ID: 1122954515

View in Genome Browser
Species Human (GRCh38)
Location 14:105064316-105064338
Sequence CAATGGGCTTTGGATGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122954515_1122954523 18 Left 1122954515 14:105064316-105064338 CCACACCCATCCAAAGCCCATTG 0: 1
1: 0
2: 1
3: 14
4: 239
Right 1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122954515 Original CRISPR CAATGGGCTTTGGATGGGTG TGG (reversed) Intronic
902042370 1:13502229-13502251 CAATAGACTTTGGCCGGGTGCGG - Intronic
903479813 1:23645055-23645077 CCATGGACTGTGCATGGGTGGGG - Intergenic
904971021 1:34419514-34419536 CAATGGGCTATGCAAGGGCGGGG + Intergenic
905111145 1:35595438-35595460 CAAAGGGCTGTGGGTGGGTTGGG + Intergenic
906474330 1:46157896-46157918 AATTGGGCTTTAGATGGTTGAGG - Intronic
908530073 1:65025967-65025989 AAATGTGGTTTGGCTGGGTGTGG - Intergenic
909529673 1:76668264-76668286 CAATTGGTCATGGATGGGTGAGG - Intergenic
910189958 1:84585148-84585170 TCATGGACTTTGGCTGGGTGTGG - Intergenic
913009737 1:114670787-114670809 CAAGAGGCTCTGGCTGGGTGGGG - Intergenic
913217890 1:116635814-116635836 GAGTGGGCATTGGCTGGGTGTGG - Intronic
913330111 1:117660011-117660033 CAGTGGGCTTTGGAAGGGGCTGG - Intergenic
916684577 1:167132813-167132835 CTATGGGTTTTGGTTGGGTTTGG - Intergenic
917334920 1:173916791-173916813 CACTGGGATTTGGGTGGGGGTGG + Intronic
921052387 1:211520138-211520160 CAAGGGGAATTGGCTGGGTGTGG + Intergenic
922208847 1:223471655-223471677 CAATCTGCTGTGGCTGGGTGAGG + Intergenic
923234879 1:232022594-232022616 CCATGGGTATTGGCTGGGTGCGG - Intronic
1064934301 10:20662882-20662904 GGAAGGGCTTTTGATGGGTGTGG - Intergenic
1065105962 10:22385194-22385216 CCATTTCCTTTGGATGGGTGTGG + Intronic
1066127742 10:32358351-32358373 AAGTGGGTTTAGGATGGGTGTGG + Intronic
1067310752 10:45111525-45111547 CAATTGTGTTTGGGTGGGTGCGG + Intergenic
1068813852 10:61287534-61287556 CAATGTGCTTTGGAGGGGTTAGG + Intergenic
1070153269 10:73818335-73818357 CCCTTGGCTTTGGATGGGTTGGG - Intronic
1071212128 10:83355546-83355568 CACTGTGGTTTGGCTGGGTGAGG - Intergenic
1072773636 10:98166566-98166588 CTAAGGGCTTGGAATGGGTGAGG - Intronic
1074005401 10:109417834-109417856 CAGTGTGCATTGGGTGGGTGTGG - Intergenic
1076425061 10:130361777-130361799 CAATGGGCTTTTCTTGGGGGAGG - Intergenic
1076863090 10:133151200-133151222 CAAGGGGCATTAGCTGGGTGTGG + Intergenic
1076870159 10:133189051-133189073 CAATTGGCTTTGGAGTGGGGAGG + Intronic
1077036729 11:498987-499009 CACTGGGCCTTGGGGGGGTGCGG - Intronic
1077108398 11:851632-851654 CAAGAGGCTCTGGAGGGGTGAGG + Intronic
1078543321 11:12228773-12228795 CTATGGGATTTGGATGTGTTGGG + Intronic
1081686715 11:45048158-45048180 AAATGTGCTTTGGCTGGGCGTGG - Intergenic
1083214686 11:61210979-61211001 CATTGGCCAATGGATGGGTGGGG + Intronic
1083217570 11:61229808-61229830 CATTGGCCAATGGATGGGTGGGG + Intronic
1083220564 11:61249558-61249580 CATTGGCCAATGGATGGGTGGGG + Intronic
1083722433 11:64610001-64610023 CAGAGGGCTGTGGGTGGGTGGGG - Intronic
1084647277 11:70465792-70465814 AAATGGGCTCTGGCTGGCTGAGG + Intergenic
1084901695 11:72314727-72314749 CAATGGGCTGGGGTGGGGTGGGG + Intronic
1085033009 11:73283957-73283979 CGCGGGGCTGTGGATGGGTGAGG + Intronic
1087104304 11:94394890-94394912 CCATGGGCTAAGGATGGGTCTGG - Intronic
1090190674 11:124764820-124764842 CATTTGCCTTGGGATGGGTGGGG - Intergenic
1090784346 11:130036071-130036093 CACAGGGCTTTGGGTGGCTGAGG + Intergenic
1091402374 12:188879-188901 CAAAGGGATCTGGATGGGGGTGG - Intergenic
1091484452 12:871038-871060 CAGTGGGTTTTGCATGGGTTGGG + Intronic
1093392796 12:18643232-18643254 CAGTGGGTTATGGATGTGTGAGG - Intronic
1093426376 12:19033038-19033060 CACTGGGCTTGTGATGGGAGGGG + Intergenic
1093674249 12:21916960-21916982 GAATGGGCTCTTGATGGCTGTGG - Exonic
1093902196 12:24648404-24648426 AAATGAGTTTTGGCTGGGTGTGG - Intergenic
1095974440 12:47929568-47929590 AATTGGGCTTGGGATGGGGGCGG - Intronic
1096981585 12:55730608-55730630 CAAAGGGCTTGGGACGGATGTGG + Intergenic
1098000478 12:65936970-65936992 CACTGGGCTTTGTAAGGGTTAGG - Intronic
1098170074 12:67737963-67737985 CAAGGGGCTTGGGATGGGGCTGG - Intergenic
1100048660 12:90416320-90416342 CAATGGCCTTTGCAAGGTTGAGG - Intergenic
1100567993 12:95817328-95817350 CAATCGACTTTGGCTGGGCGCGG + Intronic
1102212445 12:111137223-111137245 CAGTGGATTTTGGATGGGAGTGG - Intronic
1102417052 12:112772898-112772920 CAATGGACTTTGGATACTTGAGG - Intronic
1107622916 13:42251981-42252003 AAATGTCCTTTGAATGGGTGAGG + Intronic
1112839508 13:103559042-103559064 CAATGAGCTTTGGGTGGGGGTGG - Intergenic
1113678505 13:112225309-112225331 GAATGGGCTTGGGCAGGGTGTGG - Intergenic
1113913598 13:113856738-113856760 CAGTGGGCTTTGGGTGTGTCTGG - Intronic
1113919172 13:113897121-113897143 CAATTGGCTTTAGATGGGAAAGG + Intergenic
1115099299 14:29678540-29678562 CAATGCTCTTTGGGTGGGAGGGG + Intronic
1116133618 14:40891810-40891832 CACTGGGCCTTTGATGGGAGGGG + Intergenic
1116864458 14:50020105-50020127 CAAGGTGCCCTGGATGGGTGAGG + Intergenic
1117288050 14:54306689-54306711 CTATAGGCTTTGGATGTTTGGGG - Intergenic
1117496889 14:56314490-56314512 ATATGGGCTTTGGATTGGTGGGG - Intergenic
1118191082 14:63580975-63580997 CTCTGGGGTTTGGGTGGGTGGGG - Intergenic
1118876171 14:69786648-69786670 AAATGGGCTTGGCATGGGGGAGG - Intronic
1119530429 14:75356509-75356531 CTAAGGGCTTTGGATGGGGATGG + Intergenic
1119719122 14:76879392-76879414 AAGTGGGCTTTGGCTGGGGGTGG + Intergenic
1119880744 14:78097479-78097501 CTCTGGGCTTTTGATGGGAGGGG + Intergenic
1120132599 14:80824244-80824266 CACTGGGCTTGTGATGGGAGGGG + Intronic
1121136843 14:91506838-91506860 GAATGGACTTAGGCTGGGTGCGG - Intronic
1121893231 14:97618523-97618545 CCATGGGTTTAGGACGGGTGAGG + Intergenic
1122168615 14:99851900-99851922 CACTGGGCTTTGCATGAGAGTGG - Intronic
1122431288 14:101648152-101648174 CAATGGACTTTGGGTACGTGGGG + Intergenic
1122929990 14:104928711-104928733 CACTGGGCTCAGTATGGGTGCGG - Intronic
1122954515 14:105064316-105064338 CAATGGGCTTTGGATGGGTGTGG - Intronic
1124186185 15:27531498-27531520 CAAGGGCCTTTGCCTGGGTGTGG - Intronic
1125355121 15:38809423-38809445 CCAGGGGCTTTGCCTGGGTGGGG + Intergenic
1125859517 15:42985736-42985758 CCCTGGACTTTGGGTGGGTGAGG + Intronic
1127151084 15:56076130-56076152 AAATGGGATTTGGAAAGGTGAGG - Intergenic
1127366283 15:58293718-58293740 CAATGGGCTTTGCAAGGTGGAGG + Intronic
1128317038 15:66667506-66667528 AAGTGAGTTTTGGATGGGTGGGG - Intronic
1129084499 15:73074560-73074582 AAATGGGTTTTCGATGTGTGAGG + Intronic
1131921984 15:97338110-97338132 CAATGGGCATTGGAAGCGAGGGG - Intergenic
1133043426 16:3072809-3072831 ATATGGGCTTCGGATGGGCGTGG + Intronic
1133375408 16:5282941-5282963 CTCTGGGCCTTTGATGGGTGGGG - Intergenic
1133703165 16:8328094-8328116 AAATGGGCTTCGTATTGGTGGGG + Intergenic
1134104562 16:11476624-11476646 CAAGGGGATGTGCATGGGTGTGG - Intronic
1135417034 16:22276456-22276478 TAATGTTCTTTGCATGGGTGGGG - Intronic
1136609569 16:31357983-31358005 CAGTGGGCTTTGGCAGGCTGAGG + Intronic
1137289645 16:47043278-47043300 CTATGGGCTTTGGCAGGGCGCGG - Intergenic
1137568448 16:49549170-49549192 CACTGGGCTTTGGATTCCTGGGG + Intronic
1138039106 16:53643005-53643027 AAGTGGGCGTTGGCTGGGTGCGG + Intronic
1138477731 16:57282075-57282097 GATTGGGGTTGGGATGGGTGGGG - Intronic
1139481601 16:67233909-67233931 GAAGGGGCCTTTGATGGGTGGGG + Exonic
1140321493 16:73956255-73956277 CAGTGGTGTTTGGATGGATGAGG + Intergenic
1141069706 16:80942566-80942588 AAATGGGTTTAGGCTGGGTGCGG + Intergenic
1143217471 17:5235664-5235686 CACCGGGCTCTGGCTGGGTGCGG + Intergenic
1143998829 17:11033723-11033745 CTTTGGGTTTTGGATGGGCGGGG - Intergenic
1144482651 17:15640317-15640339 CCATGGGCTGTGGCTGTGTGGGG + Intronic
1144888976 17:18483206-18483228 CACGGGGCCTGGGATGGGTGGGG + Intronic
1144916036 17:18724715-18724737 CCATGGGCTGTGGCTGTGTGGGG - Intronic
1145143232 17:20461090-20461112 CACGGGGCCTGGGATGGGTGGGG - Intronic
1146225521 17:31062720-31062742 CCATGTGCATTGGCTGGGTGTGG + Intergenic
1146557300 17:33837083-33837105 CAATGGGCTTTGGCTTAGTGTGG + Intronic
1146719988 17:35117345-35117367 TAAAGGTCTTTGGATTGGTGTGG - Intronic
1147434177 17:40397133-40397155 CAATGTGCTTTGGGAGGCTGAGG - Intronic
1148945398 17:51258940-51258962 CAATGAGCAGTGGGTGGGTGAGG + Intronic
1151516329 17:74598558-74598580 CAAAGGGCTTTGCAGGGGTGGGG - Intergenic
1151633882 17:75330408-75330430 AGATGGGCTTTGGCAGGGTGCGG + Intronic
1151644958 17:75424249-75424271 CAATGCGTATTGGCTGGGTGTGG + Intergenic
1151678337 17:75611171-75611193 CCTTGGTCTTTGGCTGGGTGTGG + Intergenic
1153770834 18:8415429-8415451 AAATGGGGTGAGGATGGGTGTGG - Intergenic
1154176314 18:12088696-12088718 CAATGGGCCATGGCAGGGTGAGG - Intergenic
1157781753 18:50445742-50445764 AGATGAGATTTGGATGGGTGGGG + Intergenic
1158064472 18:53389072-53389094 AAATGAACTTTAGATGGGTGTGG - Intronic
1158389497 18:57033687-57033709 CAGTGGGATTTGGGTGGGGGTGG - Exonic
1160238584 18:77105956-77105978 CAATTTGCTTGGAATGGGTGTGG - Intronic
1160983954 19:1828842-1828864 CAATGGGCGCTGGATGGGCCTGG + Intronic
1161354163 19:3810045-3810067 CACTGGGCAGTGGGTGGGTGTGG + Intronic
1161949246 19:7458674-7458696 CAAAGGGCTGTGGAGAGGTGAGG + Exonic
1163887234 19:19977231-19977253 AAAGTGGCTTTTGATGGGTGTGG - Intergenic
1164035618 19:21451518-21451540 ATATGGGGTTGGGATGGGTGTGG + Intronic
1164424491 19:28128755-28128777 CATTTGCCTTGGGATGGGTGTGG + Intergenic
1166099103 19:40560451-40560473 CAATGGGCTGGGGGTGGCTGGGG - Intronic
1167943626 19:52968069-52968091 CAATGGTCTTTCTATTGGTGAGG - Intergenic
1168446971 19:56427444-56427466 TAGTGTGCTTTGGCTGGGTGCGG + Intronic
925524863 2:4788106-4788128 CTATGGGCTTGTGATGGGAGGGG + Intergenic
926034686 2:9626719-9626741 AACTGGGCTTTGGCTGGATGTGG - Intronic
926109114 2:10170807-10170829 CAAAGGGCTGTGGCTGGGGGCGG - Intronic
926646204 2:15292273-15292295 TAATGATTTTTGGATGGGTGTGG - Intronic
927062828 2:19440556-19440578 GACTGGCCTTTGGGTGGGTGTGG - Intergenic
928074812 2:28254425-28254447 CAATGGGCTGGGCATGGGCGTGG - Intronic
930112097 2:47687436-47687458 ACATGGGTTTTGGATGGGTGTGG - Intergenic
936256975 2:110924802-110924824 TAATGGCCTTTAGATTGGTGAGG + Intronic
937633809 2:124133268-124133290 CAAAGGGCCTTGGAAGGGAGAGG - Intronic
938095599 2:128459857-128459879 CACAGGGATTTGGAAGGGTGGGG + Intergenic
938217040 2:129526742-129526764 CAATGGGCCTATGGTGGGTGGGG + Intergenic
938699225 2:133861491-133861513 ACATGGGCTTTGGTTGGGTGTGG - Intergenic
941269584 2:163408637-163408659 ACATGGGGTTTGGAGGGGTGGGG + Intergenic
943771335 2:191720997-191721019 TGAAGGGCTTTGGCTGGGTGAGG - Intergenic
944441899 2:199751583-199751605 GAATGGGCTTTTGAGGAGTGGGG - Intergenic
944648550 2:201805159-201805181 TAATGGTCTTTGGCCGGGTGCGG + Intronic
948078211 2:235183482-235183504 CACTAGGCTTTGGGTGGCTGGGG - Intergenic
948155964 2:235781702-235781724 CAGTGGGCTCTGGAAGGGTAAGG + Intronic
948861922 2:240756908-240756930 CAAGGGGCATTTGATAGGTGAGG - Intronic
1169215914 20:3794830-3794852 CAAGGTGCATTGGATGGGGGTGG - Intronic
1169584803 20:7069216-7069238 CTATGGGTTGTGGATGGGAGGGG + Intergenic
1169991139 20:11504012-11504034 CAATGGACTTTGGCCGGGCGCGG + Intergenic
1170080261 20:12467408-12467430 CTATTGGCTTTGGCTAGGTGGGG - Intergenic
1171366515 20:24628634-24628656 CAATGTGTTTTGATTGGGTGGGG - Intronic
1171768751 20:29304522-29304544 CAATGGGCTGTGGGTAGTTGTGG + Intergenic
1172606818 20:36219695-36219717 CAGTGGGCTCTGGAGGGGTGAGG - Intronic
1172898987 20:38320472-38320494 CAAAGGCCTTTGGAGGGGGGTGG - Intronic
1173783271 20:45774063-45774085 AAATGGGTTTTGGTTGGGTGTGG - Intronic
1174500773 20:50982394-50982416 CACTGGGGTGGGGATGGGTGGGG - Intergenic
1175300232 20:57937853-57937875 GAATGGGATTTGCATTGGTGGGG + Intergenic
1178778468 21:35575632-35575654 CAATGGGCTTTGGACAGGCCAGG + Intronic
1181682977 22:24508585-24508607 AAATGGACTTGGGCTGGGTGTGG + Intronic
1182736172 22:32533352-32533374 CCATGGGCTAAGCATGGGTGTGG - Intronic
1183318686 22:37150714-37150736 CAGTGGGGGTTGGAGGGGTGGGG - Intronic
1183467716 22:37988031-37988053 TACTGGGCCTTGGTTGGGTGTGG + Intronic
1183517895 22:38278023-38278045 AGATTGGCTTTGGCTGGGTGTGG - Intergenic
1183599997 22:38834451-38834473 CAATGGGCAGAGGAGGGGTGGGG - Intronic
1184614808 22:45630785-45630807 GAATGGGGTTTGGCTGGGTGCGG + Intergenic
1185045171 22:48525128-48525150 CAAGGGTCTTGGGATGGGAGAGG - Intronic
1185416374 22:50712539-50712561 CACTGGGCTTTCCCTGGGTGAGG + Intergenic
949401345 3:3668120-3668142 AATTGGGATTGGGATGGGTGGGG + Intergenic
949680770 3:6512108-6512130 AAATGTGCTTAGGCTGGGTGTGG + Intergenic
949965410 3:9351862-9351884 CAAGGGGCCATGGAAGGGTGAGG + Intronic
950421905 3:12904299-12904321 CAAAGGGCTTTGGGTGGCTCTGG + Intronic
952158225 3:30666924-30666946 CAATGACCTTAGGCTGGGTGTGG - Intronic
952338556 3:32425853-32425875 AACTGGGATTTGGCTGGGTGTGG + Intronic
953121380 3:40045862-40045884 AAAGGGGCTATGGATGGATGGGG + Intronic
953543398 3:43842283-43842305 CAAAGGGACTTGGATGAGTGGGG - Intergenic
959245845 3:103866601-103866623 CAAGGAGCTTTAGATGTGTGCGG - Intergenic
960263573 3:115595240-115595262 CATTGAGCGTTGGATGAGTGGGG + Intergenic
961196448 3:125005899-125005921 GAATGGGGTTTGGATGGGTGTGG - Intronic
964665689 3:159169578-159169600 ACATGGGCTTTGGCAGGGTGCGG - Intronic
966788143 3:183638908-183638930 AAGTAGGCTTTGGCTGGGTGCGG + Intronic
967527794 3:190514474-190514496 CAAAGGGCTGAGGATGGGGGCGG - Intronic
969802200 4:9577675-9577697 CTCTGGGCCTTTGATGGGTGGGG - Intergenic
970861484 4:20708605-20708627 CAATAAGTTTTGGAGGGGTGGGG - Intronic
973659892 4:53093853-53093875 GAAGGGGCTAGGGATGGGTGGGG + Intronic
974083978 4:57239948-57239970 CAATGAGCATGGGCTGGGTGTGG - Intergenic
974133092 4:57780483-57780505 CAATGGGATCTTGATGGTTGAGG - Intergenic
976407754 4:84678949-84678971 CAATGGGATTGGGGTGGGGGTGG + Exonic
977891314 4:102314586-102314608 CAATGAGCTTGGCATGAGTGAGG - Intronic
978087422 4:104670758-104670780 CAATGGACTTTGGAGGCTTGGGG - Intergenic
979688990 4:123540881-123540903 TTATGGGGTTTGGCTGGGTGCGG + Intergenic
980939224 4:139257529-139257551 CAAGTGGCTTTGGAAGGCTGAGG - Intergenic
981982790 4:150815270-150815292 TAAAGGACTTTGGATGGGGGTGG + Intronic
985820258 5:2154996-2155018 CAATGAATTTTGAATGGGTGAGG + Intergenic
988838910 5:35063996-35064018 CAGTGGGCTTTGGGTTGGTATGG + Exonic
990191094 5:53260924-53260946 CAATGGGCTTTTGAATGGAGTGG - Intergenic
990205229 5:53421637-53421659 CAATGCTCTTTTGAGGGGTGTGG + Intergenic
991612789 5:68466194-68466216 CAATGGGTGCTGGCTGGGTGCGG - Intergenic
992129793 5:73680506-73680528 TGATGGGTTTTGGATGGGAGGGG + Intronic
992237913 5:74731101-74731123 AAAGGGGCTTTGGCCGGGTGCGG - Intronic
994023874 5:95059762-95059784 CAGTGGTCATGGGATGGGTGAGG + Intronic
995169417 5:109090112-109090134 CAATGGCCTTTGGATCACTGGGG + Intronic
996478644 5:123949200-123949222 CCTTGGGCTTTGGATGGGACCGG + Intergenic
997979367 5:138459382-138459404 TGATGGGCTTTGAATGGGTCTGG - Intergenic
999132232 5:149293003-149293025 CACTGAGCTTGGGATGGCTGTGG - Intronic
1001206670 5:169769692-169769714 CAAGGGGCTTTGGATGCAGGTGG + Intronic
1003641548 6:7879423-7879445 CTATGGGCTTTGAAAGGATGAGG - Intronic
1003848159 6:10195421-10195443 GCATGGGCTTGGGATGGGGGAGG + Intronic
1004519757 6:16350790-16350812 AAATGGGAATTGGCTGGGTGTGG + Intronic
1006309296 6:33246408-33246430 CAATAGGCTTAGGGTGGGTCAGG - Intergenic
1006769872 6:36543922-36543944 AAATGGTCCTTGGCTGGGTGCGG - Intronic
1007790023 6:44303415-44303437 CAATGGGGTCTGGAGGGGTGGGG + Exonic
1008541802 6:52552213-52552235 CCCTGGGCTTTGCATGGGGGAGG - Intronic
1010304655 6:74305368-74305390 GAATGGGGTGTGGTTGGGTGTGG + Intergenic
1010434385 6:75813304-75813326 CCATGGGCTTGGGATGGTGGTGG - Intronic
1016882371 6:148923614-148923636 TAATAGGCTTTGGCTGGGTGCGG + Intronic
1022235476 7:28456494-28456516 CAATGGTCTTTGGCTGGGGTGGG + Intronic
1022314179 7:29229132-29229154 CAATGTGCTTTGCAAGAGTGGGG + Intronic
1026602427 7:71787663-71787685 CTATGGACTATGGATGGATGCGG - Exonic
1026649648 7:72204283-72204305 CTCTTGGCTTTGGCTGGGTGCGG - Intronic
1026802114 7:73406668-73406690 CAATGGGCTATGTTGGGGTGGGG - Intergenic
1026911560 7:74094442-74094464 CAGTGGGCGGTGGGTGGGTGGGG - Intronic
1027984051 7:85262733-85262755 CAGTGTGTTTTGGATGGGTAAGG + Intergenic
1029198433 7:98822783-98822805 TAAGGGGCCTTGGCTGGGTGCGG - Intergenic
1029375868 7:100176687-100176709 GAATGGGGCTTGGAAGGGTGGGG + Intronic
1030124022 7:106137725-106137747 CCATGAGCCTAGGATGGGTGAGG + Intergenic
1031894224 7:127329565-127329587 CTATGGGCTTTGGAGGAGTCAGG - Intergenic
1036702186 8:11020075-11020097 GACTGGGCCTTGGGTGGGTGGGG - Intronic
1042912342 8:73840344-73840366 GAATGAGCTTTGGCTGGATGTGG - Intronic
1050514695 9:6430684-6430706 CAGTGGGCTTTGGATTGTAGGGG - Intronic
1051872620 9:21756144-21756166 GAAGGGGCTTTCTATGGGTGAGG + Intergenic
1052580045 9:30343599-30343621 CCTTGGGATTTGGATGGGGGTGG + Intergenic
1055227932 9:74023472-74023494 CAATGGGATTTGCAGGGCTGTGG + Intergenic
1056037200 9:82619131-82619153 CAATGGGATGTGGGTGGATGTGG + Intergenic
1056329364 9:85509115-85509137 CAATGGGCTTGGGAAGGATGAGG + Intergenic
1057815878 9:98294110-98294132 CAATGTGCTGGGGATGTGTGTGG + Intronic
1058871395 9:109204785-109204807 AAAAAGGCTTTGGCTGGGTGTGG - Intronic
1059433876 9:114265141-114265163 CATGGGGCTTTTGATGGGGGTGG + Intronic
1061649706 9:132037637-132037659 CAATGGGCTTGGGCTGGCTTCGG + Intronic
1062178527 9:135178082-135178104 CAAAGGGGTGTGTATGGGTGTGG - Intergenic
1186493780 X:9995895-9995917 CAATGCGCTTGGGATGGGGCAGG + Intergenic
1187355593 X:18567589-18567611 CAAAATGCTTTGGCTGGGTGTGG + Intronic
1188285009 X:28316095-28316117 CAATGGGCATGGCATGGGTGAGG - Intergenic
1188608857 X:32070797-32070819 CAATGGGCTTTGGAGACTTGGGG + Intronic
1189216796 X:39332175-39332197 CAATGGGATGTGTGTGGGTGTGG - Intergenic
1190320509 X:49176863-49176885 GACTGGGCTGTGGCTGGGTGTGG + Intronic
1190752654 X:53375612-53375634 CAATGGCTTGTGGAGGGGTGGGG + Exonic
1194936762 X:99959512-99959534 CAATGGGGGTTGGAGAGGTGAGG + Intergenic
1195858164 X:109352806-109352828 GAAGGGGCCTTGGATGGGTCAGG + Intergenic
1197536282 X:127692119-127692141 AAATGAGATTTGGGTGGGTGGGG - Intergenic
1198766766 X:140088083-140088105 CAATGGGCTGTGGGTGCTTGTGG + Intergenic
1200415510 Y:2906009-2906031 CAATGGACTTTGGAGGCTTGCGG + Intronic
1201426646 Y:13858667-13858689 AAATGTTCTTTGAATGGGTGTGG + Intergenic
1201963500 Y:19707506-19707528 GACTGGGCTTTGGAGAGGTGAGG + Exonic