ID: 1122954514

View in Genome Browser
Species Human (GRCh38)
Location 14:105064313-105064335
Sequence TGGGCTTTGGATGGGTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1238
Summary {0: 1, 1: 0, 2: 11, 3: 113, 4: 1113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122954514_1122954523 21 Left 1122954514 14:105064313-105064335 CCACCACACCCATCCAAAGCCCA 0: 1
1: 0
2: 11
3: 113
4: 1113
Right 1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122954514 Original CRISPR TGGGCTTTGGATGGGTGTGG TGG (reversed) Intronic
900142662 1:1145121-1145143 GGGACTGTGGTTGGGTGTGGAGG - Intergenic
900338206 1:2175340-2175362 TGGGGTTGGGATGGGGATGGGGG - Intronic
900426128 1:2579928-2579950 TGTGCTATGGATGGATGTTGAGG + Intergenic
900478538 1:2887398-2887420 TGGGCTGAGGATGGGGGTCGGGG + Intergenic
900675326 1:3881587-3881609 TGACTTTTGGCTGGGTGTGGTGG + Intronic
900728226 1:4232860-4232882 TGGGCTTGGCAGGGGTGCGGAGG + Intergenic
900958801 1:5906306-5906328 TCGGCCTTGGAGGGGAGTGGAGG - Intronic
901090787 1:6639617-6639639 TGGGCCTCGGCTGGGCGTGGTGG - Intronic
901131732 1:6965987-6966009 AGGGCTTTGGGAGTGTGTGGGGG + Intronic
901461774 1:9396275-9396297 TGTTTTTTGGTTGGGTGTGGTGG + Intergenic
901547714 1:9971597-9971619 TTGGCTTTGGCTGGGCGTGGTGG - Intronic
902037033 1:13465342-13465364 TGAGCTGTGGATGGGTGGGTGGG - Intergenic
902607690 1:17577932-17577954 TGGGCTTTGGAGGGGAGGGCAGG + Intronic
902760863 1:18580045-18580067 TGGGAATAGGCTGGGTGTGGTGG - Intergenic
902761490 1:18583761-18583783 TGGGCCATGGCTGGGAGTGGAGG - Intergenic
903148851 1:21390858-21390880 TGGGTTTGGGCTGGGCGTGGTGG + Intergenic
903442524 1:23399053-23399075 TAGGTGTTGGCTGGGTGTGGTGG - Intronic
903448104 1:23435314-23435336 TGGATGTTGGCTGGGTGTGGTGG - Intronic
903479680 1:23644244-23644266 TGGCATTTGGAAGGGAGTGGGGG - Intergenic
903479812 1:23645052-23645074 TGGACTGTGCATGGGTGGGGAGG - Intergenic
903559922 1:24219683-24219705 TGGATTTTGGATGGTTTTGGAGG - Intergenic
903562154 1:24236266-24236288 TGGGGTGTGGGTGTGTGTGGAGG + Intergenic
903605924 1:24575075-24575097 TGGGCCTTGGCCAGGTGTGGTGG - Intronic
903659713 1:24969655-24969677 TGGGCTGGGGGTGGGTGTGGGGG + Intergenic
903688422 1:25150172-25150194 TGGGCATTGGCTGGGTGCAGTGG + Intergenic
903836992 1:26210841-26210863 TGTGCTTTGGATGAGTATGCAGG + Intergenic
903876553 1:26478365-26478387 TGAATTTTGGCTGGGTGTGGTGG - Intergenic
903899110 1:26630277-26630299 TGGGGTTAGGCTGGGTGCGGTGG + Intergenic
904096499 1:27982391-27982413 AGGGCTTTGGGTGGCTGAGGTGG - Intronic
904215859 1:28918337-28918359 AGGCCATTGGCTGGGTGTGGTGG - Intronic
904328324 1:29741934-29741956 CAGGCTTTGGAGGGGTGGGGTGG - Intergenic
904530442 1:31165160-31165182 ACAGCTTTGGCTGGGTGTGGTGG - Intergenic
904875354 1:33650550-33650572 TGGGCTTAGGATGGGGTGGGGGG + Intronic
905016294 1:34781252-34781274 TGGGCTTTGGAGAGCTGGGGTGG - Exonic
906209351 1:44003467-44003489 TGGACCCTGGCTGGGTGTGGTGG + Intronic
906326800 1:44851350-44851372 TTGGGTTTGGCTGGGCGTGGTGG - Intronic
906895740 1:49769132-49769154 TGATTTTTGGCTGGGTGTGGTGG - Intronic
907191084 1:52649549-52649571 TGGGGATGGGATGGGTGTGACGG - Intronic
907250860 1:53138214-53138236 TGATCTTTGGATGGTTCTGGTGG - Intronic
907494794 1:54836510-54836532 TTGGCCTTGGATGGGGGTAGGGG + Intronic
907746206 1:57216086-57216108 TGTGGTTTGCATGGGTGTGTTGG + Intronic
908530072 1:65025964-65025986 TGTGGTTTGGCTGGGTGTGGTGG - Intergenic
908980738 1:69954170-69954192 TTGGATTTGGATAGGTGGGGAGG + Intronic
909139510 1:71846009-71846031 AGGGCTTTGGAAGCCTGTGGTGG - Intronic
909337391 1:74491525-74491547 TTGGACTTGGCTGGGTGTGGTGG - Intronic
909391421 1:75125719-75125741 TGGGCCTGGGATGGGGGCGGGGG - Intergenic
910189957 1:84585145-84585167 TGGACTTTGGCTGGGTGTGGTGG - Intergenic
910228061 1:84956802-84956824 TTGGCTTTGGCTGAGTGAGGTGG - Intronic
910871671 1:91839264-91839286 TAAGATTTGGCTGGGTGTGGTGG - Intronic
911687204 1:100791062-100791084 TTGGCTGGGGATGGGAGTGGTGG - Intergenic
912302620 1:108533855-108533877 TGGGGTTTGGGTGGGTGGTGGGG - Intergenic
912431697 1:109631453-109631475 GGGGCTTGGGATGGTTGTGGGGG + Exonic
912747680 1:112258975-112258997 TGGGCTTGGGATGAGGATGGAGG - Intergenic
912844314 1:113065681-113065703 TGTGTCTTGGATTGGTGTGGAGG + Intergenic
913007669 1:114650954-114650976 AGGGCATTAGCTGGGTGTGGTGG + Intronic
913327504 1:117639567-117639589 TGGGGGTGGGCTGGGTGTGGTGG - Intergenic
913330890 1:117666569-117666591 TCAGCTTTAGCTGGGTGTGGTGG - Intergenic
913962819 1:143353114-143353136 GGGGCTTTGGAAGGGGCTGGTGG + Intergenic
914057174 1:144178699-144178721 GGGGCTTTGGAAGGGGCTGGTGG + Intergenic
914121972 1:144787667-144787689 GGGGCTTTGGAAGGGGCTGGTGG - Intergenic
914412632 1:147446001-147446023 TGGGTTTTGGATGTGTGGGCTGG + Intergenic
914848543 1:151296755-151296777 TAGTCTTAGGCTGGGTGTGGTGG - Intronic
915117131 1:153608235-153608257 AGGGCCTAGGGTGGGTGTGGAGG - Intronic
915134574 1:153721717-153721739 TGGGGTTTGGCTGGGTGCAGTGG - Intergenic
915150161 1:153824340-153824362 TTGGGTTTGGCTAGGTGTGGTGG + Intronic
915377981 1:155414594-155414616 TTGGTTTTGGATGGGAGTGGTGG - Intronic
915398764 1:155607117-155607139 TTGGATCTGGCTGGGTGTGGTGG - Intergenic
915684506 1:157617717-157617739 TGGGCTGGGGGTGGGTGGGGGGG + Intergenic
916568443 1:166003977-166003999 TGGCCTCGGGCTGGGTGTGGTGG + Intergenic
918288239 1:183079954-183079976 TTTTTTTTGGATGGGTGTGGTGG + Intronic
918553229 1:185768656-185768678 TATGGTTTGGCTGGGTGTGGCGG + Intronic
918727724 1:187947435-187947457 TGGGCTTGTGATGGGAGAGGTGG - Intergenic
919673343 1:200357698-200357720 TGGGATTAGGCTGGGTATGGTGG + Intergenic
919751132 1:201038946-201038968 TGTACTTTGCATGGTTGTGGTGG + Intergenic
920044486 1:203124640-203124662 TGGGCTCTGGAGGGGTGTGCTGG + Intronic
920434774 1:205940738-205940760 TGGGTTTTGGTTGGATCTGGAGG + Intronic
920914053 1:210244933-210244955 TGTGGTTTGGATGGGTGTTTAGG - Exonic
921052388 1:211520141-211520163 GGGGAATTGGCTGGGTGTGGTGG + Intergenic
921162205 1:212481111-212481133 GGGGCTTAGGCTGGGTGTGGTGG + Intergenic
921178604 1:212614231-212614253 TAGACTTAGGCTGGGTGTGGGGG - Intronic
921833183 1:219751001-219751023 AGGGCTCTGGCTGGGTGTGGTGG - Intronic
922210668 1:223484061-223484083 TGGGCTTTGGAGGGGGTTGGAGG + Intergenic
922512165 1:226178032-226178054 TTGGCTTGGGCTGGGTGTAGTGG - Intronic
923234878 1:232022591-232022613 TGGGTATTGGCTGGGTGCGGTGG - Intronic
923481309 1:234386923-234386945 TGTGTTCTGGCTGGGTGTGGTGG - Intergenic
923905802 1:238382525-238382547 GAGGCTTTGGCTGGGCGTGGTGG - Intergenic
924268606 1:242308918-242308940 TGGGATTTGGAGGAGTGTGTGGG + Intronic
924526121 1:244851094-244851116 TGGAACTTGGCTGGGTGTGGTGG - Intronic
924643984 1:245860163-245860185 TGGGAGTGGGAGGGGTGTGGGGG - Intronic
924951743 1:248890850-248890872 GGGGCTGTGGATGTGTGGGGAGG - Intergenic
1063376239 10:5556210-5556232 TGGGCATGGCATGGGGGTGGTGG - Intergenic
1063629038 10:7717237-7717259 TAGGCTTGGGCTGGGTGTGGTGG - Intronic
1063985466 10:11497160-11497182 AGCGCTTTGGAAGGGTGAGGTGG + Intronic
1064053708 10:12079991-12080013 TGTGCTTTGGCTGGGTGAGGTGG + Intronic
1064110056 10:12530767-12530789 TGAGATTAGGCTGGGTGTGGTGG + Intronic
1064120341 10:12612645-12612667 TGGGTCCTGGATGGGCGTGGAGG + Intronic
1064156209 10:12905434-12905456 TGGGAATAGGATGGGTTTGGAGG + Intronic
1064271823 10:13872226-13872248 GTGGCTCTGGATGGGTGAGGAGG + Intronic
1064568749 10:16671051-16671073 AGGGTTCTGGCTGGGTGTGGTGG - Intronic
1064965362 10:21010539-21010561 TTGGTCTTGGCTGGGTGTGGTGG - Intronic
1064985619 10:21207259-21207281 TGGCTTTTGGCTGGGCGTGGTGG - Intergenic
1065105965 10:22385197-22385219 TTTCCTTTGGATGGGTGTGGGGG + Intronic
1065200805 10:23311117-23311139 TGAGGTGTGGCTGGGTGTGGTGG - Intronic
1065348855 10:24776863-24776885 TCGGCTTTGGATGGCTGGGATGG + Intergenic
1065557505 10:26931427-26931449 TTGGCCTTGGAGGGGCGTGGCGG + Intergenic
1065692467 10:28349248-28349270 TGCCCATTGGCTGGGTGTGGTGG - Intergenic
1065699523 10:28411283-28411305 TGGCTCTTGGATGGGTGTGGTGG + Intergenic
1065860369 10:29867451-29867473 TGGAGTTTGGATGTGTGTGCTGG + Intergenic
1065882233 10:30046802-30046824 TGATCTTGGGCTGGGTGTGGTGG + Intronic
1066123029 10:32309905-32309927 TGGGCTTTGGCCAGGTGTGGTGG + Intronic
1066209512 10:33223331-33223353 TTGGTTGTGGCTGGGTGTGGTGG + Intronic
1066405660 10:35115604-35115626 TTGGTTCTGGCTGGGTGTGGTGG + Intergenic
1066631322 10:37461584-37461606 TGGGCTCTGGCTGGGTACGGTGG - Intergenic
1066676473 10:37893050-37893072 TGTTATTGGGATGGGTGTGGTGG + Intergenic
1066716299 10:38289850-38289872 TGGGATTTGGAGGAGTGTGTGGG - Intergenic
1066795388 10:39114407-39114429 TCCACTTTGGCTGGGTGTGGTGG - Intergenic
1067364915 10:45617335-45617357 AGGGATTGGGATGGGTGTGGTGG + Intronic
1068524240 10:58109192-58109214 GGAGATTTGGCTGGGTGTGGTGG - Intergenic
1069140910 10:64824273-64824295 TGTGATTTGAATGGGTGTGCAGG - Intergenic
1069975046 10:72206155-72206177 TGTGCTTTGGAAGGCTGAGGCGG + Intronic
1070035079 10:72714478-72714500 TGGGAGTTAGCTGGGTGTGGTGG - Intronic
1070307035 10:75245859-75245881 TGGGCTCAGGATGGCAGTGGGGG - Intergenic
1070333890 10:75437830-75437852 TCAGCTTTGTTTGGGTGTGGAGG + Intronic
1070382146 10:75890815-75890837 TGGCCTATGGCTGGGTGTGGTGG + Intronic
1071212127 10:83355543-83355565 TGTGGTTTGGCTGGGTGAGGTGG - Intergenic
1071495049 10:86162389-86162411 TGGGCTTTGGGTGGCTGGGATGG - Intronic
1071528648 10:86373030-86373052 TGGGATGAGGAGGGGTGTGGTGG - Intergenic
1071723980 10:88177857-88177879 TAGGCTTTGGTTGTTTGTGGTGG + Intergenic
1072051311 10:91706344-91706366 TGGGCTTGGGTCTGGTGTGGGGG - Intergenic
1072118416 10:92385406-92385428 CAGGCTCTGGCTGGGTGTGGTGG - Intergenic
1072264971 10:93718627-93718649 TTGTTTTTGGCTGGGTGTGGTGG - Intergenic
1072615617 10:97047476-97047498 TCTGCTTTTGATGGGTGAGGGGG + Intronic
1072666228 10:97394675-97394697 TGGTGTTTGGCTGGGTGTGGTGG - Intronic
1072807569 10:98434141-98434163 GGTCCTTTGGTTGGGTGTGGGGG - Intronic
1073302686 10:102480569-102480591 TGGCCTCTGGCTGGCTGTGGGGG - Exonic
1073315942 10:102580892-102580914 TAGGCTTGGGCTGGGCGTGGTGG + Intronic
1073823326 10:107291022-107291044 TAGGCCCTGGATGGGTCTGGAGG + Intergenic
1074063149 10:109986836-109986858 TTGACTTTGGCTGGGAGTGGTGG + Intergenic
1074194236 10:111166730-111166752 TGGGATGTGGGTGGGTGTGATGG + Intergenic
1074752865 10:116603603-116603625 TATACTTTGGCTGGGTGTGGTGG + Intronic
1075124844 10:119691464-119691486 GTGGCTTTGGCTGGGTGCGGTGG + Intergenic
1076093907 10:127714668-127714690 TGGGCTCTGGATAGTTGGGGGGG - Intergenic
1076290077 10:129339337-129339359 TGGGCTGGAGGTGGGTGTGGAGG + Intergenic
1076438450 10:130462754-130462776 TGGGCTTTGCATTGGTGAGAGGG - Intergenic
1076863091 10:133151203-133151225 GGGGCATTAGCTGGGTGTGGTGG + Intergenic
1077018650 11:407728-407750 TCGGCTTTGGAGGCGTGCGGCGG - Intronic
1077464181 11:2725782-2725804 TGTGCTTTGGGTGGGGGCGGGGG - Intronic
1077487834 11:2847190-2847212 TGGGCTTTGCCTGGGTGTGCAGG - Intronic
1077592438 11:3502984-3503006 TGGGCGTGGGGTGGGTGAGGAGG + Intergenic
1077904153 11:6516072-6516094 TGTGTCTTGGCTGGGTGTGGTGG - Intronic
1078075206 11:8152557-8152579 TGGGGTTTGGAGGGGTGCAGAGG + Intronic
1078237048 11:9495154-9495176 TGGGCTAAGGCTGGGCGTGGTGG + Intronic
1078611859 11:12827443-12827465 TAGGCTTGGGGTGGGTGTGTTGG + Intronic
1078708618 11:13768763-13768785 TGTGTTCTGGATGGGTGGGGTGG + Intergenic
1078968843 11:16381774-16381796 TGGGTTTTGGGAGGGAGTGGGGG - Intronic
1079501097 11:21102138-21102160 TGTACTTTGGCCGGGTGTGGTGG - Intronic
1079996031 11:27295964-27295986 TGGACTTAGGCTGGGTGTGGTGG - Intergenic
1081477000 11:43443429-43443451 TGGCCTTTGGAAGGCTTTGGGGG + Exonic
1081524350 11:43914916-43914938 TGAACTTGGGCTGGGTGTGGTGG + Intronic
1081663890 11:44905277-44905299 TGGGGTGTGGATGGATGTAGGGG - Intronic
1081672363 11:44949464-44949486 TGGGCTTTGGAGGAGCCTGGGGG + Intronic
1081686714 11:45048155-45048177 TGTGCTTTGGCTGGGCGTGGTGG - Intergenic
1081728727 11:45353352-45353374 CAAGCTTTGGCTGGGTGTGGTGG + Intergenic
1081924327 11:46811761-46811783 TGGTATTAGGCTGGGTGTGGTGG - Intronic
1082732649 11:56818864-56818886 TGTGCTTTGGCTGGGCATGGTGG - Intergenic
1082916061 11:58438769-58438791 TGGGCTTTGCATGTGTGTGTTGG - Intergenic
1082918383 11:58464717-58464739 TTGTATTTGGCTGGGTGTGGTGG - Intergenic
1083171405 11:60925635-60925657 TGGACTGTGGGTGGGGGTGGGGG - Intronic
1083337590 11:61933727-61933749 TGGATATTGGCTGGGTGTGGTGG + Intergenic
1083341924 11:61963751-61963773 TTGTCTTGGGCTGGGTGTGGAGG + Exonic
1083483509 11:62965906-62965928 TGGGCTTTGGTGGGTTTTGGTGG + Intronic
1083658902 11:64243092-64243114 AGGGCTGTGGGTGGGCGTGGGGG + Intronic
1084142334 11:67240866-67240888 TGGGGTATGTGTGGGTGTGGAGG - Intronic
1084294372 11:68201790-68201812 TAGGTTCTGGCTGGGTGTGGTGG + Intronic
1084462362 11:69303013-69303035 AGGGCTTTGGATGGGATCGGGGG + Intronic
1085733412 11:79018471-79018493 TGGGGTAGGGATGTGTGTGGGGG - Intronic
1086103067 11:83121713-83121735 AGGGCCTAGGCTGGGTGTGGTGG - Intergenic
1086376389 11:86204984-86205006 TGAGCTGTGGCTGGGTGTGGTGG - Intergenic
1086537226 11:87862358-87862380 TGGGGCATGGATGGGGGTGGAGG + Intergenic
1086742349 11:90383499-90383521 TGGCTTTTGGCTGGGTATGGTGG + Intergenic
1087116852 11:94534744-94534766 TGGGCTGTGGCTGGGCATGGTGG - Intergenic
1087370245 11:97274397-97274419 TAGGCTGTGGTTGTGTGTGGAGG - Intergenic
1087666590 11:101056350-101056372 TGGCCTGGGGCTGGGTGTGGTGG + Intronic
1087725853 11:101715915-101715937 TGAATTTTGGCTGGGTGTGGTGG + Intronic
1087771901 11:102220019-102220041 AGGCCATTGGCTGGGTGTGGTGG - Intronic
1088830595 11:113533139-113533161 TGGGCGTGGGGTGGGGGTGGAGG - Intergenic
1089244307 11:117107210-117107232 TGTCTTTTGGTTGGGTGTGGTGG + Intergenic
1089406489 11:118201889-118201911 TGGGCTGAGGAGGGGTGTGCAGG + Intronic
1089581654 11:119485211-119485233 TGGGCTCTGGATGTATTTGGAGG - Intergenic
1090162835 11:124514160-124514182 TGGGAGTGGGGTGGGTGTGGTGG - Intergenic
1090190045 11:124761448-124761470 TGGGCCTTGGGGGGGTGGGGTGG + Intronic
1090846498 11:130534045-130534067 TGGGTTTGGGGTGGGTGTGAGGG + Intergenic
1091469882 12:717523-717545 TGGTCTATGTCTGGGTGTGGTGG - Intergenic
1091534516 12:1393238-1393260 AGAACTTTGGCTGGGTGTGGTGG + Intronic
1091708227 12:2715192-2715214 TGGGGATTGGCTGGGTGCGGTGG - Intergenic
1092181512 12:6450077-6450099 TGGGCCTGGGATGGGGGTTGGGG + Intronic
1092613402 12:10194558-10194580 TGTGGATAGGATGGGTGTGGTGG + Intergenic
1092616327 12:10219029-10219051 TCAGCTTTGGCTGGGGGTGGTGG + Intronic
1092617645 12:10230115-10230137 TGGGTCTTGGCTGGGTGTCGTGG + Intergenic
1093075475 12:14753617-14753639 TGTGCCTTTGATTGGTGTGGGGG - Intergenic
1093473643 12:19531960-19531982 TGGTTTTTGGCTGGATGTGGTGG + Intronic
1093902195 12:24648401-24648423 TGAGTTTTGGCTGGGTGTGGTGG - Intergenic
1094111415 12:26866567-26866589 TGTACTTTAGCTGGGTGTGGTGG + Intergenic
1094277828 12:28698882-28698904 TCGGCTTGGTGTGGGTGTGGGGG - Intergenic
1094585139 12:31770939-31770961 CAGGCTTTGGCTGGGTATGGTGG + Intergenic
1096070629 12:48773743-48773765 TGGGGGTTTGAGGGGTGTGGTGG - Intronic
1096230551 12:49894465-49894487 TGGGCTGTGGGTGGGGGAGGGGG + Intronic
1096480970 12:51940804-51940826 TGTCCTGTGGATGGGTGTGTGGG - Intergenic
1096786507 12:54019866-54019888 AGGGCATAGGATGGGGGTGGGGG - Intronic
1096972262 12:55676720-55676742 TGGGGTTGGGATGGGGATGGGGG + Intergenic
1097109541 12:56648034-56648056 AGGATTTTGGCTGGGTGTGGTGG + Intergenic
1097175826 12:57142333-57142355 GGGGCTGTGCTTGGGTGTGGGGG + Intronic
1097797611 12:63880519-63880541 AGAGGTTTGGCTGGGTGTGGTGG - Intronic
1097933758 12:65221506-65221528 TGTTATTTGGCTGGGTGTGGTGG - Intronic
1098000477 12:65936967-65936989 TGGGCTTTGTAAGGGTTAGGAGG - Intronic
1098335358 12:69398861-69398883 TGTGCTTTGGCCGGGTGTGGTGG + Intergenic
1098410783 12:70181308-70181330 TGGGATCAGGCTGGGTGTGGTGG + Intergenic
1098921553 12:76306701-76306723 TGGGCATGGGCTGGGTGTGGTGG - Intergenic
1098940579 12:76530303-76530325 AGGACTTTGGATGGCTGAGGAGG - Intronic
1099896906 12:88659697-88659719 AGAGTTTTGGCTGGGTGTGGTGG - Intergenic
1100218369 12:92477304-92477326 TTGGCTTCGGAGGGGCGTGGAGG + Intergenic
1100596780 12:96078656-96078678 TGTGCTGTGGCTGGGTGGGGTGG - Intergenic
1100988023 12:100223048-100223070 TGGGAGTAGGCTGGGTGTGGTGG + Intronic
1101172624 12:102114649-102114671 TTGGCCTTAAATGGGTGTGGTGG - Intronic
1101477380 12:105063656-105063678 TAGGGTTTGGGTGGGTGGGGAGG + Intronic
1101792505 12:107940695-107940717 TGGGGTTTGGTTGGTTGGGGTGG - Intergenic
1102014309 12:109637671-109637693 TGGGCTTGGGGTGGGTGGGAGGG + Intergenic
1102212444 12:111137220-111137242 TGGATTTTGGATGGGAGTGGTGG - Intronic
1102449108 12:113027328-113027350 CTGGTTTTGGCTGGGTGTGGTGG - Intergenic
1102954840 12:117052750-117052772 TGGGGGTGGGTTGGGTGTGGGGG - Intronic
1103372732 12:120431931-120431953 AGGGTTTTGGCTGGGTGTGGTGG + Intergenic
1103384390 12:120520609-120520631 TGGGCGATGGCGGGGTGTGGTGG - Intronic
1103424151 12:120817000-120817022 TAGGTTTTGGCTGGGTGTGGTGG + Intronic
1103476618 12:121223361-121223383 TGGCTTCTGGCTGGGTGTGGTGG - Intronic
1103730982 12:123027643-123027665 TCGGCTGTGGAGGGGTGTGAGGG + Intronic
1103839853 12:123853612-123853634 TAGTCTCAGGATGGGTGTGGCGG + Intronic
1104072242 12:125355985-125356007 TGGGGTTTGGAGGGGGCTGGGGG + Intronic
1104470430 12:129025481-129025503 GGGGCTGTGGATGTGTGTGTGGG - Intergenic
1105208869 13:18246182-18246204 TGATTTTTGGCTGGGTGTGGTGG - Intergenic
1105329597 13:19403174-19403196 TGGCATTTTGATGGGTGGGGTGG - Intergenic
1105518396 13:21110647-21110669 TGGCTTTTGGCTAGGTGTGGTGG - Intergenic
1105689625 13:22822870-22822892 TGGTTCTCGGATGGGTGTGGTGG - Intergenic
1105785842 13:23748191-23748213 TGTGATTTAGCTGGGTGTGGTGG - Intronic
1105819288 13:24065297-24065319 GGGGGTTTTGATGTGTGTGGTGG + Intronic
1105862239 13:24425864-24425886 TGGCATTTTGATGGGTGGGGTGG + Intronic
1105951573 13:25233831-25233853 TAGGCTTTGGATGAATGTGTAGG - Intergenic
1106168194 13:27267612-27267634 TTGATTTTGGATGGGGGTGGTGG + Intergenic
1106394911 13:29370307-29370329 TGTGATTCGGCTGGGTGTGGTGG + Intronic
1107168877 13:37316613-37316635 TGTCCTTTGGATGGGTGTTTTGG + Intergenic
1107194179 13:37627930-37627952 GGGGTTAGGGATGGGTGTGGGGG + Intergenic
1107551811 13:41483562-41483584 TGCACTGTGGATGGGTGCGGTGG + Intergenic
1107746609 13:43517207-43517229 TGTCCTTAGGCTGGGTGTGGTGG + Intronic
1107922936 13:45228955-45228977 TGAGGATTGGTTGGGTGTGGTGG - Intronic
1108095578 13:46897342-46897364 TTGGCTTTGGATGGAAGTGCCGG - Intergenic
1108150544 13:47529121-47529143 TGGTTTTTGGATGGGTATGGTGG - Intergenic
1108213199 13:48158843-48158865 AGGGCTCAGGCTGGGTGTGGTGG - Intergenic
1108258844 13:48637024-48637046 AGGGGTTAGGCTGGGTGTGGTGG + Intergenic
1108281890 13:48869620-48869642 TGGGTTATGGAGGGTTGTGGAGG + Intergenic
1108615107 13:52125274-52125296 TAGATGTTGGATGGGTGTGGTGG + Intronic
1109109811 13:58302487-58302509 TGTGCTTTGACTGTGTGTGGTGG + Intergenic
1109241442 13:59894573-59894595 TGTGCTTTTGAGGGGTGGGGGGG - Intronic
1109916654 13:68996175-68996197 TTGCCTTTGGATCGCTGTGGGGG + Intergenic
1110229140 13:73150631-73150653 GGGGCATTGGCCGGGTGTGGTGG + Intergenic
1110238306 13:73239046-73239068 TAGATTTTGGCTGGGTGTGGTGG - Intergenic
1110716456 13:78710390-78710412 TGGTCTTGGGCCGGGTGTGGTGG - Intergenic
1111391443 13:87600670-87600692 TGAGTTTTGGAAGGGTGAGGGGG + Intergenic
1111772800 13:92621287-92621309 GGGGCTGAGGATGGGAGTGGAGG - Intronic
1111981909 13:95025353-95025375 TGGGGTGTGGGTGTGTGTGGGGG - Intronic
1112119781 13:96396913-96396935 TGCCTTTTGGCTGGGTGTGGTGG + Intronic
1112191729 13:97184696-97184718 TGTTCTTGGGCTGGGTGTGGTGG + Intergenic
1112347236 13:98600336-98600358 TTGCCTTTGGGTGGGTGTGGTGG - Intergenic
1112430281 13:99345058-99345080 TGGAATTTGGATGGGTGGAGAGG + Intronic
1113263472 13:108592160-108592182 TGGGGTATGGAGGGGTGTGTGGG + Intergenic
1113263481 13:108592179-108592201 TGGGGTATGGAGGGGTGTGGGGG + Intergenic
1113483940 13:110641158-110641180 GGGGCTGGGGATGGGTGAGGTGG - Intergenic
1113678504 13:112225306-112225328 TGGGCTTGGGCAGGGTGTGGTGG - Intergenic
1113736290 13:112680813-112680835 TGGGCCTTGGAGGGAAGTGGGGG + Intronic
1113920613 13:113906695-113906717 CCGGCTCTGGATGTGTGTGGAGG - Intergenic
1114332591 14:21652295-21652317 TGGCCACTGGATGGGTGTGGAGG + Intergenic
1114455301 14:22849862-22849884 TGGGGTCTGGAGGGGTGTGGGGG - Intergenic
1115535744 14:34371614-34371636 TGGGTTCTGGCTGGGCGTGGTGG + Intronic
1115561027 14:34583017-34583039 TGGTGTTTGGCTGGGTGCGGTGG + Intronic
1116170828 14:41400235-41400257 AGCACTTTGGCTGGGTGTGGGGG - Intergenic
1116255349 14:42547971-42547993 TGGGTTTTGGACTTGTGTGGGGG - Intergenic
1116855043 14:49944662-49944684 TGGTCTGTGGGTGGGAGTGGGGG + Intergenic
1117155759 14:52939065-52939087 TGGCTTCTGGCTGGGTGTGGTGG + Intronic
1117809328 14:59530081-59530103 TGGGACTAGGCTGGGTGTGGTGG + Intronic
1117876997 14:60262937-60262959 TGGGTTTTGGCTGGGTGCGGTGG + Intronic
1117921399 14:60728598-60728620 TGAGTTTGGGCTGGGTGTGGTGG + Intergenic
1118014236 14:61642149-61642171 ATGGGTGTGGATGGGTGTGGAGG - Intronic
1118217533 14:63823462-63823484 TAGACTTGGGCTGGGTGTGGTGG - Intergenic
1118349691 14:64964860-64964882 TGGGTTATGGCTGGGTGCGGTGG - Intronic
1118619417 14:67600864-67600886 TGGGTTTGGGCTGGGTGCGGTGG - Intergenic
1119136482 14:72225614-72225636 TGGTTTTTGGCTGGGCGTGGTGG - Intronic
1119243830 14:73086158-73086180 GTGGTTTGGGATGGGTGTGGTGG + Intronic
1119757336 14:77128389-77128411 AGGGCTGTGGGTGGGAGTGGAGG - Intronic
1119837428 14:77762770-77762792 GTAGCTTTGGCTGGGTGTGGTGG + Intronic
1119861262 14:77937812-77937834 TGGGCTGTGGCGGGGGGTGGTGG - Intergenic
1119883270 14:78118950-78118972 CAGGCATTGGCTGGGTGTGGTGG + Intergenic
1119940117 14:78631751-78631773 TTGGCTTTGGATGGGGTTGTTGG + Intronic
1120535730 14:85692426-85692448 TAGGCTTTGGCTGGGTGTTCTGG - Intergenic
1120784513 14:88520126-88520148 TTATCTTTGGCTGGGTGTGGTGG + Intronic
1120784686 14:88522137-88522159 TGGGCTTAGGCCGGGCGTGGTGG + Intronic
1121136842 14:91506835-91506857 TGGACTTAGGCTGGGTGCGGTGG - Intronic
1121390457 14:93569146-93569168 TGGCTCTTGGCTGGGTGTGGTGG + Intronic
1121400078 14:93668421-93668443 TGTGCAATGGCTGGGTGTGGTGG + Intronic
1121412612 14:93758296-93758318 TGACATTTGGCTGGGTGTGGTGG + Intronic
1122231914 14:100310376-100310398 TGGGTTCTGGCTGGGCGTGGTGG + Intergenic
1122267498 14:100553558-100553580 AAGGGTCTGGATGGGTGTGGGGG - Intronic
1122748603 14:103916443-103916465 ACTGCTTTGGTTGGGTGTGGTGG + Intronic
1122858715 14:104572508-104572530 AGGGCTGTGGGTGGGTGTGCAGG - Intronic
1122954514 14:105064313-105064335 TGGGCTTTGGATGGGTGTGGTGG - Intronic
1123039748 14:105485656-105485678 TGGCCTTGGGCTGGGTGTGCTGG + Intergenic
1123632967 15:22274932-22274954 TGTGGATAGGATGGGTGTGGGGG - Intergenic
1123807969 15:23894815-23894837 TGGCCTTTGGCTGGGTGCAGTGG - Intergenic
1123902095 15:24887514-24887536 TAGGTTTGGGTTGGGTGTGGTGG + Intronic
1124029829 15:26000722-26000744 TGTTATTAGGATGGGTGTGGTGG + Intergenic
1124056745 15:26247401-26247423 AGCGCTTTGGAAGGGTGAGGCGG - Intergenic
1124140514 15:27073117-27073139 CATGCTTTGGATGGGTGTGCTGG - Intronic
1124451782 15:29799700-29799722 TTGTTTTTGGCTGGGTGTGGTGG - Intronic
1124808381 15:32908756-32908778 TGGGGTGTGGGTGGGGGTGGGGG + Intronic
1124864819 15:33478742-33478764 TGGGATTTGGAAGGGTATTGGGG - Intronic
1125112273 15:36047299-36047321 TGGGCAGTGGATGGGACTGGGGG - Intergenic
1125196961 15:37058149-37058171 GGGGCCTTAGGTGGGTGTGGGGG - Intronic
1125695632 15:41635044-41635066 TGGAAATTGGCTGGGTGTGGTGG + Intronic
1126098883 15:45107920-45107942 AGGGGTTGGGAAGGGTGTGGTGG + Intronic
1126371018 15:47947211-47947233 TCAGCTTAGGCTGGGTGTGGTGG + Intergenic
1126689787 15:51280383-51280405 CAGGCTTTGGCTGGGCGTGGTGG - Intronic
1126851968 15:52802774-52802796 TGGGGTTTTGAGGGGTGTGTTGG - Intergenic
1127393937 15:58528655-58528677 TGGGCTCTAGCTGGGTATGGTGG - Intronic
1127500462 15:59549624-59549646 TGGGGTGGGGATGGGTGGGGGGG + Intergenic
1127500474 15:59549650-59549672 TGGGGTGGGGGTGGGTGTGGAGG + Intergenic
1127815976 15:62609036-62609058 TGGGCTTGTGATGGTGGTGGTGG + Intronic
1127905356 15:63372295-63372317 TGGGCTTAGCATGGCTGAGGTGG - Intronic
1127920475 15:63490505-63490527 GGAACTCTGGATGGGTGTGGTGG + Intergenic
1128026072 15:64437779-64437801 ATGACTTTGGCTGGGTGTGGTGG - Intronic
1128102018 15:65009939-65009961 AGGGAATTGGTTGGGTGTGGTGG - Intronic
1128145129 15:65328809-65328831 TGGGATTTGGATGGTCCTGGGGG - Exonic
1128481286 15:68041773-68041795 TGGGCAAAGGCTGGGTGTGGTGG + Intergenic
1128788134 15:70413262-70413284 AGGGCTCTGGATGGATGAGGAGG + Intergenic
1128820531 15:70648601-70648623 GGGGCATTGGCTGGGCGTGGTGG - Intergenic
1128966938 15:72068762-72068784 TGGGATATGGCTGGGTATGGTGG - Intronic
1129085167 15:73081842-73081864 TAGTATTTGGCTGGGTGTGGTGG - Intronic
1129169415 15:73798595-73798617 AGGGCTTTGGAGGGGTGTGGAGG - Intergenic
1129265724 15:74392180-74392202 TGTGCTTTGGAATGGTGTTGAGG - Intergenic
1129625271 15:77191391-77191413 TGGGGTGTGGATATGTGTGGAGG - Intronic
1130360448 15:83179990-83180012 TGGGGTGTGTATGTGTGTGGCGG + Intronic
1130551535 15:84892876-84892898 TGGGCTTTGGCTGGGAGAGCGGG - Intronic
1130827053 15:87559998-87560020 GAGGCTCTGGCTGGGTGTGGTGG + Intergenic
1131107782 15:89746500-89746522 TGGGCTGTGTGTGTGTGTGGAGG - Intergenic
1131125865 15:89856273-89856295 TGGGCCTTGGCTGGGTGCAGTGG + Intronic
1131229061 15:90647133-90647155 TGGAATTTGGAGGGGTGTGGAGG - Intergenic
1131554316 15:93383655-93383677 TGTTCTCTGGCTGGGTGTGGTGG + Intergenic
1131569933 15:93524312-93524334 TGGGTTTGGGAGGCGTGTGGAGG + Intergenic
1132008469 15:98252714-98252736 TTGGTTTTGGATAGGGGTGGGGG + Intergenic
1132206613 15:99990321-99990343 TGTGCTTTGGCTGGGCGTGGTGG - Intronic
1132474829 16:129422-129444 TGGGCTTTGGAAGGGCGATGGGG - Intronic
1132582447 16:691217-691239 TGGGCTGGGAATGGGGGTGGAGG - Intronic
1132676358 16:1122934-1122956 GGGGCTGTGGGTGGGTATGGAGG - Intergenic
1133015783 16:2939058-2939080 TTGGTTTTGGCCGGGTGTGGTGG - Intronic
1133039584 16:3053179-3053201 TGGGCTTCGGCTGGGCGTGGTGG + Intronic
1133043427 16:3072812-3072834 TGGGCTTCGGATGGGCGTGGTGG + Intronic
1133072658 16:3256826-3256848 AGGGTTTGGGAGGGGTGTGGGGG - Intergenic
1133181277 16:4056539-4056561 TTTACTTTGGCTGGGTGTGGTGG - Intronic
1133390146 16:5403731-5403753 AGAGCATTGGCTGGGTGTGGTGG - Intergenic
1133580761 16:7142309-7142331 TGGGACTTGGCTAGGTGTGGTGG - Intronic
1133761066 16:8798563-8798585 GGGGCTGGAGATGGGTGTGGTGG - Intronic
1133927492 16:10205033-10205055 GGAGCTTTGGCTGGGTGTGGTGG + Intergenic
1133964711 16:10522160-10522182 TGGGGGTGGGTTGGGTGTGGTGG + Intergenic
1134690971 16:16190895-16190917 GGGGCTTGAGATGGGGGTGGGGG + Intronic
1134726273 16:16420881-16420903 TGGGGTTGGGAGGGGTATGGTGG - Intergenic
1135078291 16:19412653-19412675 TGGGCTCGGGCTGGGTGCGGTGG - Intronic
1135317976 16:21466997-21467019 AGGGCTTTGTCTGGGTATGGTGG - Intergenic
1135370871 16:21898792-21898814 AGGGCTTTGTCTGGGTATGGTGG - Intergenic
1135440914 16:22471925-22471947 AGGGCTTTGTCTGGGTATGGTGG + Intergenic
1135748510 16:25037618-25037640 TGGGCTTTGGCTGGGTGATTTGG + Intergenic
1135751716 16:25063672-25063694 TGGGCTTTGGCTGGGTGATTTGG + Intergenic
1135751796 16:25064289-25064311 TGGGCTTTGGCTGGGTGATTTGG - Intergenic
1135758297 16:25116160-25116182 TGGGCTTTGGCTGGGTGATTTGG + Intronic
1135850206 16:25956709-25956731 TGGGTTTTGGCTGGGCGTGGTGG + Intronic
1135945904 16:26864718-26864740 TGGGCTTTGGTGGGGGTTGGGGG + Intergenic
1136170435 16:28486277-28486299 TTGGCCATGGCTGGGTGTGGTGG - Intronic
1136240825 16:28942829-28942851 TGGGCTTTGGGAGGCTGAGGTGG - Intergenic
1136489641 16:30598444-30598466 TGGGATTTGGCTGGGAGCGGTGG + Intergenic
1136654539 16:31702092-31702114 TTGATTTTGGCTGGGTGTGGTGG + Intergenic
1136989297 16:35142358-35142380 TGGGCTTGGGCTGGGTGCAGGGG + Intergenic
1137289644 16:47043275-47043297 TGGGCTTTGGCAGGGCGCGGTGG - Intergenic
1137292209 16:47059544-47059566 TGGGCTAGGTGTGGGTGTGGTGG - Intergenic
1137379176 16:47981803-47981825 GGGACCTTGGCTGGGTGTGGTGG - Intergenic
1137590333 16:49689620-49689642 TGGCCTCTGGCTGGGTGTTGTGG - Intronic
1137700956 16:50497400-50497422 TGGGCCTTGACTGGGCGTGGGGG + Intergenic
1137832051 16:51553256-51553278 TGGAATTTGGAATGGTGTGGTGG + Intergenic
1137951282 16:52785868-52785890 TGGAATCTGGCTGGGTGTGGCGG - Intergenic
1138008145 16:53356049-53356071 GGGGACTTGGATGTGTGTGGGGG + Intergenic
1138039107 16:53643008-53643030 TGGGCGTTGGCTGGGTGCGGTGG + Intronic
1138131578 16:54484465-54484487 TGGGCTTTGAATGGTGGGGGTGG + Intergenic
1138833435 16:60403966-60403988 TGGTATTAGGCTGGGTGTGGTGG + Intergenic
1139119624 16:63999742-63999764 AGCGCTTTGGATGGCTGAGGTGG + Intergenic
1139781946 16:69359238-69359260 ATGGTTTTGGCTGGGTGTGGTGG + Intronic
1139889617 16:70240941-70240963 AGGGCTTTGTCTGGGTATGGTGG - Intergenic
1140141863 16:72265874-72265896 TAGGCTATAGCTGGGTGTGGTGG + Intergenic
1140412487 16:74749285-74749307 TGAGCTCTGGATGCCTGTGGTGG + Intronic
1140443207 16:75002576-75002598 TGGGCTTAGGCTGGGTCTGGAGG + Intronic
1140531918 16:75674084-75674106 TGTACTTTGGCTGGGGGTGGTGG + Intronic
1140806529 16:78537202-78537224 TTGACTCTGGCTGGGTGTGGTGG - Intronic
1140977714 16:80076193-80076215 TAGATTTTGGCTGGGTGTGGTGG - Intergenic
1141069707 16:80942569-80942591 TGGGTTTAGGCTGGGTGCGGTGG + Intergenic
1141242931 16:82279700-82279722 TGGGTTTTGGATGGGTGACATGG - Intergenic
1141266299 16:82500613-82500635 TGAATGTTGGATGGGTGTGGTGG + Intergenic
1141355979 16:83347354-83347376 TGGGGTTTGGGTGGGGGTAGGGG + Intronic
1141585544 16:85031191-85031213 TTGGCCTTGGCTGGGTGTGGTGG + Intronic
1141588941 16:85054715-85054737 TGGATTTTGGCTGGGCGTGGTGG - Intronic
1141619106 16:85227442-85227464 TGGGCTTTTGAGGGATGTGCAGG + Intergenic
1141737518 16:85863501-85863523 TGGGTTCTGGCTGGGTGCGGTGG - Intergenic
1141776164 16:86123832-86123854 TGGACTTTGGCTGGGATTGGGGG + Intergenic
1141897179 16:86965548-86965570 TGGGCTTTGGCTGGGGGTGCTGG - Intergenic
1141993183 16:87621756-87621778 TGGGGTTTGGGTGGGTGGTGGGG + Intronic
1142105036 16:88298132-88298154 TGGGCTGTGGCAGGGGGTGGGGG - Intergenic
1142401725 16:89862333-89862355 TGGGCCTTGGCCGGGTGCGGTGG - Intronic
1142530202 17:574475-574497 TGGGCCTTGGCTGGGCGCGGTGG + Intronic
1142659828 17:1420227-1420249 TGGGATTAGGCCGGGTGTGGTGG - Intergenic
1142684553 17:1570409-1570431 TGGGCTTGGGTGTGGTGTGGTGG + Intronic
1142953173 17:3501061-3501083 TGGGCTTCGGCTGGATGTCGTGG - Exonic
1142970441 17:3607822-3607844 TCTACTTTGGCTGGGTGTGGGGG - Intergenic
1143011905 17:3870650-3870672 TGGGGTTTGGCCGGGCGTGGTGG - Intronic
1143217473 17:5235667-5235689 CGGGCTCTGGCTGGGTGCGGTGG + Intergenic
1143521081 17:7444826-7444848 TGGGGTTTGTGTGGGTGAGGGGG - Exonic
1143558361 17:7676471-7676493 TGGGGTTGGGGTGGGGGTGGTGG + Intronic
1143677913 17:8449993-8450015 TCGACATTGGCTGGGTGTGGCGG + Intronic
1143967313 17:10765711-10765733 AAGGCTTTGGCTGGGTGTGGTGG - Intergenic
1144869235 17:18358612-18358634 TGTACTTGGGCTGGGTGTGGTGG + Intronic
1145204017 17:20971117-20971139 TGGGATTTTGATGGTGGTGGAGG + Intergenic
1145290858 17:21544774-21544796 GGGGCCTAGGATGGGTGTGGTGG + Intronic
1145362369 17:22222593-22222615 TGGGCATGGGCTGGGCGTGGTGG + Intergenic
1145398095 17:22511886-22511908 GGGGCTTTGCATGGGAGGGGAGG - Intergenic
1145911899 17:28547967-28547989 TGGGCTATGGGTGGTGGTGGGGG - Intronic
1146225522 17:31062723-31062745 TGTGCATTGGCTGGGTGTGGTGG + Intergenic
1146362622 17:32189992-32190014 TGGTATTTGGCTGGGCGTGGTGG - Intronic
1146402501 17:32510986-32511008 GGGGCTTTGGTTTGGTTTGGTGG - Intronic
1146576728 17:34000538-34000560 TGATCTTTGGCTGGGTGTGGTGG - Intronic
1146702846 17:34976808-34976830 TGGGAACTGGCTGGGTGTGGTGG - Intronic
1146823700 17:36005298-36005320 GGTGTTTTGGCTGGGTGTGGTGG - Intergenic
1147232105 17:39027135-39027157 TGGGGTTTGGATGGGATTGTGGG + Intergenic
1147353969 17:39876204-39876226 TGGGCTTTGGCTGGGCGCAGTGG - Intronic
1147445934 17:40475362-40475384 TGGACTGTGGTCGGGTGTGGTGG - Intergenic
1147958259 17:44149917-44149939 TGGGCTTTGGATGGATGAGTAGG + Intronic
1148368157 17:47072223-47072245 TGGGCTGTGGTGGGGTGGGGTGG - Intergenic
1148649076 17:49236819-49236841 TTGTCTATGGCTGGGTGTGGTGG - Intergenic
1149087809 17:52740206-52740228 AGGGCTTTGGGAGGCTGTGGTGG + Intergenic
1149328396 17:55556165-55556187 GGGTCTTGGGATGGGGGTGGAGG + Intergenic
1149662400 17:58341530-58341552 TTTGCTTTGGCTGGGTGTGGTGG - Intergenic
1149741864 17:59054587-59054609 TGGGCATTGGCTGGGTGCCGTGG - Intronic
1149865584 17:60149560-60149582 TGGCCTTGGGGTGGGGGTGGGGG - Intergenic
1150028981 17:61711579-61711601 TGGGGAGTGGCTGGGTGTGGTGG + Intronic
1150105302 17:62458313-62458335 TGTGCTAGGGCTGGGTGTGGTGG - Intergenic
1150328940 17:64279066-64279088 TTGACTATGGCTGGGTGTGGTGG + Intergenic
1150481989 17:65517765-65517787 TGGGCCTGTGCTGGGTGTGGAGG - Intergenic
1150571944 17:66394287-66394309 TGGGCTAGTGCTGGGTGTGGAGG - Intronic
1150581915 17:66481813-66481835 TGGGTTGGGGCTGGGTGTGGTGG + Intronic
1150698669 17:67428249-67428271 TGTGCCTTGGCTGGGTGTGGTGG + Intronic
1150804890 17:68310911-68310933 TGGAGTTTGGCTGGGTGTGGTGG + Intronic
1150919233 17:69465983-69466005 AGACCTTTGGCTGGGTGTGGTGG + Intronic
1151191211 17:72399474-72399496 TGGGTTTTGGAGGGGTGAGAAGG - Intergenic
1151235081 17:72714047-72714069 TGGGTTTTGGCTGGGTGCAGTGG + Intronic
1151245428 17:72790818-72790840 TTGTTTTTGGCTGGGTGTGGTGG - Intronic
1151633883 17:75330411-75330433 TGGGCTTTGGCAGGGTGCGGTGG + Intronic
1151644959 17:75424252-75424274 TGCGTATTGGCTGGGTGTGGTGG + Intergenic
1151678338 17:75611174-75611196 TGGTCTTTGGCTGGGTGTGGTGG + Intergenic
1151780697 17:76243188-76243210 TGAGTCTTGGCTGGGTGTGGTGG - Intergenic
1152129749 17:78468943-78468965 TGTGCTCTGGTTGGTTGTGGAGG - Intronic
1152856965 17:82670470-82670492 TGGCCCTTGGCTGGGCGTGGTGG - Intronic
1152889737 17:82873706-82873728 TGGCCTTGGTCTGGGTGTGGAGG + Intronic
1153245033 18:3065439-3065461 TGGCTTTTTGAGGGGTGTGGTGG + Intergenic
1153692403 18:7606776-7606798 TTGGCTTTGGTTGAGTGGGGAGG + Intronic
1153774593 18:8441484-8441506 TGATTTTTGGCTGGGTGTGGTGG - Intergenic
1153885680 18:9463440-9463462 TAGGATTTGGATGGGACTGGAGG + Intergenic
1154477228 18:14773938-14773960 TGAGTTTTGGATGGGCGCGGGGG - Intronic
1154977297 18:21471906-21471928 TGGATTGTGGCTGGGTGTGGTGG - Intronic
1155510199 18:26568522-26568544 TGAGCTGAGGCTGGGTGTGGTGG - Intronic
1155671735 18:28379875-28379897 TGGCTTTTGGAGGGGTGTAGGGG - Intergenic
1156298966 18:35818406-35818428 TGGGGTTTGGATGGCTGCAGCGG + Intergenic
1157201173 18:45661179-45661201 AGGTCTTTGGATGGGTGGGTAGG - Intronic
1157262928 18:46192284-46192306 TGGACTCTGGCTGGGTGAGGTGG + Intronic
1157426831 18:47591486-47591508 TGGGCTCTGCATGGATGTGGTGG - Intergenic
1157613242 18:48971979-48972001 TGATCTTTGGCTGGGTGGGGTGG - Intergenic
1157671214 18:49530408-49530430 GGGTCTTTGGTTGGGTGCGGTGG + Intergenic
1157912733 18:51633688-51633710 AGTGTTTTGGCTGGGTGTGGTGG - Intergenic
1158227052 18:55212056-55212078 TGGGTTTAGGCCGGGTGTGGTGG - Intergenic
1158587218 18:58751157-58751179 TAGTTTTAGGATGGGTGTGGTGG + Intergenic
1158594727 18:58806388-58806410 TGGGGTTTAGCTGGGCGTGGTGG - Intergenic
1158716114 18:59881273-59881295 GAGGCTCTGGCTGGGTGTGGTGG + Intergenic
1159637274 18:70820683-70820705 AGGTCTTGGGATGGGGGTGGCGG + Intergenic
1159665761 18:71157672-71157694 AGGGCTTTGGCCGGGCGTGGTGG - Intergenic
1160232566 18:77058944-77058966 TGGGCTAGGGCTGGATGTGGTGG - Intronic
1160394796 18:78563774-78563796 TGGGGGTTTGAGGGGTGTGGGGG - Intergenic
1160394829 18:78563852-78563874 TGGGGGTTTGAGGGGTGTGGGGG - Intergenic
1160394862 18:78563930-78563952 TGGGGGTTTGAGGGGTGTGGGGG - Intergenic
1160907664 19:1459358-1459380 CAGGCTTTGGCCGGGTGTGGTGG - Intronic
1161056877 19:2195125-2195147 TGGCAGTGGGATGGGTGTGGGGG + Intronic
1161253174 19:3292232-3292254 TGGTCTTTGGCCGGGTGTGGTGG - Intronic
1161474782 19:4478486-4478508 TGAGCCTGGGCTGGGTGTGGTGG - Intronic
1161594203 19:5142890-5142912 TGGGCCTGGCGTGGGTGTGGCGG + Intronic
1161984388 19:7645662-7645684 TGGGTGCTGGATGGGTGCGGGGG - Intronic
1162062135 19:8102503-8102525 AGAGGTTTGGCTGGGTGTGGTGG - Intronic
1162063379 19:8110344-8110366 TGGGTTTTGGCTGGGAGTGGTGG - Intronic
1162149672 19:8636122-8636144 CTGGTTTTGGCTGGGTGTGGTGG - Intergenic
1162624126 19:11870312-11870334 TTGGCCTTGGCTGGGTGTGGTGG + Intronic
1162663341 19:12188668-12188690 TTGGCTCTGGCTGGGTGTGGTGG + Exonic
1162882408 19:13669608-13669630 TGGGCGTGGGCTGGGTGTGGTGG - Intergenic
1163314815 19:16534759-16534781 GGTGCATTGGCTGGGTGTGGTGG - Intronic
1163400861 19:17091719-17091741 TGGGAGTGGGATGGGGGTGGTGG - Intronic
1163506213 19:17707928-17707950 ATGGCTTGGGCTGGGTGTGGTGG - Intergenic
1163533917 19:17866323-17866345 TGGGGTTTGGCAGGGGGTGGGGG - Intergenic
1163537870 19:17888115-17888137 TGCCCTTTGGCTGTGTGTGGAGG + Intronic
1163582640 19:18147583-18147605 TGGGCTTCGGCAGGGAGTGGTGG - Exonic
1163633358 19:18427836-18427858 TGGGCTGTGGAAGGGGGTTGAGG + Intronic
1163860112 19:19738309-19738331 TGGTCAGGGGATGGGTGTGGTGG + Intergenic
1163867821 19:19789132-19789154 AGGCCTCTGGCTGGGTGTGGTGG + Intronic
1163994398 19:21029677-21029699 AGAGTTTTGGCTGGGTGTGGTGG + Intronic
1164001854 19:21107524-21107546 TTGTCTATGGCTGGGTGTGGTGG - Intronic
1164002287 19:21113111-21113133 TAGGCTTTGGCTGGGCATGGTGG - Intronic
1164058873 19:21647758-21647780 TGGGTGCTGGCTGGGTGTGGTGG + Intergenic
1164387514 19:27787837-27787859 AGGGCCTTGGCTGGGCGTGGTGG + Intergenic
1164691176 19:30211730-30211752 TGGGCTATGGTTGGGATTGGAGG + Intergenic
1164728523 19:30483489-30483511 TGGTTGTTGGATGGGTGGGGTGG - Intronic
1164773440 19:30831260-30831282 TGGGCTTTTTTTGGCTGTGGGGG + Intergenic
1164877808 19:31704822-31704844 TGAACCTTGGCTGGGTGTGGTGG + Intergenic
1165019186 19:32909068-32909090 TTGGCTTTGGATTGGACTGGCGG + Intronic
1165104484 19:33460875-33460897 GGGTCTTGGGATGGGGGTGGAGG + Intronic
1165511847 19:36270709-36270731 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165512399 19:36273210-36273232 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165512946 19:36275751-36275773 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165513502 19:36278306-36278328 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165514052 19:36280840-36280862 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165514604 19:36283377-36283399 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165515156 19:36285910-36285932 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165515706 19:36288446-36288468 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165516257 19:36290983-36291005 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165516809 19:36293509-36293531 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165517362 19:36296032-36296054 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165517914 19:36298567-36298589 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165518465 19:36301102-36301124 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165519014 19:36303634-36303656 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165519564 19:36306149-36306171 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165623954 19:37269904-37269926 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165624500 19:37272445-37272467 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165625043 19:37274972-37274994 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165625577 19:37277510-37277532 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165626117 19:37280035-37280057 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165626658 19:37282562-37282584 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165627198 19:37285083-37285105 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165627739 19:37287611-37287633 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165628277 19:37290135-37290157 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165628817 19:37292660-37292682 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165629359 19:37295186-37295208 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165629900 19:37297711-37297733 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165630443 19:37300239-37300261 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165630980 19:37302777-37302799 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165788910 19:38479053-38479075 TGGACTCTGGCTGGGTGTGGTGG - Intronic
1165992869 19:39826143-39826165 GGGGCTTTGGAGGTGGGTGGTGG - Intronic
1166059902 19:40319821-40319843 AGGGCCTTGGCTGGGCGTGGTGG - Exonic
1166099697 19:40564549-40564571 TGGATCTTGGCTGGGTGTGGTGG + Intronic
1167006092 19:46777497-46777519 GGGGCTTTGGCTGGTTGGGGTGG - Intronic
1167022513 19:46888704-46888726 TGTTCTTTGGCCGGGTGTGGTGG + Intergenic
1167127591 19:47561184-47561206 TGAGCTCTGGCTGGGTGTGGTGG + Intergenic
1167129600 19:47575406-47575428 ATGGCTTGGGACGGGTGTGGTGG + Intergenic
1167252547 19:48408045-48408067 TGGGCGTTGGCCGGGCGTGGTGG + Intronic
1167280055 19:48561825-48561847 TGGGCCTTGGCTGGGTGCAGTGG + Intronic
1167297147 19:48657905-48657927 TGAGTTCTGGCTGGGTGTGGTGG - Intergenic
1167309802 19:48730447-48730469 GGGTCTCTGGCTGGGTGTGGTGG - Intronic
1167525578 19:49981764-49981786 TGTGCTTGGGACGGGTGGGGAGG - Intronic
1167671631 19:50856873-50856895 AGGGCTTTGGCTGGGCGCGGTGG + Intronic
1167907235 19:52671726-52671748 TTGCAATTGGATGGGTGTGGTGG - Intronic
1168175993 19:54628424-54628446 TGGACTTGGGAATGGTGTGGGGG - Intronic
1168446972 19:56427447-56427469 TGTGCTTTGGCTGGGTGCGGTGG + Intronic
1168537101 19:57180207-57180229 TGTAGTTTGGATGGGTTTGGAGG + Intergenic
1168565102 19:57415975-57415997 TGGGCTTTGGATTAGAGTTGGGG + Intronic
1168675139 19:58272274-58272296 CTGGAGTTGGATGGGTGTGGTGG + Intronic
1168675734 19:58276758-58276780 TGTCTTTTGGCTGGGTGTGGTGG - Intronic
1202696657 1_KI270712v1_random:131372-131394 GGGGCTTTGGAAGGGGCTGGTGG + Intergenic
925129028 2:1481501-1481523 TTTGCTTTGGATGTGTGTGGAGG + Intronic
925237033 2:2288439-2288461 TGCTCTTTGAATGGATGTGGAGG - Intronic
925366542 2:3315450-3315472 GGGGCTGTGGATGGGGATGGTGG - Intronic
925366593 2:3315598-3315620 GGGGCTGTGGATGGGGATGGTGG - Intronic
925366719 2:3315966-3315988 GGGGCTGTGGATGGGGATGGTGG - Intronic
926034685 2:9626716-9626738 TGGGCTTTGGCTGGATGTGGTGG - Intronic
926127986 2:10283551-10283573 TGGGCATTGCGTGTGTGTGGGGG + Intergenic
926152667 2:10433631-10433653 TATGCTGTGGATGTGTGTGGTGG + Intergenic
926152670 2:10433681-10433703 TGTGCTGTGAATGTGTGTGGTGG + Intergenic
926335525 2:11859760-11859782 TTGGTTTAGGCTGGGTGTGGTGG + Intergenic
926646203 2:15292270-15292292 TGATTTTTGGATGGGTGTGGTGG - Intronic
927182352 2:20455680-20455702 TTCTCTTTGGCTGGGTGTGGTGG + Intergenic
927425955 2:22981467-22981489 TGGGATTAGGATCGGTTTGGGGG - Intergenic
927434563 2:23055900-23055922 TGGGCTTTTGATTGCTGTGCCGG - Intergenic
927508196 2:23628195-23628217 TGGGCTCGGGCTGGGTGCGGTGG - Intronic
927750657 2:25667199-25667221 TGTAATTTGGCTGGGTGTGGTGG + Intronic
927949195 2:27155927-27155949 TGGGATTGGGATGGAGGTGGAGG + Exonic
927991297 2:27449191-27449213 TGGGCTTTGGGTTTTTGTGGAGG + Intronic
928074811 2:28254422-28254444 TGGGCTGGGCATGGGCGTGGCGG - Intronic
928342325 2:30455610-30455632 TTGTCTTAGGCTGGGTGTGGTGG + Intronic
928653518 2:33426092-33426114 TGATCCTTGGCTGGGTGTGGTGG + Intergenic
928674871 2:33640504-33640526 ATGGTTTTGGCTGGGTGTGGTGG + Intergenic
929153989 2:38773197-38773219 AATGCTTTGGTTGGGTGTGGTGG - Intronic
929540755 2:42818792-42818814 TAGCTTTTGGCTGGGTGTGGTGG + Intergenic
929544051 2:42844223-42844245 TGGGCTTTGCTTGGGAGAGGTGG + Intergenic
929881820 2:45843369-45843391 TGGGGTTTGTGTGTGTGTGGTGG + Intronic
930646557 2:53915147-53915169 TAAGCTTTGGCTGGGCGTGGTGG + Intronic
930774489 2:55158974-55158996 TGGGGCTTGGCTGGGTGCGGTGG - Intergenic
930827653 2:55710537-55710559 TGAGCTCTAGCTGGGTGTGGTGG + Intergenic
931252950 2:60550068-60550090 TGTGCTTTGCATGGGGGTGAGGG + Intronic
931367237 2:61629466-61629488 TGGGTTCAGGCTGGGTGTGGTGG - Intergenic
931658309 2:64530772-64530794 TGCTTTTTGGCTGGGTGTGGTGG + Intronic
931732687 2:65167133-65167155 TAGGCTGGGGCTGGGTGTGGTGG - Intergenic
931937409 2:67214387-67214409 TTGGATGTGTATGGGTGTGGGGG - Intergenic
932022978 2:68106803-68106825 TAGGTTATGGCTGGGTGTGGTGG + Intronic
932059540 2:68482393-68482415 TAGGCTGTGGAAGTGTGTGGTGG + Intronic
932066830 2:68572546-68572568 TGCAGTTTGGCTGGGTGTGGTGG + Intronic
932156541 2:69423191-69423213 TGGGCTGTGTGTGTGTGTGGGGG + Intronic
932580165 2:72988210-72988232 TGTGCTGTGGGTGGGTGTGGGGG - Intronic
932767245 2:74478737-74478759 TGGGCATTGGCCGGGTGTGGTGG + Intronic
933706255 2:85292863-85292885 TTGACTTGGGCTGGGTGTGGTGG - Intronic
933825786 2:86159370-86159392 TTTGCCTTGGCTGGGTGTGGTGG - Intronic
934054806 2:88242757-88242779 TGGGTTTGGGTTGGGTATGGTGG + Intergenic
934277810 2:91588386-91588408 GGGGCTTTGGAAGGGGCTGGTGG + Intergenic
934572899 2:95383524-95383546 TGGGCTGAGGGAGGGTGTGGGGG - Intronic
934668090 2:96187985-96188007 TGGGTGTTGGCTGGGCGTGGTGG + Intronic
934972266 2:98773193-98773215 TGGGTTTTGGATAAATGTGGAGG - Intergenic
935090680 2:99892107-99892129 TGGGCTTTGGCCGGGTGTGGTGG - Intronic
935103731 2:100020541-100020563 TGGGGTTGGGGTCGGTGTGGTGG - Intronic
935279327 2:101504233-101504255 TGGGGATTGCCTGGGTGTGGTGG + Intergenic
935359937 2:102238491-102238513 TGGGGTGCTGATGGGTGTGGGGG - Intronic
935488926 2:103693517-103693539 TAAGCTATGGCTGGGTGTGGTGG - Intergenic
935597628 2:104891651-104891673 TGGGCCTTTGGTTGGTGTGGGGG + Intergenic
935750738 2:106231726-106231748 TGTGCACTGGCTGGGTGTGGTGG - Intergenic
935818365 2:106869115-106869137 TGGGCTTTGGAGGGGATTTGGGG + Intronic
936087576 2:109479804-109479826 TGGTCTGTGGATGGTTTTGGGGG - Intronic
936269445 2:111037655-111037677 TGGGCTTTGCAAGGTTGTTGTGG - Intronic
936537786 2:113325165-113325187 TGGGCTCTGGTGGGGGGTGGGGG - Intergenic
937359074 2:121216763-121216785 TGGCCCTTGGATGGGTCAGGTGG - Exonic
937456075 2:122042801-122042823 TGGGCATGCGATGGGTGTGATGG + Intergenic
938001856 2:127748196-127748218 TGGGCTTTGGATAATTTTGGGGG - Intronic
938064163 2:128272129-128272151 TGAGCTTTGCAGGGGTGAGGAGG - Intronic
938137037 2:128767900-128767922 GGGGCTTTGTGTGGGTGTTGAGG + Intergenic
938248066 2:129794290-129794312 AGGGATTTGGGTGGGTGTTGGGG + Intergenic
939009844 2:136833076-136833098 GGGGAATTGGCTGGGTGTGGTGG + Intronic
939453929 2:142409090-142409112 TGGACGTGGGCTGGGTGTGGTGG + Intergenic
939821372 2:146960735-146960757 TGGGCAATGGCAGGGTGTGGTGG - Intergenic
940071778 2:149696334-149696356 GGGGCTTGGAATGGGGGTGGGGG + Intergenic
940303618 2:152202091-152202113 TGGTTGTTGGCTGGGTGTGGTGG - Intergenic
940860130 2:158762610-158762632 TTGCCTTTTGATGGGGGTGGTGG - Intergenic
940895968 2:159082000-159082022 TGGGCTCTGGAAGGGTCTGATGG - Intronic
941939215 2:171015829-171015851 TGGACTTTGGGAGGCTGTGGCGG + Intronic
942028564 2:171935587-171935609 TGGGGTATGGTTGGGTGTGGTGG + Intronic
942184090 2:173407773-173407795 AGGGCTGTGGGTGGGGGTGGGGG + Intergenic
942572402 2:177327462-177327484 TAGGTTGTGGGTGGGTGTGGTGG + Intronic
943041644 2:182811740-182811762 GGGGTTTTGGCTGGGTGCGGTGG - Intergenic
943419423 2:187652064-187652086 TTGGCATTAGCTGGGTGTGGTGG - Intergenic
943986705 2:194631036-194631058 TGGTCTTTGGATGTGTGTGGTGG + Intergenic
944205276 2:197151891-197151913 TCGGATATGGATGGGTTTGGGGG - Intronic
944463121 2:199973006-199973028 TGAGTTTAGGCTGGGTGTGGTGG - Intronic
944648551 2:201805162-201805184 TGGTCTTTGGCCGGGTGCGGTGG + Intronic
945052134 2:205834126-205834148 TTGGGTTTGTATGTGTGTGGTGG + Intergenic
945477022 2:210295672-210295694 TTAGGTTTGGCTGGGTGTGGTGG + Intronic
945974695 2:216261072-216261094 CGGGCTATGGATTTGTGTGGTGG + Intronic
945988909 2:216377146-216377168 TGTGATTTGGCTGGGTGCGGTGG + Intergenic
946065776 2:216986035-216986057 TGGGCTTTAGCTTGGAGTGGTGG - Intergenic
946392623 2:219425780-219425802 GGGGCTATGGATGTGTCTGGGGG + Intronic
946430950 2:219627316-219627338 TGGGCTCTGGAGGGGAGGGGAGG + Intronic
946803132 2:223442421-223442443 TGGGCTTTGTATTAGTGTGTAGG + Intergenic
946972066 2:225104970-225104992 TAGGTGTTGGCTGGGTGTGGGGG + Intergenic
947007641 2:225530348-225530370 TGGATTTTGGATGAGGGTGGAGG - Intronic
947832452 2:233151183-233151205 TGGGCTATGCATGGGTGCAGTGG + Intronic
947839001 2:233195502-233195524 TGGGCGTGGGGTGGGTGTTGGGG + Intronic
948429225 2:237908722-237908744 GAGGCCTTGGCTGGGTGTGGTGG - Intronic
948465059 2:238148291-238148313 TGGGCTGGGGCTGGGGGTGGGGG + Intronic
948720873 2:239899205-239899227 AGGGGTGTGGAGGGGTGTGGTGG + Intronic
948720921 2:239899371-239899393 AGGGGTGTGGAGGGGTGTGGTGG + Intronic
948880326 2:240853684-240853706 TGGGCTTTGGCTGGTAGTGGTGG + Intergenic
948904874 2:240974655-240974677 AGGGTGTTGGCTGGGTGTGGTGG - Intronic
948948961 2:241236573-241236595 TGGGCCTTGGCGGGGGGTGGAGG + Intronic
1168924941 20:1571689-1571711 TGGGCTTGGGCTGGGTGTGAGGG + Intronic
1168932609 20:1636157-1636179 TGGGCTTGGGCTGGGTGTGAGGG + Intronic
1169156029 20:3330526-3330548 TCTGCTTTTGCTGGGTGTGGTGG - Intronic
1169250197 20:4054707-4054729 TGAGTTTAGGCTGGGTGTGGTGG + Intergenic
1169574496 20:6943155-6943177 TTGATTTTGGCTGGGTGTGGTGG + Intergenic
1169736292 20:8840967-8840989 TGTATTTTGGTTGGGTGTGGTGG - Intronic
1170027101 20:11900996-11901018 TGGACTTTGGCCGGGTGCGGTGG - Intronic
1170061462 20:12263914-12263936 TGAGCATTGGCTGGATGTGGTGG - Intergenic
1170150238 20:13220882-13220904 GGGGCTGTGGGTGGGTGGGGTGG - Intergenic
1170225719 20:13990250-13990272 TGTACTTGGGAAGGGTGTGGGGG - Intronic
1170707014 20:18753318-18753340 TTGACATTGGCTGGGTGTGGTGG + Intronic
1171102697 20:22400421-22400443 GGGGCTTGGGGTGGGGGTGGAGG - Intergenic
1171290038 20:23977904-23977926 TGATTTTTGGCTGGGTGTGGTGG - Intergenic
1172053062 20:32134100-32134122 GGGTCTTGGGCTGGGTGTGGTGG - Intronic
1172206831 20:33168247-33168269 TGGTCTTTGGAAGGCTTTGGGGG + Intronic
1172296860 20:33818371-33818393 TGGGCATTGGATGGGTGGCTGGG - Intronic
1172527095 20:35606449-35606471 TGGGCTTTGGATTGGAGTTTAGG - Intergenic
1172651456 20:36505485-36505507 TGGTTTTAGGCTGGGTGTGGTGG + Intronic
1172728133 20:37063359-37063381 TGCCATTTGGCTGGGTGTGGTGG + Intronic
1173080189 20:39859232-39859254 TAGGCTGTGTGTGGGTGTGGTGG - Intergenic
1173708128 20:45129158-45129180 TGATCTTTGGCTGGGCGTGGTGG + Intergenic
1173761455 20:45564382-45564404 TGGGCATGGGCTGGGTGCGGTGG + Intronic
1174034570 20:47660718-47660740 AGGGCTTTGGAAGGCTGAGGTGG - Intronic
1174228285 20:49022826-49022848 TGTGCCTTGACTGGGTGTGGTGG + Intronic
1174481165 20:50832543-50832565 TGTGTTGTGGATGAGTGTGGTGG - Intronic
1174500770 20:50982391-50982413 TGGGGTGGGGATGGGTGGGGGGG - Intergenic
1174531858 20:51220528-51220550 TAGGCTTTGGGTGGGGGTTGGGG - Intergenic
1175106654 20:56619930-56619952 TAGTTTTTGGCTGGGTGTGGTGG - Intergenic
1175223771 20:57433131-57433153 TGGGCCAGGGCTGGGTGTGGCGG + Intergenic
1175268264 20:57715412-57715434 TGGGATTTGGATGTGTTTGTGGG - Intergenic
1175669527 20:60890101-60890123 TGGGCTTGGGGGGTGTGTGGGGG - Intergenic
1176222657 20:63977397-63977419 TGGGCAGTGGCTGTGTGTGGGGG + Exonic
1176271085 20:64235746-64235768 TGACCCTTGGATGGCTGTGGTGG + Intronic
1176373535 21:6076412-6076434 AGGACTTGGGCTGGGTGTGGTGG + Intergenic
1177728973 21:25004151-25004173 GTGACTTTGGCTGGGTGTGGTGG + Intergenic
1178569728 21:33724980-33725002 TGACATTTGGCTGGGTGTGGTGG + Intronic
1178639899 21:34337368-34337390 TGGGCTTTGAAGTGGTGAGGGGG + Intergenic
1179013197 21:37572597-37572619 TGGGATTTGGCAGGGCGTGGTGG - Intergenic
1179749942 21:43461831-43461853 AGGACTTGGGCTGGGTGTGGTGG - Intergenic
1179901185 21:44395660-44395682 GAGGCTGTGGAGGGGTGTGGAGG + Intronic
1179901189 21:44395670-44395692 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901204 21:44395719-44395741 AGGGCTGTGGAGGGATGTGGAGG + Intronic
1179901210 21:44395738-44395760 GAGGCTGTGGAGGGGTGTGGAGG + Intronic
1179901214 21:44395748-44395770 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901229 21:44395797-44395819 AGGGCTGTGGAGGGATGTGGAGG + Intronic
1179901235 21:44395816-44395838 GAGGCTGTGGAGGGGTGTGGAGG + Intronic
1179901239 21:44395826-44395848 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901275 21:44395942-44395964 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901290 21:44395991-44396013 AGGGCTGTGGAGGGATGTGGAGG + Intronic
1179901296 21:44396010-44396032 GAGGCTCTGGAGGGGTGTGGAGG + Intronic
1179901305 21:44396039-44396061 GAGGCTGTGGAGGGGTGTGGAGG + Intronic
1179901311 21:44396059-44396081 AGGGCTGTGGAGGGATGTGGAGG + Intronic
1179901317 21:44396078-44396100 GAGGCTGTGGAGGGGTGTGGAGG + Intronic
1179901335 21:44396136-44396158 GAGGCTGTGGAGGGGTGTGGAGG + Intronic
1179901341 21:44396155-44396177 GAGGCTGTGGAGGGGTGTGGAGG + Intronic
1179901347 21:44396174-44396196 GAGGCTGTGGAGGGGTGTGGAGG + Intronic
1179901353 21:44396193-44396215 GAGGCTGTGGAGGGGTGTGGAGG + Intronic
1179901359 21:44396212-44396234 GAGGCTGTGGAGGGGTGTGGAGG + Intronic
1179901363 21:44396222-44396244 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901370 21:44396242-44396264 AGGGCTGTGGAGGGGTGTGGAGG + Intronic
1179901374 21:44396252-44396274 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901380 21:44396272-44396294 AGGGCTGTGGAGGGATGTGGAGG + Intronic
1179901389 21:44396301-44396323 GAGGCTGTGGAGGGGTGTGGAGG + Intronic
1179901401 21:44396340-44396362 AGGGCTGTGGAGGGATGTGGAGG + Intronic
1179901405 21:44396350-44396372 AGGGATGTGGAGGGGTGTGGAGG + Intronic
1179901409 21:44396360-44396382 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901413 21:44396370-44396392 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901419 21:44396390-44396412 AGGGCTGTGGAGGGATGTGGAGG + Intronic
1179901427 21:44396420-44396442 AGGGCTGTGGAGGGATGTGGAGG + Intronic
1179901433 21:44396439-44396461 GAGGCTGTGGAGGGGTGTGGAGG + Intronic
1179901437 21:44396449-44396471 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901441 21:44396459-44396481 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901456 21:44396516-44396538 GAGGCTGTGGAGGGGTGTGGAGG + Intronic
1179901462 21:44396535-44396557 GAGGCTGTGGAGGGGTGTGGAGG + Intronic
1179901484 21:44396612-44396634 GAGGCTGTGGAGGGGTGTGGAGG + Intronic
1179901491 21:44396632-44396654 AGGGCTGTGGAGGGGTGTGGAGG + Intronic
1179901495 21:44396642-44396664 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901501 21:44396661-44396683 GAGGCTGTGGAGGGGTGTGGAGG + Intronic
1179901508 21:44396681-44396703 AGGGTTGTGGAGGGGTGTGGAGG + Intronic
1179901512 21:44396691-44396713 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901518 21:44396710-44396732 GAGGCTGTGGAGGGGTGTGGAGG + Intronic
1179901528 21:44396740-44396762 AGGGATGTGGAGGGGTGTGGAGG + Intronic
1179901532 21:44396750-44396772 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901536 21:44396760-44396782 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901542 21:44396779-44396801 GAGGCTGTGGAGGGGTGTGGAGG + Intronic
1179901549 21:44396799-44396821 AGGGATGTGGAGGGGTGTGGAGG + Intronic
1179901553 21:44396809-44396831 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901559 21:44396828-44396850 GAGGCTGTGGAGGGGTGTGGAGG + Intronic
1179901566 21:44396848-44396870 AGGGATGTGGAGGGGTGTGGAGG + Intronic
1179901573 21:44396868-44396890 AGGGCTGTGGAGGGGTGTGGAGG + Intronic
1179901580 21:44396888-44396910 AGGGCTGTGGAGGGGTGTGGAGG + Intronic
1179901584 21:44396898-44396920 AGGGGTGTGGAGGGGTGTGGAGG + Intronic
1179901590 21:44396908-44396930 AGGGGTGTGGAGGGGTGTGGGGG + Intronic
1180000754 21:44994226-44994248 TGGGCTGTGAGGGGGTGTGGAGG + Intergenic
1180086755 21:45511006-45511028 TGGGGTGTGGATGTGTGGGGGGG - Intronic
1180542366 22:16461846-16461868 GAGGCTTTGGCTGGGCGTGGTGG - Intergenic
1180565321 22:16658884-16658906 TGGCATTTTGATGGGTGGGGTGG + Intergenic
1180632584 22:17239947-17239969 TAGAGTTTGGCTGGGTGTGGTGG + Intergenic
1180738541 22:18036742-18036764 TGGGCTTTGAATGGGAAAGGGGG - Intergenic
1180763891 22:18231604-18231626 AGGGTTTTGGCCGGGTGTGGTGG + Intergenic
1180767396 22:18353133-18353155 TGATTTTTGGCTGGGTGTGGTGG + Intergenic
1180771754 22:18392938-18392960 AGGGTTTTGGCCGGGTGTGGTGG - Intergenic
1180778911 22:18509250-18509272 TGATTTTTGGCTGGGTGTGGTGG - Intergenic
1180803133 22:18642552-18642574 AGGGTTTTGGCCGGGTGTGGTGG - Intergenic
1180811634 22:18766567-18766589 TGATTTTTGGCTGGGTGTGGTGG - Intergenic
1181197788 22:21200818-21200840 TGATTTTTGGCTGGGTGTGGTGG - Intergenic
1181218584 22:21352708-21352730 AGGGTTTTGGCCGGGTGTGGTGG + Intergenic
1181401955 22:22654991-22655013 TGATTTTTGGCTGGGTGTGGTGG + Intergenic
1181532338 22:23523944-23523966 TGGGGGTGGGATGGGGGTGGCGG - Intergenic
1181636677 22:24177874-24177896 GGGGCCTAGGATGGGGGTGGGGG + Intronic
1181647593 22:24242102-24242124 TGATTTTTGGCTGGGTGTGGTGG - Intronic
1181673937 22:24439888-24439910 AGGGCTGTGGGTGGGTTTGGAGG + Intronic
1181703910 22:24636081-24636103 TGATTTTTGGCTGGGTGTGGTGG + Intergenic
1182075569 22:27493199-27493221 TGGGATGTGGGTGGGGGTGGGGG + Intergenic
1182290257 22:29271929-29271951 TGGGATTGGGATGGGTTTTGTGG + Intronic
1182403490 22:30102915-30102937 TGGGTTTAGGCCGGGTGTGGTGG - Intronic
1182417057 22:30228209-30228231 TGAGTTGTGGCTGGGTGTGGTGG + Intergenic
1182544892 22:31069340-31069362 TGAGCTTGGGGTGGGTGAGGTGG - Intronic
1182577683 22:31284189-31284211 AGGGATTAGGCTGGGTGTGGTGG - Intronic
1182667016 22:31967443-31967465 TGGGCCATGGCTGGGCGTGGTGG - Intergenic
1183268269 22:36844352-36844374 TGGGATGTGGATGGCTGAGGAGG - Intergenic
1183343922 22:37296510-37296532 GGGGCTTGGGAGTGGTGTGGGGG - Intronic
1183413277 22:37667804-37667826 TGTGCTTAGGCTGGGTGTGGTGG - Intergenic
1183465960 22:37980568-37980590 TGGGCTTGGGGTTGGGGTGGAGG - Intronic
1183467717 22:37988034-37988056 TGGGCCTTGGTTGGGTGTGGTGG + Intronic
1183517894 22:38278020-38278042 TTGGCTTTGGCTGGGTGTGGTGG - Intergenic
1183532080 22:38362992-38363014 TGAGACTTGGCTGGGTGTGGTGG - Intronic
1183747640 22:39700768-39700790 TGGGATGTGGGTGGGAGTGGTGG - Intergenic
1183905616 22:41038043-41038065 TGGTCTTAGGCTGGGTGCGGTGG - Intergenic
1184533774 22:45072671-45072693 AGGCCTGGGGATGGGTGTGGGGG - Intergenic
1184951963 22:47849543-47849565 TGGGGTTTGGACGGCTGTGCTGG + Intergenic
1185013280 22:48328341-48328363 TGGGCTTTGGCCGGGTGTGTTGG - Intergenic
1203229017 22_KI270731v1_random:94016-94038 TGATTTTTGGCTGGGTGTGGTGG + Intergenic
1203233591 22_KI270731v1_random:133929-133951 AGGGTTTTGGCCGGGTGTGGTGG - Intergenic
949325871 3:2863681-2863703 TGGGGGTTAGATGGTTGTGGTGG + Intronic
949506971 3:4737554-4737576 AGGGCCTTGGATGGGGGTTGGGG + Intronic
950002292 3:9666418-9666440 TGGGCATTGGCCAGGTGTGGTGG - Intronic
950238259 3:11342471-11342493 GGGACTTGCGATGGGTGTGGAGG - Intronic
950340683 3:12241358-12241380 GGGGCTTTGGAAGGTTGAGGTGG - Intergenic
950681766 3:14590077-14590099 TGGTGTTTAGCTGGGTGTGGTGG - Intergenic
951591790 3:24273792-24273814 TGGGTTTTTGAGGGGTGGGGGGG - Intronic
952141263 3:30481197-30481219 TGGGATTTGGAAGGGTCTGGGGG + Intergenic
952158224 3:30666921-30666943 TGACCTTAGGCTGGGTGTGGTGG - Intronic
952338557 3:32425856-32425878 TGGGATTTGGCTGGGTGTGGTGG + Intronic
952392502 3:32892188-32892210 AGGGCACTGGATGTGTGTGGTGG + Exonic
952439457 3:33311062-33311084 TAGAATTTGGCTGGGTGTGGTGG - Intronic
953333628 3:42075186-42075208 TGAGGTCTGGCTGGGTGTGGTGG + Intronic
953507849 3:43503974-43503996 TGGGGATTGGCTGGGTGTGGTGG + Intronic
953603582 3:44391475-44391497 AATGCTTTGGCTGGGTGTGGTGG - Intronic
953715278 3:45312302-45312324 TTGGGTTAGGATGGGGGTGGTGG + Intergenic
953741643 3:45543749-45543771 TGGGCTGGGGCTGGGTGCGGTGG - Intronic
954075865 3:48179652-48179674 TGATCTCTGGCTGGGTGTGGTGG - Intronic
954105837 3:48409532-48409554 TGGGCTCTAGGTGTGTGTGGGGG - Intronic
954110625 3:48430897-48430919 TGGGGTGGTGATGGGTGTGGGGG - Intergenic
954143750 3:48623835-48623857 GGGGCTGCGGTTGGGTGTGGGGG - Intergenic
954369130 3:50161087-50161109 TGGGCTGGGGAGGGGTTTGGGGG - Intronic
955262347 3:57406061-57406083 TGGGCTTGGGCTGGGCGCGGTGG + Intronic
955271703 3:57506031-57506053 TAAGGTTTGGCTGGGTGTGGTGG - Intronic
955338449 3:58106442-58106464 TAGGCCTGGGCTGGGTGTGGTGG - Intronic
955338588 3:58107317-58107339 TAGGCCTGGGCTGGGTGTGGAGG - Intronic
955683386 3:61525952-61525974 AGTGCTTTGGAAGGGTGAGGTGG - Intergenic
956143165 3:66165933-66165955 TGGGGTTGGGATGGGGGTGGTGG - Intronic
956187887 3:66579805-66579827 AGTGATTTGGCTGGGTGTGGTGG + Intergenic
956438134 3:69254394-69254416 TGGGTTTTGGCTGGGTACGGTGG - Intronic
956863036 3:73343019-73343041 TGGGCTGTGTCTGTGTGTGGTGG - Intergenic
956975428 3:74573314-74573336 TTGGCATGGGATGGGAGTGGGGG - Intergenic
957167880 3:76698404-76698426 TGGTCTCTGGAAGGGGGTGGGGG + Intronic
958263359 3:91408312-91408334 TGTACGTTGGCTGGGTGTGGTGG - Intergenic
959102707 3:102031291-102031313 TTGGATTTGGCTGGGTTTGGCGG + Intergenic
959595481 3:108124600-108124622 AAGGCTTAGCATGGGTGTGGAGG + Intergenic
959993641 3:112656588-112656610 TGGCATTGGGATGGGTGTGGTGG - Intergenic
960011755 3:112841660-112841682 TGGGCCTTGGGTGGGGCTGGTGG - Intronic
960111888 3:113852869-113852891 AGGGCTTAGGGTGGGAGTGGGGG + Intronic
961093459 3:124135547-124135569 TGTTCTTTGAAAGGGTGTGGGGG + Intronic
961424890 3:126837275-126837297 TGGGTTTAGCCTGGGTGTGGTGG + Intronic
961695980 3:128704883-128704905 ATGGCTTTGGCTGGGTGTGGTGG - Intergenic
961703578 3:128766047-128766069 TGGGGCCTGGCTGGGTGTGGTGG - Intronic
961748306 3:129080284-129080306 CTGGCTTTGGCTGAGTGTGGTGG + Intergenic
961929549 3:130518171-130518193 TTGCCAGTGGATGGGTGTGGGGG + Intergenic
961932981 3:130553809-130553831 TGTCCTTTGAATGGGTGTTGCGG + Intergenic
962273101 3:133992600-133992622 TGGGCTCAGGATGGGGGTGCAGG - Intronic
962610836 3:137074780-137074802 TGGACTGAGGCTGGGTGTGGTGG + Intergenic
963751327 3:149182570-149182592 TGGGGTGGGGATGGGAGTGGGGG + Intronic
963780489 3:149481497-149481519 TAGGCTTGGGAAGGGAGTGGGGG - Intronic
963933133 3:151024908-151024930 AGTGCCTTGTATGGGTGTGGTGG - Intergenic
963939748 3:151086509-151086531 TGGGCGCAGGATGGGGGTGGGGG - Intronic
964187450 3:153963938-153963960 TTGGCTGGGGCTGGGTGTGGTGG - Intergenic
964363199 3:155920364-155920386 TGGTCTGTGGACCGGTGTGGTGG + Intronic
964660694 3:159117140-159117162 TGGGCTTTAGTTGGGGGTTGTGG - Intronic
964665688 3:159169575-159169597 TGGGCTTTGGCAGGGTGCGGTGG - Intronic
964717420 3:159737019-159737041 TGGTCTTTGGCCGGGCGTGGTGG - Intronic
965373840 3:167897456-167897478 TGGGTGTAGGCTGGGTGTGGTGG - Intergenic
965545885 3:169915863-169915885 AGGGCTCAGGCTGGGTGTGGTGG - Intronic
965607991 3:170515606-170515628 TGGGGTTAGGATGTGTGTTGGGG + Intronic
965804528 3:172528432-172528454 TAGGATTTGGCTGGGCGTGGTGG - Intergenic
966165418 3:177011081-177011103 ATGGTTTTGGCTGGGTGTGGTGG + Intergenic
966331988 3:178824659-178824681 TGAGATTTGGCCGGGTGTGGTGG - Intronic
966514711 3:180806031-180806053 TGTGATTTGGATGGGTCTTGGGG - Intronic
966613968 3:181894791-181894813 TGGGCTTTGGCCTGGCGTGGTGG - Intergenic
966780812 3:183582466-183582488 TTGGCTTTCGATGTGTGGGGAGG - Intergenic
966788144 3:183638911-183638933 TAGGCTTTGGCTGGGTGCGGTGG + Intronic
967063756 3:185895818-185895840 TTCGATTTGGCTGGGTGTGGTGG - Intergenic
967789791 3:193535064-193535086 TGGCTTTTAGCTGGGTGTGGTGG - Intronic
967807357 3:193727697-193727719 TGTGGTTGGGATGGGGGTGGCGG + Intergenic
967919463 3:194603683-194603705 TTGGTGTTGGCTGGGTGTGGTGG - Intronic
968292964 3:197553241-197553263 AGAGTTTTGGCTGGGTGTGGTGG + Intronic
968655873 4:1778281-1778303 GGGGCTCTGGCTGGGGGTGGGGG - Intergenic
969289507 4:6229729-6229751 TGGGGTTGGGATGGGGATGGAGG - Intergenic
969483804 4:7460482-7460504 TGGGCTTGGGAAAGCTGTGGGGG - Intronic
969585682 4:8090116-8090138 TGGGCAGTGGATGGGAGGGGAGG - Intronic
969605508 4:8200297-8200319 TGGGTTTAGGATGGGTATGTGGG + Intronic
969670793 4:8589156-8589178 CTGGTTTTGGCTGGGTGTGGTGG - Intronic
970617115 4:17778601-17778623 TGAGCTTTGGAAGGTTGAGGCGG + Intronic
970695864 4:18676221-18676243 TGGGTTTTGGAAGGGTGGAGGGG + Intergenic
971295549 4:25386495-25386517 TGAGCTTCGGCTGGGTATGGTGG - Intronic
971319094 4:25590951-25590973 TGGGCAACGGCTGGGTGTGGTGG - Intergenic
972259106 4:37390075-37390097 TATGATTTGGCTGGGTGTGGTGG - Intronic
972560808 4:40226869-40226891 GGAGCTGTGGCTGGGTGTGGTGG + Intronic
972582102 4:40404095-40404117 CTGGCTTTGGCTGGGCGTGGTGG - Intergenic
972749453 4:41973675-41973697 TGGATTTTGGATTTGTGTGGGGG + Intergenic
973062344 4:45743077-45743099 TAATCTATGGATGGGTGTGGTGG + Intergenic
973118740 4:46491757-46491779 TGGGCGTGAGATGGGTGGGGAGG - Intergenic
973871428 4:55170485-55170507 TGTGCAGTGGCTGGGTGTGGTGG - Intergenic
974083977 4:57239945-57239967 TGAGCATGGGCTGGGTGTGGTGG - Intergenic
974967451 4:68779157-68779179 TGGGCTGTGTGTGTGTGTGGGGG + Intergenic
975074460 4:70187723-70187745 TGGGCTTAGAATGTGTGTGAAGG + Intergenic
975347244 4:73306217-73306239 AGGTGTTTGGCTGGGTGTGGTGG + Intergenic
975976103 4:80098396-80098418 TAGGATTTGGCTGGGCGTGGTGG + Intronic
976104536 4:81602595-81602617 TGCCATTGGGATGGGTGTGGAGG + Intronic
976881040 4:89925542-89925564 TGGTTTTAGGCTGGGTGTGGTGG + Intronic
977247040 4:94644827-94644849 TTGGCATGGGCTGGGTGTGGTGG - Intronic
977465639 4:97380717-97380739 TGGAATGGGGATGGGTGTGGGGG + Intronic
977608784 4:99011651-99011673 TGAGCTTGGGCTGGGCGTGGTGG + Intronic
978074903 4:104516321-104516343 TTAGTTTTGGCTGGGTGTGGTGG + Intergenic
978303857 4:107300573-107300595 TGGGCTTTGACCGAGTGTGGTGG + Intergenic
978792466 4:112676967-112676989 AAGGTTTTGGCTGGGTGTGGTGG + Intergenic
979534745 4:121807003-121807025 TGGATTTTGGCTGGGCGTGGTGG + Intronic
979688991 4:123540884-123540906 TGGGGTTTGGCTGGGTGCGGTGG + Intergenic
980354368 4:131724148-131724170 TGGGTTTTGGCTGGGTGCAGCGG + Intergenic
980354906 4:131726654-131726676 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
980355446 4:131729131-131729153 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
980355992 4:131731632-131731654 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
980356524 4:131734120-131734142 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
980357062 4:131736608-131736630 TGGGTTTTGGCTGGGTGCAGCGG + Intergenic
980358143 4:131741589-131741611 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
980359215 4:131746556-131746578 TGGGTTTTGGCTGGGTGCAGCGG + Intergenic
980359757 4:131749024-131749046 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
980360297 4:131751519-131751541 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
980360837 4:131753991-131754013 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
980361380 4:131756474-131756496 TGGGTTTTGGTTGGGTGCAGCGG + Intergenic
980361920 4:131758946-131758968 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
980362463 4:131761429-131761451 TGGGTTTTGGCTGGGTGCAGCGG + Intergenic
980363007 4:131763912-131763934 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
980378282 4:131977080-131977102 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
981018490 4:140000738-140000760 TTGGCCTTGGCTGGGTGCGGTGG + Intronic
982264838 4:153528769-153528791 AGGGATTTGGTTGGGGGTGGGGG + Intronic
983295852 4:165868159-165868181 TGGGCTTTAGCTGGGGATGGAGG + Intergenic
983397839 4:167224950-167224972 AAAGTTTTGGATGGGTGTGGTGG - Intronic
983587166 4:169368368-169368390 TGTGTTTTAGCTGGGTGTGGTGG + Intergenic
983597506 4:169487315-169487337 GGGGCTTTTGAGGGATGTGGAGG - Intronic
984457403 4:179987614-179987636 TCAGCTTTGGCCGGGTGTGGTGG - Intergenic
984736658 4:183114972-183114994 TGGGGATTAGCTGGGTGTGGTGG - Intronic
984818076 4:183857001-183857023 AGGGGTTTGGAGGGGTTTGGAGG + Intronic
985616363 5:924476-924498 TGGGTTTTGGGTGGCAGTGGGGG + Intergenic
985708989 5:1417693-1417715 TGGGCCTTGGATGGGGGAGAAGG + Intronic
985942631 5:3150779-3150801 TGGGCATTTGCTGAGTGTGGTGG + Intergenic
986344129 5:6818668-6818690 TGGGCTTTGGTTGGGTGATTGGG + Intergenic
986507337 5:8466082-8466104 TGGGCTTTGGTTGGGTGAATTGG - Intergenic
986745507 5:10741061-10741083 TTGGCTGTAGCTGGGTGTGGTGG + Intronic
987032941 5:13992255-13992277 TGGGATTAGGATGCTTGTGGAGG - Intergenic
987427391 5:17788975-17788997 AGAGCTTGGGCTGGGTGTGGTGG + Intergenic
987999948 5:25335082-25335104 AGGGCTTTGGGTTGGTGTGGGGG + Intergenic
988511600 5:31869058-31869080 TGACCTTTGGCTGGGTATGGTGG - Intronic
988588814 5:32531078-32531100 TGGGCTCTTGCTGGGCGTGGTGG - Intergenic
988788617 5:34586640-34586662 AGGACTTTGGATGGCTGAGGCGG + Intergenic
989095107 5:37774692-37774714 TGGCCCTTGGCTGGGTGTAGTGG - Intergenic
989146193 5:38252388-38252410 TGGGCTTTGGCTGGATGCAGTGG - Intergenic
989397193 5:40970501-40970523 GGTGCTTTAGCTGGGTGTGGTGG + Intronic
989802376 5:45559046-45559068 TGGGTGTAGGCTGGGTGTGGTGG - Intronic
990334328 5:54757120-54757142 TGGGTATGGGATGGGTGAGGTGG + Intergenic
990903161 5:60775049-60775071 AGAGTTTTGGCTGGGTGTGGTGG - Intronic
991399153 5:66235644-66235666 GGGCTTTTGGCTGGGTGTGGTGG - Intergenic
991670118 5:69038835-69038857 TGGGCCATGGATTGGTATGGTGG - Intergenic
991693882 5:69251383-69251405 GGGGCATTGGCTGGGTGCGGCGG - Intronic
992090525 5:73312230-73312252 TGGGAGTGGGATGGGGGTGGGGG + Intergenic
992217381 5:74539291-74539313 TTGCCTTTGGCTGGGTGTGGTGG - Intergenic
992237912 5:74731098-74731120 GGGGCTTTGGCCGGGTGCGGTGG - Intronic
992260416 5:74964987-74965009 TGGTCTCTGGATGTCTGTGGAGG + Intergenic
992833396 5:80617303-80617325 TTAGCTTTGGCTGGGCGTGGTGG - Intergenic
993121466 5:83779662-83779684 TGGGGTTTCACTGGGTGTGGTGG + Intergenic
993470103 5:88296899-88296921 TGAGATTAGGAAGGGTGTGGTGG + Intergenic
993603286 5:89955427-89955449 TGGACTTGGGGTGGGGGTGGCGG - Intergenic
993769870 5:91913992-91914014 TTGGATTTTGATGTGTGTGGGGG + Intergenic
994036558 5:95208376-95208398 TGGCAGTTGGCTGGGTGTGGTGG - Intronic
994683298 5:102917019-102917041 AGGCCTGTGGCTGGGTGTGGTGG - Intronic
995607158 5:113869336-113869358 ATGGATTTGGCTGGGTGTGGTGG - Intergenic
995707930 5:115004461-115004483 TGGCCTTGGGATGGAGGTGGCGG - Intergenic
995872695 5:116759528-116759550 TTGACTTTGGCTGGGTGCGGTGG + Intergenic
996133175 5:119807236-119807258 TGGGTTGTGGCTGGGTGCGGTGG - Intergenic
996757253 5:126947872-126947894 TGGGTTTGGGAGGGGTGGGGGGG + Intronic
996852119 5:127964700-127964722 TGCTCTTAGGCTGGGTGTGGTGG - Intergenic
997035919 5:130191072-130191094 TGAGCTTTGTATTGGGGTGGTGG - Intergenic
997460754 5:134050800-134050822 TTGGCTTTGGGCGAGTGTGGTGG + Intergenic
998096867 5:139400868-139400890 TTGGTTTTGGCTGGGTGCGGTGG + Intronic
998103274 5:139451723-139451745 TGTGGTTTGGGTGGGTGTGTGGG + Intronic
998252136 5:140560594-140560616 GGGGCTTTGGAGGGGTGAGCAGG - Intronic
998369676 5:141652846-141652868 TGGTCTTTGGATGGGTGGATGGG - Intergenic
998463984 5:142328453-142328475 GGGTCTTTGGCTGGGTGCGGTGG + Intergenic
998478625 5:142442728-142442750 TGGGATCAGGCTGGGTGTGGTGG - Intergenic
998491121 5:142547237-142547259 TTGGCTTTGGCCGGGCGTGGTGG - Intergenic
999075464 5:148791402-148791424 AGGGCTGTGGATGTGGGTGGGGG - Intergenic
999535640 5:152513709-152513731 TGGTCATTGGCTGGATGTGGTGG - Intergenic
999571697 5:152926184-152926206 TGGGTTTTGAATGTGTGAGGGGG + Intergenic
1000266491 5:159642736-159642758 TGGGCTTAGGGTGGGAGTGAGGG - Intergenic
1000367493 5:160505164-160505186 TGGGGTATGTATGGGTGTGTGGG + Intergenic
1000553016 5:162690337-162690359 TGGTTCTGGGATGGGTGTGGCGG + Intergenic
1001040286 5:168329820-168329842 TGGCTTTTGGCTGGGCGTGGTGG + Intronic
1001265852 5:170274173-170274195 TGGGCCCTGGGTGGGTGTGCTGG + Intronic
1001910071 5:175508920-175508942 TATGCTCTGGCTGGGTGTGGTGG - Intronic
1002019930 5:176357016-176357038 TGCAGTTTGGATGGGTGTGGTGG + Intronic
1002112443 5:176927539-176927561 TGAAATTTGGCTGGGTGTGGTGG - Intronic
1002304365 5:178274560-178274582 TGGTGGTTGGCTGGGTGTGGGGG + Intronic
1002358902 5:178654046-178654068 TGGGTACTGGCTGGGTGTGGTGG - Intergenic
1002585200 5:180241584-180241606 TGGGTTATGGCTGGGTGCGGCGG - Intronic
1002770865 6:290010-290032 TTGGTTTTGGCTGGGCGTGGTGG - Intergenic
1003018116 6:2484749-2484771 GTGACTTTGGACGGGTGTGGTGG + Intergenic
1003360518 6:5420925-5420947 TGGGGTCTGGAGGGGTCTGGAGG + Intronic
1003698789 6:8439348-8439370 TGTGTTTGGGCTGGGTGTGGTGG - Intergenic
1003830181 6:10000894-10000916 TGCTGTTTGGCTGGGTGTGGTGG + Intronic
1003939523 6:11010307-11010329 TGTGCGCTGGCTGGGTGTGGAGG - Intronic
1004519758 6:16350793-16350815 TGGGAATTGGCTGGGTGTGGTGG + Intronic
1004770130 6:18771886-18771908 TGGGCTTTCCAGGGGTGTTGAGG + Intergenic
1005080964 6:21956278-21956300 TAAGCTTTGGCTGGGTGCGGTGG + Intergenic
1005492781 6:26361916-26361938 TGGGCTGTGGGTAGGGGTGGTGG + Intergenic
1005496946 6:26396037-26396059 TGGGCTGTGGGTAGGGGTGGTGG + Intergenic
1005690535 6:28300616-28300638 GGGGCTTGGGGTGGGTGTGGGGG - Intronic
1006296185 6:33171081-33171103 TGGGCCTTCGGTGGGGGTGGAGG + Intronic
1006366886 6:33621295-33621317 CGGGATTTGCATGTGTGTGGTGG + Exonic
1006512002 6:34526473-34526495 AGGGCTTTGGAGGGGCCTGGGGG - Intronic
1006513073 6:34532089-34532111 TGGGCCCAGGATGGGAGTGGGGG + Intronic
1006720285 6:36145643-36145665 TGGGCTTTGCCAGGGTGTTGTGG - Intergenic
1006763478 6:36484220-36484242 AAGGTTTTGGCTGGGTGTGGTGG - Intronic
1006769871 6:36543919-36543941 TGGTCCTTGGCTGGGTGCGGTGG - Intronic
1006772437 6:36564810-36564832 TGGCTTCTGGCTGGGTGTGGTGG + Intergenic
1006853649 6:37117563-37117585 TGATCCTTGGCTGGGTGTGGTGG + Intergenic
1007075588 6:39064290-39064312 TGGGTCTCGGCTGGGTGTGGTGG - Intronic
1007305316 6:40899393-40899415 TAGGCATTGGATGGGTGTATGGG - Intergenic
1007519994 6:42444621-42444643 TGGCCTTTGTAAGGGGGTGGGGG - Intronic
1007636286 6:43301708-43301730 TGGGTCTGGCATGGGTGTGGTGG + Intronic
1007711915 6:43829929-43829951 TTGCCTGTGGATGGGTGGGGTGG + Intergenic
1007790024 6:44303418-44303440 TGGGGTCTGGAGGGGTGGGGAGG + Exonic
1008615027 6:53218271-53218293 TGGGCCTTGGCTGGGTGCAGTGG - Intergenic
1008626372 6:53320608-53320630 GGGGTTTTGGCCGGGTGTGGTGG - Intronic
1008675445 6:53813271-53813293 TGTGGATTGGAGGGGTGTGGTGG + Intronic
1008880442 6:56375763-56375785 GTGGCTTGGGGTGGGTGTGGGGG + Intronic
1008992056 6:57614561-57614583 TGTACGTTGGCTGGGTGTGGTGG + Intronic
1008995089 6:57649835-57649857 TGCGTTTTGGATAGGTGTGCTGG + Intergenic
1009180671 6:60513606-60513628 TGTACGTTGGCTGGGTGTGGTGG + Intergenic
1009183624 6:60548595-60548617 TGCGTTTTGGATAGGTGTGCTGG + Intergenic
1009710197 6:67308407-67308429 TGGGCTTGTGATGGGAGGGGTGG - Intergenic
1010236622 6:73580160-73580182 TGGGCTGGGGATGGGGGTGGGGG - Intergenic
1011581984 6:88878382-88878404 TAGGTTTTGGCTGGGCGTGGTGG - Intronic
1012929633 6:105303341-105303363 TGGACTTTGGATGGGCTTGGTGG - Intronic
1013148414 6:107418482-107418504 TGTTGTTTGGTTGGGTGTGGTGG + Intronic
1013258827 6:108416948-108416970 GGGGCCTGGGCTGGGTGTGGTGG + Intronic
1013522103 6:110942792-110942814 TGGGCTTAGGCCGGGAGTGGTGG - Intergenic
1013775508 6:113674744-113674766 GGCGCTTGGGTTGGGTGTGGTGG - Intergenic
1015120783 6:129699123-129699145 AGTGCTTCGGCTGGGTGTGGTGG - Intronic
1015208243 6:130666438-130666460 TGGGCATGACATGGGTGTGGGGG + Intergenic
1015480593 6:133703801-133703823 TGGGTGTGGGCTGGGTGTGGTGG - Intergenic
1015648406 6:135422775-135422797 TGGGGGGTGGCTGGGTGTGGTGG - Intronic
1016176426 6:141082111-141082133 TGAGATTTGGAGGGGTGTGTCGG + Intergenic
1016441602 6:144089830-144089852 TAAGTTTTGGCTGGGTGTGGTGG + Intergenic
1016566162 6:145457205-145457227 CTGCCTTTGGCTGGGTGTGGCGG + Intergenic
1016882372 6:148923617-148923639 TAGGCTTTGGCTGGGTGCGGTGG + Intronic
1017112647 6:150947380-150947402 TGATTTTTGGCTGGGTGTGGTGG - Intronic
1017437351 6:154428806-154428828 TGTTCTTTGGCTGGGTGTGGTGG - Intronic
1017850953 6:158305410-158305432 TGGGTTGTTGCTGGGTGTGGTGG + Intronic
1017895835 6:158679080-158679102 TGGGATTAGGCCGGGTGTGGTGG + Intronic
1017918662 6:158853091-158853113 TGGTGTTTGTATGTGTGTGGTGG - Intergenic
1018010245 6:159663230-159663252 TGTGCTTGGGCCGGGTGTGGTGG - Intergenic
1018303301 6:162426732-162426754 TGGTTTTTGGCTGGGTATGGTGG - Intronic
1018927598 6:168217328-168217350 TGGGATTTGGGTGGGTGATGGGG + Intergenic
1019443022 7:1056850-1056872 TGTGCTTTGGCGGGGTGGGGGGG + Intronic
1019502152 7:1369701-1369723 TGGGCGATGGATCAGTGTGGGGG - Intergenic
1019734232 7:2642773-2642795 TAGACTTGGGCTGGGTGTGGTGG + Intronic
1020046167 7:5042225-5042247 TGGGTTGTGGCTGGGCGTGGTGG - Intronic
1020225237 7:6274232-6274254 TGTCCCTTGGCTGGGTGTGGTGG - Intergenic
1020255764 7:6502500-6502522 GGGGATTGGGCTGGGTGTGGTGG - Intronic
1021869229 7:24987082-24987104 TGTTTTTTGGAGGGGTGTGGAGG + Intergenic
1021988491 7:26119966-26119988 TGGGCTCTGGCAGGGTATGGTGG - Intergenic
1022051817 7:26682368-26682390 TGGGCTATTGATGGGTGTCTTGG - Intronic
1022248925 7:28587549-28587571 TGGGCTGGGGGTGGGGGTGGGGG + Intronic
1022660183 7:32359845-32359867 TGAGATTTGGATGGGTGCTGGGG - Intergenic
1022861922 7:34376465-34376487 TGGGTTTTGGACTTGTGTGGGGG + Intergenic
1023047949 7:36227973-36227995 TGGGATTAGGCCGGGTGTGGTGG - Intronic
1023847071 7:44128367-44128389 TGGACTATGTATGGGTTTGGTGG - Intergenic
1023903563 7:44504591-44504613 TGCCCTTTGGCTGGGTATGGTGG + Intergenic
1024496735 7:50056896-50056918 TAGGCCTTGGCTAGGTGTGGTGG + Intronic
1024925990 7:54616684-54616706 TGGGCTTTGTAAGGGGGAGGAGG - Intergenic
1025079938 7:55972813-55972835 TGGAATATGGCTGGGTGTGGTGG + Intronic
1025108723 7:56194667-56194689 TGCCGTTTGGCTGGGTGTGGTGG + Intergenic
1025779665 7:64589331-64589353 GAGGCTTTGGCTGGGCGTGGTGG + Intergenic
1025925223 7:65953605-65953627 TGGCATTTGGCTGGGTATGGTGG + Intronic
1026357764 7:69574218-69574240 TGGCTTTTGGCCGGGTGTGGTGG - Intergenic
1026511601 7:71031932-71031954 AGGGCTTTGGTTGGGTGTGGTGG - Intergenic
1026637545 7:72097518-72097540 TCAGCTGTGGCTGGGTGTGGTGG + Intronic
1026649647 7:72204280-72204302 TTGGCTTTGGCTGGGTGCGGTGG - Intronic
1026839171 7:73659450-73659472 TGGGCATTGGCCGGGCGTGGTGG - Intergenic
1027508641 7:79051231-79051253 TGGGCTTTGGTTGGGTGATTTGG - Intronic
1028795100 7:94893746-94893768 TGGGCCTCGGCCGGGTGTGGTGG - Intergenic
1029213631 7:98929225-98929247 TGGGCGTGGGCTGGGTGTGGTGG - Intronic
1029300460 7:99578992-99579014 TTAGCTATGGCTGGGTGTGGTGG + Intronic
1029433573 7:100548305-100548327 TGGGGGTTGGAGGGGGGTGGTGG + Intronic
1029544459 7:101202936-101202958 CAGGCTTTGGCTGGGTGCGGTGG - Intergenic
1029669160 7:102017014-102017036 TTAGCTTGGGCTGGGTGTGGTGG + Intronic
1030088403 7:105836771-105836793 TAGGTTTAGGCTGGGTGTGGTGG + Intronic
1030239330 7:107303726-107303748 TTACCTTTGGCTGGGTGTGGTGG - Intronic
1030999359 7:116396883-116396905 TGGGAATAGGCTGGGTGTGGTGG - Intronic
1033128278 7:138723811-138723833 AGGGCCCTGGCTGGGTGTGGTGG - Intronic
1033331836 7:140423150-140423172 TGGTCCTTGGCTGGGCGTGGTGG + Intronic
1033420986 7:141204404-141204426 TGGACTTGGGAAGGGAGTGGAGG + Intronic
1033646535 7:143309128-143309150 ACAGCTTTGGTTGGGTGTGGTGG - Intergenic
1034029976 7:147750749-147750771 CAGGCTTTGGCTGGGTGCGGCGG + Intronic
1034066375 7:148140707-148140729 GGGGCCTGGGCTGGGTGTGGTGG - Intronic
1034259699 7:149747113-149747135 TGGGTGTTGGGTGGGGGTGGGGG + Intergenic
1034432916 7:151049889-151049911 TGGGCTTTGGTGGGGATTGGCGG + Intronic
1035329142 7:158085094-158085116 ATGGGTGTGGATGGGTGTGGTGG - Intronic
1035329153 7:158085132-158085154 GAGGGTGTGGATGGGTGTGGTGG - Intronic
1035392739 7:158516230-158516252 AGGGCTTTGGAAGGCTGAGGTGG + Intronic
1035830099 8:2686519-2686541 TTAGTTTTGGCTGGGTGTGGTGG + Intergenic
1036462863 8:8969539-8969561 TGGAACTTGGTTGGGTGTGGTGG + Intergenic
1036798804 8:11774523-11774545 TGTGCTTTGGAAGGGCCTGGGGG - Intronic
1037800017 8:22027892-22027914 GAGGATTTGGCTGGGTGTGGTGG - Intronic
1038491620 8:27976004-27976026 TGGGACATGGATGGGGGTGGAGG - Intronic
1038578282 8:28724478-28724500 TAGTCCTTGGCTGGGTGTGGTGG + Intronic
1038658426 8:29475341-29475363 TGGGCCTAGGCTGGGCGTGGTGG + Intergenic
1038903566 8:31871675-31871697 TGGGGTTTTGATGGGTTTTGTGG - Intronic
1039067577 8:33622362-33622384 GGGGTTATGGCTGGGTGTGGTGG + Intergenic
1039226800 8:35397191-35397213 TGGGCTTGGGCTGGGCGTGGTGG - Intronic
1039597106 8:38799878-38799900 TGTACTTTGGATGTGTGTGCTGG + Intronic
1039672726 8:39620852-39620874 AGAGATTTGGATGGGTGAGGAGG + Intronic
1039701357 8:39965196-39965218 TGGGTTTAGGCTGGGTGTGGTGG + Intronic
1039714467 8:40092713-40092735 TGGGCAGAGGCTGGGTGTGGTGG + Intergenic
1039991304 8:42490308-42490330 TGGATTTTGGCTGGGTGTGGTGG + Intronic
1039991959 8:42496035-42496057 TGGGATCTGGCCGGGTGTGGTGG - Intronic
1041056384 8:53990649-53990671 GGGTTTTTGGCTGGGTGTGGTGG - Intronic
1042148582 8:65757902-65757924 TTGGAGTTGGCTGGGTGTGGTGG - Intronic
1042305647 8:67328978-67329000 TGGACTTTGGAAGGTTGAGGCGG + Intronic
1043055760 8:75435879-75435901 TGTTTTTTGGCTGGGTGTGGTGG - Intronic
1043161657 8:76854233-76854255 TGGGCTGTGGATGCCTGTGGTGG - Exonic
1044595516 8:93954857-93954879 TCTGCCTTGGCTGGGTGTGGTGG + Intergenic
1044972293 8:97631932-97631954 TGGTCATTGGCTGGGCGTGGTGG - Intergenic
1045131025 8:99152887-99152909 TGAGTTTTGGCTGGGTGTGGTGG + Intronic
1045205976 8:100041199-100041221 TAGGCTTTGGCTGGGTGCGGTGG + Intronic
1045396188 8:101762857-101762879 TAGGCCTTGGCTGGGCGTGGTGG - Intronic
1046441990 8:114268308-114268330 TGAGTTTTGGCTGGGCGTGGTGG - Intergenic
1046652145 8:116847848-116847870 TGGGGTGGGGATGGGGGTGGTGG + Intronic
1047729449 8:127714847-127714869 TTGGATTTGGCTGGGTGTGGTGG - Intergenic
1047729480 8:127715046-127715068 TTGGATTTGGCTGGGTGTGGTGG - Intergenic
1047747824 8:127858101-127858123 TGGTCTTAGGCTGGGTGTGGTGG + Intergenic
1048048805 8:130797821-130797843 TTGCCCTGGGATGGGTGTGGGGG - Intronic
1048341317 8:133540642-133540664 AGGGCATAGCATGGGTGTGGTGG - Intronic
1049144061 8:140984719-140984741 GGGACTGAGGATGGGTGTGGAGG - Intronic
1049317205 8:141975583-141975605 AGGGGTTTGGGTGGGTGGGGGGG + Intergenic
1049360854 8:142212008-142212030 TGGGATGTGGATGGGAATGGAGG - Intergenic
1049395468 8:142398223-142398245 TGCGCTTTGGGAGGGTTTGGGGG - Intronic
1049395527 8:142398403-142398425 TGTGCTTTGGGAGGGTTTGGGGG - Intronic
1049437520 8:142594625-142594647 GGGGCTTTGTAGGTGTGTGGAGG + Intergenic
1049558307 8:143294800-143294822 GGGGCCATGGCTGGGTGTGGTGG + Intronic
1049926789 9:417005-417027 TGGGTTTTGGCTCGGTGTGGTGG + Intronic
1050227015 9:3470613-3470635 TGGGCTTTGGCCCGGTGCGGTGG - Intronic
1050248961 9:3723199-3723221 TGTGATTTGGCTGGGCGTGGTGG - Intergenic
1050410026 9:5354100-5354122 TGGTCTTTGGATTGGGTTGGTGG + Intergenic
1050423727 9:5492942-5492964 TAGAATTTGGCTGGGTGTGGTGG - Intergenic
1050454229 9:5817475-5817497 TAGGCTCTGGCCGGGTGTGGTGG - Intronic
1050514694 9:6430681-6430703 TGGGCTTTGGATTGTAGGGGTGG - Intronic
1050558915 9:6813314-6813336 TGGGCATGGGATGGGCATGGTGG - Intronic
1051661656 9:19432879-19432901 TGGGTTTGGGCTGGGTATGGTGG - Intronic
1051791450 9:20807760-20807782 TAGTCTTAGGCTGGGTGTGGTGG + Intronic
1052612755 9:30797486-30797508 TGTGCATTGGCTGTGTGTGGAGG - Intergenic
1052727099 9:32242225-32242247 TGAGCTTTGGACAGCTGTGGAGG - Intergenic
1053205766 9:36184877-36184899 AAGTCTTTGGCTGGGTGTGGTGG - Intergenic
1053210181 9:36221031-36221053 TGAGCTTAGGCTGGGTGTGGTGG + Intronic
1054909727 9:70443197-70443219 TGATCTTAGGCTGGGTGTGGTGG + Intergenic
1055117919 9:72625360-72625382 TGGGCTTTGGTTGGGTGATTTGG + Intronic
1055322893 9:75099538-75099560 TGGGATTGGGCTGGGTGTGGTGG + Intronic
1055331616 9:75189945-75189967 ATGACTTTGGTTGGGTGTGGTGG + Intergenic
1055441883 9:76344576-76344598 TGGGGGTGGGATGGGAGTGGTGG + Intronic
1055889418 9:81107096-81107118 TGAGCATTGGCTGGGTGCGGTGG + Intergenic
1055951305 9:81732305-81732327 TCAGTTTTGGCTGGGTGTGGTGG + Intergenic
1055994380 9:82141443-82141465 TGGGGTTTGGCCGGGTGCGGTGG - Intergenic
1056858868 9:90161310-90161332 AGCACTTTGGATGGGTGAGGCGG + Intergenic
1057177886 9:93012677-93012699 TGGGCGGTGGCGGGGTGTGGGGG + Intronic
1057241913 9:93418729-93418751 TAAGCTTTGGCCGGGTGTGGTGG + Intergenic
1057391961 9:94647812-94647834 TGGGCCTTGGCTGGGCGCGGTGG - Intergenic
1057710232 9:97434355-97434377 TGGGGTTAGGATGGGGGTTGTGG + Intronic
1058054319 9:100434234-100434256 CAGTCTTTGGCTGGGTGTGGTGG + Intronic
1058801426 9:108548006-108548028 TGGTCTTTGGATAGGTGGGTAGG - Intergenic
1058871394 9:109204782-109204804 AAGGCTTTGGCTGGGTGTGGTGG - Intronic
1059103685 9:111493306-111493328 TGGGCATGGGCTGGGTGCGGTGG + Intergenic
1059433879 9:114265144-114265166 GGGGCTTTTGATGGGGGTGGGGG + Intronic
1060091670 9:120748459-120748481 AGGGTTTTGGACAGGTGTGGTGG + Intergenic
1060525196 9:124316493-124316515 TGGGCTTTGTCTGGCTGTGGTGG - Intronic
1060569321 9:124623641-124623663 TGGACTCAGGCTGGGTGTGGTGG - Intronic
1060569602 9:124626291-124626313 TAGGATATGGCTGGGTGTGGTGG - Intronic
1060660891 9:125404748-125404770 CAGGCATTGGCTGGGTGTGGTGG - Intergenic
1060929362 9:127479240-127479262 TGGGCCCTGGAGGGGAGTGGGGG + Intronic
1061127169 9:128684325-128684347 GGGGATTTGGCTGGATGTGGAGG - Intronic
1061216318 9:129224049-129224071 TGGCCTCGGGTTGGGTGTGGTGG - Intergenic
1061563875 9:131424397-131424419 GGGGCACTGGCTGGGTGTGGTGG + Intronic
1061891443 9:133623138-133623160 TGGGATTTTGATGGGGGTTGGGG + Intergenic
1061894180 9:133638531-133638553 TGGGCTCTGGGTGGCTGGGGTGG + Intronic
1062124423 9:134851493-134851515 TGTGCTTTGGATGGAGTTGGAGG + Intergenic
1062405627 9:136394934-136394956 TGGGCTCTGGAGGGATGTGCTGG - Intronic
1062496510 9:136833968-136833990 GAGGCTTTGGAAGGGTTTGGAGG - Intronic
1062674957 9:137736913-137736935 AGAGATTTGGCTGGGTGTGGTGG + Intronic
1203360432 Un_KI270442v1:216666-216688 TGTGCCTTGGAGGGGTGTTGGGG + Intergenic
1185539641 X:892139-892161 GGGGCTTTGGCCGGGTGCGGTGG + Intergenic
1185860008 X:3569068-3569090 GGTGCTTTTGATGTGTGTGGTGG - Intergenic
1185964899 X:4589568-4589590 TGGCCTGTGGAGGGGTGTGCTGG + Intergenic
1186133121 X:6491062-6491084 TGGTTGTTGGCTGGGTGTGGTGG - Intergenic
1186389822 X:9147941-9147963 CGGGCTGTGGCTGGGGGTGGGGG - Intronic
1186773963 X:12845752-12845774 TTGGCATTGGCTGGGCGTGGTGG - Intergenic
1186845403 X:13525788-13525810 CAAGCTTTGGCTGGGTGTGGTGG + Intergenic
1187012538 X:15294656-15294678 GGGGGTTAGGCTGGGTGTGGTGG - Intronic
1187355594 X:18567592-18567614 AATGCTTTGGCTGGGTGTGGTGG + Intronic
1187990140 X:24861417-24861439 TGAGTGTTGGCTGGGTGTGGTGG - Intronic
1188009995 X:25045141-25045163 TGGGCCATGGCTGGGTGTGGTGG + Intergenic
1189128671 X:38475664-38475686 GGGGCTTTGGATGAATGTTGGGG + Intronic
1189353895 X:40297241-40297263 TCAGATTTGGCTGGGTGTGGTGG + Intergenic
1189817983 X:44843565-44843587 TGGGATTTGGCTGGGCTTGGTGG - Intergenic
1189891986 X:45612664-45612686 TGGCGTTTGGATGGGCCTGGGGG - Intergenic
1190109282 X:47579525-47579547 GGGGAGCTGGATGGGTGTGGGGG - Intronic
1190797646 X:53759745-53759767 TGGGCCTTGGAAGGGAGTTGGGG - Intergenic
1191776678 X:64822024-64822046 TGGGAATTAGCTGGGTGTGGCGG + Intergenic
1192178100 X:68898493-68898515 TGGCTTTGGGATGGGTGGGGCGG + Intergenic
1192180765 X:68914367-68914389 TGGGGTTGGAATGTGTGTGGGGG - Intergenic
1192279785 X:69672592-69672614 TAGGCTTTGGCCGGGCGTGGTGG + Intronic
1192317270 X:70062786-70062808 TGGGCTTTGGAGGAGCGGGGAGG - Exonic
1192458350 X:71296397-71296419 TGGGGTTGGGCTGGGGGTGGTGG - Intronic
1192462725 X:71331169-71331191 AGGGCTTAGGCTGGGTGTAGTGG - Intergenic
1192815702 X:74588780-74588802 TGGTGTTTGGATGTGGGTGGGGG + Exonic
1193406063 X:81104048-81104070 TAGGTTTGGGCTGGGTGTGGTGG + Intergenic
1193554019 X:82931979-82932001 TGGGGTATTGATGGCTGTGGTGG + Intergenic
1195760417 X:108239953-108239975 TTGAATTTGGCTGGGTGTGGTGG + Intronic
1196441197 X:115721517-115721539 TGGTCTTGGGGTGGGGGTGGCGG + Intergenic
1196444725 X:115839505-115839527 TGGTCTTGGGGTGGGGGTGGCGG + Intergenic
1196863123 X:120046119-120046141 TGGGGTTGGGATGGGGGTGGGGG - Intergenic
1196879979 X:120190225-120190247 TGGGGTTGGGATGGGGGTGGGGG + Intergenic
1198551456 X:137749539-137749561 GGGGATTTGGGTGGGGGTGGAGG + Intergenic
1198639414 X:138740634-138740656 TGGGCTGTGGATGGCTATTGGGG - Intronic
1199949751 X:152698630-152698652 TGGGGATCGGATGGGGGTGGAGG - Intergenic
1199959923 X:152769831-152769853 TGGGGATCGGATGGGGGTGGAGG + Intergenic
1200313600 X:155105972-155105994 AGGGTCTTGGATGGGCGTGGTGG - Intronic
1200844600 Y:7818791-7818813 TGGGCTTTGGACATGTGTGATGG + Intergenic
1201318921 Y:12676332-12676354 TAGGCTTTGGCTGGGCATGGTGG - Intergenic
1201928693 Y:19317650-19317672 TGGGCTTTGGTGGGTTCTGGTGG + Intergenic