intronic
994059845 5:95462536-95462558 TAGCTGGGTGTGGTGGTGAATGG + Intergenic
994141009 5:96341330-96341352 TGGAGGGGTGGGGTGGAGGGTGG - Intergenic
994565365 5:101439314-101439336 TGGTTGGGGGTGTTGGATCATGG + Intergenic
995371395 5:111422970-111422992 TGTATGGGGGTGGTGGTGGATGG - Intronic
995404981 5:111784919-111784941 AGGCTGGGTGTGCTTGAGCAGGG + Intronic
996058163 5:119002856-119002878 TGGCTGGGTGTGGTGGCTCATGG - Intergenic
996187202 5:120491687-120491709 TAGATGGGTGTGGTGGCGGGTGG - Intronic
997232036 5:132252481-132252503 TGGATGTGTGCGCTGGGGCAGGG + Intronic
997466196 5:134089667-134089689 TGGCCGGGTGTGGTGGCTCATGG + Intergenic
997557665 5:134814963-134814985 AGGCTGGGTGTGGTGGCTCATGG + Intronic
997824121 5:137091221-137091243 TGGAAGGGTGGGATGGAGCAGGG - Intronic
998020929 5:138769677-138769699 TAGCTGGGCGTGGTGGCGCAGGG - Intronic
998023719 5:138794720-138794742 TGGGTGGGAGTGGTGGGACATGG + Intronic
998327766 5:141297026-141297048 TAGCTGGGTGTGGTGGTGCGTGG + Intergenic
998858539 5:146419962-146419984 TGGCTGGGTGTAGTGGCTCATGG + Intergenic
998990350 5:147808491-147808513 TGGCTGGGTGTGGTGGATGGGGG + Intergenic
999221162 5:149978996-149979018 AGGCTGGGTGTGGTGGCTCATGG - Intronic
999231730 5:150065714-150065736 TGAATGGGTGTAGGGGAGGAGGG + Intronic
999252030 5:150188463-150188485 TGGGAGGGAGTGGTTGAGCAAGG + Intergenic
999368514 5:151038588-151038610 CTGATGGGAGTGGAGGAGCACGG - Intronic
999386579 5:151157861-151157883 TAGAGGGGTGGGGTGGAGGAGGG - Exonic
999883200 5:155890341-155890363 TGGCTGGGTGTGATGGCTCATGG + Intronic
1000941857 5:167371505-167371527 TAGCCGGGTGTGGTGGCGCATGG - Intronic
1001000062 5:167997017-167997039 GGGCTGGGTGTGGTGGCTCATGG - Intronic
1001138607 5:169123964-169123986 AGCATGGTTGTGGTGGAGAAGGG - Intronic
1001293866 5:170485361-170485383 TGGAGAGGTGTGGTGAAGGAAGG - Intronic
1001295945 5:170499009-170499031 TGGATGGGGGCGGTGGAGGTGGG + Intronic
1001534684 5:172490173-172490195 TGGCCGGGTGTGGTGGCTCATGG + Intergenic
1001900147 5:175420468-175420490 TGGATGGGTGTGTGGGTGGATGG - Intergenic
1002437560 5:179241072-179241094 TGCATGGGTGAGGTAGACCAAGG + Intronic
1002659776 5:180783790-180783812 TCGATTGGTGGGGTGGGGCAAGG + Intergenic
1003065549 6:2901719-2901741 GGGATGGGTGTGGGGGAGGAGGG - Intronic
1003086636 6:3065526-3065548 GAGATGGGTGTGGGGGAGGAGGG + Intronic
1003205223 6:4003122-4003144 TTGCTGGGTGTGGTGGCACAAGG + Intergenic
1003666811 6:8119005-8119027 TGGCTGGATGTGGTGGCTCACGG + Intergenic
1003785031 6:9475872-9475894 TGGATGAGTGTGGTGGACTTGGG - Intergenic
1003833612 6:10042813-10042835 TAGAGGTGTGTGGTGGTGCAGGG + Intronic
1003956866 6:11172333-11172355 GGGATGGGGGTGGAGGAGCTTGG + Intergenic
1004272188 6:14205445-14205467 TGGCTGGGCGTGGTGGCTCATGG - Intergenic
1004518927 6:16344181-16344203 TGGATGAGAATGTTGGAGCAGGG - Intronic
1004655147 6:17652740-17652762 TGGCTGGGTGCGGTGGCTCATGG + Intronic
1004829607 6:19463025-19463047 TAGCTGGGTGTGGTGGTACATGG + Intergenic
1005039232 6:21587144-21587166 GGGATGGGAGGGGTGGGGCAGGG - Intergenic
1005457895 6:26038964-26038986 TAGCCGGGTGTGGTGGCGCATGG + Intergenic
1005793500 6:29332061-29332083 TAGCTGGGTGTGGTGGTGCGCGG - Intergenic
1005914977 6:30344004-30344026 TAGCCGGGTGTGGTGGTGCATGG - Intronic
1006190232 6:32203049-32203071 TAGCTGGGCGTGGTGGTGCATGG - Intronic
1006407900 6:33855860-33855882 GGGAGGGGAGTGGTGGAGAAGGG + Intergenic
1006638577 6:35476966-35476988 TAGCTGGGCGTGGTGGCGCATGG - Intronic
1006678403 6:35779710-35779732 AGGGAGGGTGTGGTGGAGCAGGG + Intergenic
1006727511 6:36210539-36210561 TGGATGGGTGGGGAGGAGAGGGG + Intronic
1006784045 6:36652959-36652981 TGGCTGGATGTGATGGATCAAGG - Intergenic
1007312413 6:40957021-40957043 TGGATGAATGTGGTGGGGCAGGG - Intergenic
1007388161 6:41533320-41533342 TAGCTGGGTGTGGTGGTGCATGG + Intergenic
1007525530 6:42489290-42489312 TGGCTGGGTGTGGTGGCTCATGG + Intergenic
1007742560 6:44021762-44021784 AGGAGGGGTGTGGTGGTGCTGGG - Intergenic
1007743131 6:44024981-44025003 AGGAGGGGTGTGGTGGTGCTGGG - Intergenic
1008781748 6:55114903-55114925 TGAGTGGGTGTGGAGAAGCAAGG + Intronic
1008913604 6:56762994-56763016 TAGCTGGGTGTGGTGGCACATGG - Intronic
1009658442 6:66576873-66576895 TAGATGGGTGTGATGGTGGAAGG + Intergenic
1009967430 6:70592291-70592313 TGGAAGAGTTTGGAGGAGCAGGG + Intergenic
1010002651 6:70963210-70963232 TAGCTGGGTGTGTTGGGGCATGG + Intergenic
1011625743 6:89282191-89282213 TCTGTGGGTGTGGTGGAGGAGGG - Intronic
1012155180 6:95810709-95810731 TGAATGGGGGTGGTGAAGGAGGG - Intergenic
1012263281 6:97112031-97112053 TGGGGGGGTGGGGTGGATCATGG + Intronic
1012930382 6:105310323-105310345 TGGATGGGTGTGATTGAAGATGG - Intronic
1013178761 6:107700432-107700454 TGGATGGGGGTGATGCAGCTGGG + Intergenic
1014206567 6:118662382-118662404 TAGCTGGGTGTGGAGGCGCATGG + Intronic
1014773366 6:125481916-125481938 TGGCTGTGTGTGCTGGAGGAAGG - Intergenic
1014989206 6:128053223-128053245 TGGCAGGGTGTGGGGGTGCAGGG - Intronic
1015865945 6:137726712-137726734 TGTATGTGTGTGGTGGGGCTTGG - Intergenic
1016747496 6:147596793-147596815 TAGATGGGTGTTGTGGAAGAAGG + Intronic
1017142687 6:151206017-151206039 TGGGAGGGTGGGGTAGAGCAAGG + Intergenic
1017237320 6:152130142-152130164 TGGCTGGGTGTGCTGGATGAAGG + Intronic
1017660217 6:156666817-156666839 CGGCTGGGTGTGGTGGCTCACGG + Intergenic
1017870639 6:158483683-158483705 TGCATGGGGGTGGTGGTGCATGG - Intronic
1018252392 6:161883796-161883818 TGGCTGGGCGTGGTGGCGCGCGG - Intronic
1018331619 6:162733869-162733891 GAGATGGGAGTGCTGGAGCAGGG - Intronic
1019282667 7:208146-208168 TGGGTGTGTGTGGTCGTGCAGGG + Intronic
1019320463 7:413062-413084 TAGCTGGGCGTGGTGGCGCATGG + Intergenic
1019771467 7:2886294-2886316 TGGTTGTGAGTGGTGGAGCTGGG + Intergenic
1020140831 7:5610690-5610712 TGGAGGGGTGGGGCGGGGCAGGG + Intergenic
1020164602 7:5798008-5798030 TGGCTGGGCGTGGTGGCTCATGG + Intergenic
1021181477 7:17510957-17510979 AGGATGGCTGTGATGGATCAAGG + Intergenic
1021269263 7:18565140-18565162 TAGCTGGGTGTGGTGGCGCATGG - Intronic
1021503237 7:21352650-21352672 TGGATGGCTGGGGAGGAGAAAGG + Intergenic
1021939664 7:25667346-25667368 TGGATGGGGGTGGTGGGCCATGG + Intergenic
1022385490 7:29895084-29895106 TAGCTGGGTGTGGTGGTGCATGG - Intronic
1022518634 7:30991585-30991607 TAGCTGGGTGTGGTTGTGCACGG - Intronic
1022660181 7:32359838-32359860 TGGATGGGTGCTGGGGAGGAAGG - Intergenic
1024953830 7:54894705-54894727 TAACTGGGTGTGGTGGTGCATGG + Intergenic
1025079426 7:55968899-55968921 TAGCAGGGTGTGGTGGTGCAGGG + Intronic
1025218805 7:57086360-57086382 TGGGTGTGTGTGGGGGGGCAGGG - Intergenic
1026221065 7:68398144-68398166 TAGCTGGGTGTGGTGGTACATGG - Intergenic
1026828618 7:73598461-73598483 TGGATGGGTGGGCTGGTGGATGG - Intronic
1027057567 7:75060574-75060596 TAGCTGGGTGTGGTGGCACACGG - Intronic
1027162497 7:75812952-75812974 TGGCTGGGTGTGGTGGTTCATGG + Intronic
1027963966 7:84981626-84981648 TGGAGGGGTGTGTTCGAGGATGG + Intergenic
1027985102 7:85277581-85277603 TAGCTGGGTGTGGTGGCACACGG - Intergenic
1027987232 7:85308714-85308736 TGGGTGGGGGTGGTGGAGATCGG + Intergenic
1028211165 7:88076516-88076538 TGGAGGTGTGGGGTGGGGCAGGG - Intronic
1028313854 7:89374957-89374979 TGGCTGGGTGTGGTGGCTCAGGG - Intergenic
1028317182 7:89418048-89418070 GGGCTGGGTGTGGTGGCTCATGG - Intergenic
1028458946 7:91070075-91070097 AGGCTGGGTGTGGTGGCTCATGG - Intronic
1028749154 7:94362821-94362843 GGGATGGGGGTGGTGCAGGATGG + Intergenic
1029055973 7:97743056-97743078 TGCATTGGTGGGGTGGGGCAGGG + Intergenic
1029131738 7:98336468-98336490 TAGCTGGGTGTGGTGGCGGATGG + Intronic
1029347145 7:99987008-99987030 TACATGGGTGGGGTGGAGAATGG + Intergenic
1029572301 7:101378232-101378254 TAGCTGGGTGTGGTGGTGCATGG + Intronic
1029594331 7:101528827-101528849 AGGATGGGTGTGGTGGCTCATGG - Intronic
1029796210 7:102896979-102897001 GGGAGGGCTGTAGTGGAGCAAGG + Intronic
1029868498 7:103662474-103662496 TAGCTTGGTGTGGTGGTGCATGG + Intronic
1029911918 7:104161672-104161694 TGGCTGGGTATGGTGGCTCATGG - Intronic
1030005345 7:105112826-105112848 TGGATGGATGGGGTGGTGGATGG - Exonic
1030641741 7:112013857-112013879 GGGATTGGTGTGGTGGAGTTAGG - Intronic
1031067667 7:117123320-117123342 GGGATGGGGGTGGTGGAGTGAGG + Intronic
1031616913 7:123892355-123892377 TAGCTGGGTGTGGTGGCACATGG + Intergenic
1032205336 7:129859856-129859878 GGGATGGGGGTGATGGAGGATGG - Intronic
1032343236 7:131095240-131095262 CGGATGGGTGGGGTGGGGGATGG - Intergenic
1032405395 7:131652197-131652219 TGGATGTGTGAGGTGGAAGAAGG + Intergenic
1033068365 7:138177853-138177875 TGGATGGGTGCGGTGGCTCACGG + Intergenic
1033417954 7:141180968-141180990 TGGATGGGTGGGGAGGAGGATGG - Intronic
1033477890 7:141708285-141708307 TGGGTGGGTGGGGAGGAGAAGGG + Intergenic
1034311770 7:150094941-150094963 GGGCTGGGGGTGCTGGAGCAGGG - Intergenic
1034356033 7:150451307-150451329 TGCATGGCTGTGGGGGAGGATGG + Intronic
1034520786 7:151618039-151618061 TGGCTGGGTGCGGTGGCTCATGG + Intronic
1034795084 7:154005713-154005735 GGGCTGGGGGTGCTGGAGCAGGG + Intronic
1035279123 7:157766207-157766229 TGGATGGGTGTGTGGGTGGATGG - Intronic
1036018442 8:4814247-4814269 TGTATGTGTGTGGTGGGGGATGG + Intronic
1036406925 8:8463298-8463320 GGGAGGGGTGTGGTGGGGTAGGG - Intergenic
1037184555 8:16047160-16047182 AGGCTGGGTGTGGTGGCTCATGG + Intergenic
1037893431 8:22636307-22636329 TGGATGTGGGTGCTGGGGCAAGG - Intronic
1038266945 8:26045248-26045270 TGGAACGGTGGGGAGGAGCAGGG - Exonic
1038537949 8:28368041-28368063 TGCATGTATGTGGTGGGGCAGGG + Intronic
1038819099 8:30935961-30935983 TAGCTGGGTGTGGTGGTGCGTGG + Intergenic
1038978038 8:32723538-32723560 TAGCCGGGTGTGGTGGCGCATGG + Intronic
1039411574 8:37359585-37359607 TGGAAGGGTGTGGTGGATGGAGG - Intergenic
1039623530 8:39024357-39024379 TTGGTGGGTGTGGTTGGGCAAGG - Intronic
1040419762 8:47227657-47227679 TAGCTGGGTGTGGTGGCTCATGG + Intergenic
1040455413 8:47593030-47593052 TAGCTGGGCGTGGTGGGGCATGG - Intronic
1040463335 8:47671053-47671075 TAGCTGGGTATGGTGGTGCACGG - Intronic
1040520844 8:48174667-48174689 AGGCTGGGTGTAGTGGAGAAGGG + Intergenic
1041375254 8:57205433-57205455 TGCAGGGGTATGGTGGGGCAAGG + Intergenic
1041599875 8:59704327-59704349 GGGATGGGGGTGGTGGGGAATGG + Intergenic
1041717512 8:60945449-60945471 TAGCTGGGTATGGTGGTGCATGG - Intergenic
1042622913 8:70725623-70725645 GGGCTGGGTGTGGTGGCTCATGG + Intronic
1043525667 8:81094080-81094102 TGAGAGCGTGTGGTGGAGCAGGG + Intronic
1043944632 8:86235667-86235689 TAGCTGGGTGTGGTGGAGCGTGG - Intronic
1044678128 8:94750099-94750121 TAGCTGGCTGTGGTGGTGCACGG - Intronic
1045130308 8:99144351-99144373 TAGTTGGGTGTGGTGGTACATGG + Intronic
1045196097 8:99932157-99932179 TGAATGGAAGTGGTGGAGAATGG + Intergenic
1045319385 8:101070195-101070217 TGGATGGGTGTGTGGGAGTGGGG + Intergenic
1045537048 8:103040266-103040288 TAGCTGGGTGTGATGGTGCATGG + Intronic
1045768593 8:105706958-105706980 AGGCTGGGTGTGGTGGCTCATGG + Intronic
1045840411 8:106573248-106573270 TGTATGTCTGTGGTGGGGCAGGG - Intronic
1045987464 8:108265254-108265276 AGGCTGGGTGTGGTGGCTCATGG - Intronic
1046143505 8:110125996-110126018 TGGCCAGGTGTGGTGGATCAAGG + Intergenic
1046559695 8:115820064-115820086 TGGCTGGGCGTGGTGGTGCATGG - Intergenic
1046792872 8:118340621-118340643 TAGCTGGGTGTAGTGGTGCATGG + Intronic
1047295961 8:123570761-123570783 TAGCTGGGTTTGGTGGCGCACGG - Intergenic
1048198713 8:132353666-132353688 TAGCTGGGCGTGGTGGCGCACGG + Intronic
1048425915 8:134323399-134323421 TAGAGAAGTGTGGTGGAGCAAGG - Intergenic
1048427053 8:134332683-134332705 TGGATGGGTGGGGGGGTGGATGG - Intergenic
1048446700 8:134498076-134498098 GGGAGGGTTGTGGTGGAGCTGGG + Intronic
1048447024 8:134499375-134499397 GGGAGGGTTGTGGTGGAGCTGGG + Intronic
1048707946 8:137175637-137175659 TTGATGGGTGGGGTGGAGGTGGG - Intergenic
1049008395 8:139872113-139872135 TGGATGGGTGGGCTGGTGGATGG + Intronic
1049008532 8:139872661-139872683 TGGATGGGTGGGCTGGTGGATGG + Intronic
1049008620 8:139872925-139872947 TGGATGGGTGGGTTGGTGGATGG + Intronic
1049147791 8:141014406-141014428 TAGCTGGGGGTGGTGGTGCATGG - Intergenic
1049351141 8:142165454-142165476 TGGATGGGGGTGGGTCAGCAGGG - Intergenic
1049375720 8:142288150-142288172 GGGAGGGGTGTGGCTGAGCAAGG + Intronic
1049426192 8:142538827-142538849 TGGAGGGATGTGGGGGACCAAGG + Intronic
1049485951 8:142861505-142861527 TGAATAGGAGTGGTGGAACAAGG + Intronic
1049511380 8:143028423-143028445 TGGATGGGGGAGGTGGCACAGGG - Intergenic
1049576680 8:143392944-143392966 GGGGTGGGTGTGGTGGCCCAAGG + Intergenic
1050349307 9:4724631-4724653 TAGCTGGGTGTGGTGGCTCATGG + Intronic
1050424684 9:5501103-5501125 TAGCTGGGTGTGGTGGCGCATGG + Intergenic
1050786054 9:9403143-9403165 TAGCTGGGTGTGGTGGCACAAGG + Intronic
1050860834 9:10428171-10428193 TAGCTGGGTGTGGTGGCTCATGG + Intronic
1051495750 9:17720946-17720968 TGGTAGTGTGTTGTGGAGCAGGG + Intronic
1052258212 9:26484218-26484240 TGGCCGGGCGTGGTGGCGCATGG - Intergenic
1052966875 9:34347040-34347062 GAGAGGGGTGTGGTGGGGCACGG - Intergenic
1053159913 9:35806746-35806768 AGCAAGGGTGTGGTAGAGCAGGG - Intronic
1054155104 9:61634528-61634550 TGGCTGGGTGTGGGGGTGCGGGG + Intergenic
1054178375 9:61891918-61891940 TGGCTGGGTGTGGGGGTGCGGGG - Intergenic
1054474894 9:65565636-65565658 TGGCTGGGTGTGGGGGTGCGGGG + Intergenic
1054659154 9:67688906-67688928 TGGCTGGGTGTGGGGGTGCGGGG + Intergenic
1055031499 9:71774792-71774814 TGGCTGGGTGTGGTGGCTCATGG - Intronic
1055641286 9:78320623-78320645 TGGATGGGTGGGTGGGAGAATGG - Intronic
1055752976 9:79527725-79527747 TAGATGGGTGTGGTGGCACGTGG + Intergenic
1056471253 9:86906116-86906138 TGGCTGGGTGGGGTGGGCCATGG + Intergenic
1056867773 9:90244916-90244938 TGGCTGGGTGTGGTGGCTCACGG - Intergenic
1056893447 9:90517673-90517695 TGGAGAAGTGTGGTGGAGAATGG + Intergenic
1057046965 9:91893483-91893505 TGGAGGGGTGTGGGGAAGAAGGG - Intronic
1057900173 9:98942566-98942588 TGGCTGAGTGGGGAGGAGCATGG + Intergenic
1058050136 9:100397402-100397424 TAGCTGGGTGTGGTAGTGCACGG - Intergenic
1058133687 9:101283115-101283137 TAGCTGGGTGTGGTGGCTCACGG - Intronic
1058146807 9:101421551-101421573 TGGGTGGGTATTCTGGAGCATGG + Exonic
1058494184 9:105536915-105536937 TGGCTGGGTGTGGTGGCTCATGG - Intronic
1059292674 9:113240902-113240924 TAGCTGGGTGTGGTGGCGCTTGG + Intronic
1059445987 9:114338062-114338084 AGGGTGTGTGTGGTGGAGGAGGG + Intronic
1059576780 9:115497961-115497983 TAGCTGGGTGTGGTGGCGCGTGG + Intergenic
1060136543 9:121160970-121160992 TTGGGGGGTGTGGTGGAACAGGG - Intronic
1060397116 9:123324145-123324167 TAGCTGGATGTGGTGGCGCATGG - Intergenic
1060430694 9:123549141-123549163 AGGTTGGGAGTGGTGGAGCTGGG - Intronic
1060465265 9:123898472-123898494 TAGCTGGATGTGGTGGTGCATGG - Intronic
1060506877 9:124204483-124204505 TAGCTGGGTGTGGTGGCGCATGG - Intergenic
1060711052 9:125864389-125864411 TGAATGGGGGTGGGGGAGGATGG + Intronic
1060997009 9:127879985-127880007 TAGCCGGGTGTGGTGGTGCATGG - Intergenic
1061022331 9:128024264-128024286 TGGCTGGGTGTGGTGGCTCACGG - Intergenic
1061201529 9:129141012-129141034 TGCCTGGCTGTGGTGGAGCCTGG + Intronic
1061497882 9:130986073-130986095 TAGCTGGGTGTGGTGGCACATGG - Intergenic
1061846865 9:133392993-133393015 TGGATGGGTGTGTGGTTGCATGG + Intronic
1061991623 9:134162461-134162483 CCGACAGGTGTGGTGGAGCAGGG + Intergenic
1062106851 9:134759901-134759923 TGTATGAGTGTGGGGGTGCATGG - Intronic
1062211136 9:135364773-135364795 TAGATGGGCGTGGTGGCACACGG + Intergenic
1062217137 9:135395288-135395310 TGGATGGATGGGATGGAGAAGGG + Intergenic
1062454898 9:136630819-136630841 TGGATGGGTGTGTGCAAGCATGG - Intergenic
1062477968 9:136738773-136738795 TGGGTGGGGCTGGAGGAGCAGGG - Intronic
1062577474 9:137215370-137215392 GGGGTGGGGGTGGTGGAACAAGG - Intronic
1062611755 9:137378489-137378511 AGGACGGGTGTGGTGGCTCACGG - Intronic
1203360436 Un_KI270442v1:216673-216695 TGGAGGGGTGTTGGGGAGGAGGG + Intergenic
1185559633 X:1049701-1049723 TGGCTGGGTGCGGTGGCTCACGG + Intergenic
1185559674 X:1049964-1049986 TGGCTGGGTGCGGTGGCTCACGG + Intergenic
1185559715 X:1050227-1050249 TGGCTGGGTGCGGTGGCTCACGG + Intergenic
1185580907 X:1211058-1211080 TGGATGGATGTGTTGGTGGATGG + Intronic
1185590885 X:1276312-1276334 TGGCTGGGTGAGGTGGCTCACGG - Intronic
1186168631 X:6853907-6853929 TAGCTGGGTGTGGTGGTGCATGG - Intergenic
1186421610 X:9431467-9431489 TGGCTGGGCGTGGTGGCTCATGG - Intergenic
1186490487 X:9968506-9968528 TAGCTGGGTGTGGTGGTGCGTGG + Intergenic
1186869453 X:13756097-13756119 TAGCTGGGTGTGGTGGCACATGG - Intronic
1187254011 X:17624787-17624809 TGGATGGTTGTGGTGGGAAATGG + Intronic
1187273814 X:17801556-17801578 TGGATGGTACTGGAGGAGCATGG + Exonic
1187338753 X:18402923-18402945 AGGCTGGGTGTGGTGGCTCATGG - Intergenic
1187747711 X:22427640-22427662 TGGATGGATGTGATGGAGACTGG + Intergenic
1187895247 X:23974436-23974458 TGGAAGGTTGGGGTGGAACAAGG - Intergenic
1187913970 X:24135713-24135735 TGGAAGGTTGGGGTGGAACAAGG - Intergenic
1187995971 X:24926975-24926997 TAGCTGGGTGTGGTGGCGCATGG - Intronic
1188691127 X:33130695-33130717 TAGCTGGGCGTGGTGGCGCATGG - Intronic
1189105949 X:38235517-38235539 GGGTTGGGTGGGGTGGGGCATGG - Intronic
1189321593 X:40090549-40090571 GGGTGGGGTGGGGTGGAGCAAGG - Intronic
1189787942 X:44576506-44576528 TGGCTGGGTGCGGTGGCTCACGG - Intergenic
1190109281 X:47579518-47579540 TGGATGGGTGTGGGGGCCCATGG - Intronic
1190128161 X:47723989-47724011 TGGTTGGGTGGGGTGGCACATGG + Intergenic
1190580480 X:51888961-51888983 GGGATGGGGGCGGTGGAGGAGGG + Intronic
1190863426 X:54364442-54364464 TAGCTGGGTGTGGTGGTGCTCGG + Intergenic
1190954957 X:55183794-55183816 TGTGGGGGTGTGGTTGAGCAAGG + Intronic
1192104750 X:68303885-68303907 TGGAAGGGTAGGGAGGAGCAGGG + Intronic
1192779007 X:74275334-74275356 TAGCTGGGTGTGGTGGTGCATGG - Intergenic
1193398432 X:81013586-81013608 TGGGTGGGTGCGGTGGCTCATGG + Intergenic
1193714921 X:84926885-84926907 TTGATGGTTCTGGTGGAGGATGG + Intergenic
1193859990 X:86653395-86653417 TGGAAGGGTGCGGGGGAGCAGGG + Intronic
1195107817 X:101617448-101617470 TGGGTGGGGGTGGCGGAGGAGGG - Intronic
1195690245 X:107618339-107618361 TGTATGTGTGGGGTGAAGCAAGG - Intergenic
1195703136 X:107719901-107719923 TGGAATGATGTGGTTGAGCATGG - Intronic
1195927099 X:110037321-110037343 TAGATGAGTGTGGTGTTGCAAGG + Intronic
1196388332 X:115183547-115183569 AAGTTGGGTGTGGTGGCGCATGG + Intronic
1196997014 X:121395432-121395454 TGGCTGGGTGCGGTGGCTCATGG + Intergenic
1197958531 X:131978898-131978920 TGGGTGGGAGGGGTGGAGCTAGG + Intergenic
1200316176 X:155135510-155135532 TAGCTGGGTGTGGTGGCACATGG + Intronic
1200953763 Y:8925485-8925507 TAGCTGGGTGTGGTGGCCCATGG - Intergenic
1201110480 Y:10795728-10795750 TGGAAGGGAGTGGTGGAGAGTGG - Intergenic
1201173798 Y:11295254-11295276 TGGATGGGAGTGGAGTAGAATGG - Intergenic
1201848857 Y:18454044-18454066 TTGCTTGGTGTGGTGGGGCATGG + Intergenic
1201884461 Y:18866331-18866353 TTGCTTGGTGTGGTGGGGCATGG - Intergenic
1201992002 Y:20037304-20037326 TGGCTGGGTGCGGTGGCTCATGG + Intergenic