ID: 1122954516

View in Genome Browser
Species Human (GRCh38)
Location 14:105064321-105064343
Sequence GTTGACAATGGGCTTTGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122954516_1122954523 13 Left 1122954516 14:105064321-105064343 CCCATCCAAAGCCCATTGTCAAC 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 81
1122954516_1122954524 27 Left 1122954516 14:105064321-105064343 CCCATCCAAAGCCCATTGTCAAC 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1122954524 14:105064371-105064393 TTGCCCAGGCTAGAGTGCAATGG 0: 2189
1: 44143
2: 118007
3: 187814
4: 215396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122954516 Original CRISPR GTTGACAATGGGCTTTGGAT GGG (reversed) Intronic
902302550 1:15512324-15512346 GATGAGAATGGGATTTGAATAGG + Intronic
903887285 1:26547785-26547807 GTTGGTAGTGGGCTTTGGGTTGG + Intronic
907697342 1:56745509-56745531 GTGGACAGATGGCTTTGGATTGG - Intronic
908384541 1:63628401-63628423 GTTTTCAATGGGCTATGGAAGGG + Intronic
910081313 1:83345505-83345527 GTTCCCAGTGTGCTTTGGATTGG - Intergenic
913391803 1:118322224-118322246 GTTCACAATGACCTTTGGCTTGG - Intergenic
916867815 1:168879100-168879122 CTTGGCAATGGGCTTAGTATTGG - Intergenic
918811549 1:189127686-189127708 GTTCAAAATGAGATTTGGATGGG + Intergenic
924396031 1:243621981-243622003 GTTGACAATAGACTGTGGATTGG - Intronic
1063345627 10:5310002-5310024 GTAGAAAAAGGGCTTTGGGTGGG - Intergenic
1063816938 10:9786437-9786459 GATGACAATGGCATTTGAATTGG - Intergenic
1068467022 10:57407374-57407396 GATGACAATGGGCTCTGTATGGG - Intergenic
1068752985 10:60617982-60618004 GTTGACTATGGGCTTAAGACAGG + Intronic
1068813851 10:61287529-61287551 GTTTACAATGTGCTTTGGAGGGG + Intergenic
1069204155 10:65660957-65660979 GTGGTCAATGGGCTGTGGGTTGG - Intergenic
1070624241 10:78038340-78038362 GTTAACACTGGGCTTGGGAAGGG + Intronic
1070779857 10:79131238-79131260 GTCCTCAATGGGCTGTGGATGGG - Intronic
1073384669 10:103115103-103115125 GTTGAAAATAGCCTTTGGCTGGG + Intronic
1075225618 10:120626141-120626163 ATTCAAGATGGGCTTTGGATGGG + Intergenic
1075769833 10:124923865-124923887 GTTGGCAATGAGATTTGGGTGGG + Intergenic
1076319325 10:129566481-129566503 GAGGACAATGAGCTCTGGATAGG - Intronic
1079390741 11:20019822-20019844 GTTGACCATTGGCTTTGGCAAGG + Intronic
1080803857 11:35634019-35634041 TTTAACAATTGGCTTTGGGTAGG + Intergenic
1081164472 11:39790809-39790831 GTTCACAATGAGATTTGGGTAGG - Intergenic
1083704730 11:64506072-64506094 GTTGACAGGGGGCTTTGGTGCGG - Intergenic
1085919431 11:80934484-80934506 GATGACTATAGGCTCTGGATTGG - Intergenic
1086268902 11:85035615-85035637 GTTCACAATGAGATTTTGATGGG + Intronic
1086794398 11:91082906-91082928 GTTCAAAATGGGATTTGGGTGGG - Intergenic
1087104306 11:94394895-94394917 ATTGACCATGGGCTAAGGATGGG - Intronic
1087574210 11:99970240-99970262 TTTGACAGTGTGTTTTGGATAGG - Intronic
1089753114 11:120665951-120665973 GTGCACAATGGGTTTTGGAAAGG - Intronic
1090802986 11:130185672-130185694 CTTGAGAATGTGCTTTGAATTGG - Intronic
1098082856 12:66807950-66807972 ATTGACAAAGGGCTTTAGGTTGG - Intergenic
1098580010 12:72088414-72088436 TTTGACAATGGGCATTTGAGAGG + Intronic
1101907670 12:108839818-108839840 GTTAACATTGGTCTTTGGAGGGG + Intronic
1107048902 13:36026371-36026393 GTTGACAGTTGGCTGTGGGTTGG - Intronic
1110208857 13:72948946-72948968 GTTGAGGATGAACTTTGGATGGG + Intronic
1110786817 13:79538223-79538245 GTTGAATATGAGATTTGGATGGG + Intronic
1112839511 13:103559047-103559069 ATTCACAATGAGCTTTGGGTGGG - Intergenic
1114908221 14:27157906-27157928 TTATACATTGGGCTTTGGATTGG - Intergenic
1118156028 14:63242776-63242798 GTTGACAGTGGAGTTTGGTTTGG - Intronic
1120541055 14:85751501-85751523 GTTCAAAATGAGATTTGGATGGG - Intergenic
1121363478 14:93285043-93285065 GTTGATAATGGTCTTTAGCTTGG + Intronic
1122072055 14:99211277-99211299 GTTGCCCATGGGCTTGGGCTGGG - Intronic
1122954516 14:105064321-105064343 GTTGACAATGGGCTTTGGATGGG - Intronic
1134782871 16:16914615-16914637 GTTGCCAGGGGTCTTTGGATGGG - Intergenic
1136383213 16:29906694-29906716 GTTAGCAATGGGGTTGGGATGGG + Exonic
1141390858 16:83662109-83662131 GATGCCAATGGGTTTTGGAGAGG + Intronic
1147772527 17:42877835-42877857 GTGGACTTTGGACTTTGGATTGG + Intergenic
1147836461 17:43335709-43335731 GTTGACTTTGGGCTTTTCATCGG + Intergenic
1153389073 18:4534078-4534100 GTTCAAAATGAGATTTGGATGGG + Intergenic
1155868713 18:30998574-30998596 GTTGACAATTTTCTCTGGATAGG - Intronic
1156803618 18:41149150-41149172 GTGGCCCATGGGCTCTGGATTGG + Intergenic
1157588365 18:48819678-48819700 GTTTACCATGAGCATTGGATGGG - Intronic
1161879944 19:6942159-6942181 TATGACAATTGGCTATGGATAGG - Intergenic
1164579153 19:29423784-29423806 GTTCAAAATGAGATTTGGATGGG - Intergenic
1165019184 19:32909060-32909082 GCTGTCAGTTGGCTTTGGATTGG + Intronic
1165224177 19:34342469-34342491 GTTGACACTGGGCGAGGGATGGG - Intronic
1166182189 19:41116853-41116875 GATGACAATGGGGTTGGGGTTGG - Intronic
929190719 2:39136842-39136864 GTTGACAATGCATTTCGGATAGG - Intergenic
930229969 2:48833793-48833815 ATTCACAATGAGATTTGGATGGG - Intergenic
931622169 2:64221831-64221853 GTTGACAATGGTTTTTAGAAAGG - Intergenic
934605406 2:95691414-95691436 GTTGGGAATGGGCTCTGGCTTGG + Intergenic
936538867 2:113333960-113333982 GTTGGGAATGGGCTCTGGCTTGG + Intergenic
938603909 2:132872751-132872773 TTTGAAAATGTGCTTTGGAGAGG + Intronic
938963926 2:136369850-136369872 ATTGACATTGGGCTTGGGCTTGG + Intergenic
939499554 2:142965789-142965811 GTTGGGAATGGGCTTCGGGTTGG + Intronic
947832451 2:233151175-233151197 GTTAAGAATGGGCTATGCATGGG + Intronic
1172527097 20:35606457-35606479 GCCAAGAATGGGCTTTGGATTGG - Intergenic
1178778467 21:35575627-35575649 CTGCACAATGGGCTTTGGACAGG + Intronic
1179019978 21:37630958-37630980 GGTCACAATGTGCTTTGGAAAGG - Intronic
950152065 3:10695424-10695446 GTTCAAAATGAGATTTGGATGGG + Intronic
955101560 3:55854782-55854804 ATTCACAATGGGCTCTGGAGTGG + Intronic
955127662 3:56129983-56130005 ATTGACAATGGGCTAAGGTTTGG + Intronic
956431946 3:69195774-69195796 GTTGACAGTGAGATTTAGATGGG + Intronic
958069595 3:88593320-88593342 ATGGACAATGGGATTTGAATTGG + Intergenic
961311228 3:126003467-126003489 GTTGACAAAGGGCATTGTTTTGG - Intergenic
963609134 3:147442824-147442846 GTTGCCAGTGGGCTGTAGATTGG + Intronic
963609137 3:147442857-147442879 GTTGCCAATGGACTATAGATTGG + Intronic
964709705 3:159658656-159658678 GATGTGAATGGGTTTTGGATGGG - Intronic
965853844 3:173064504-173064526 GTTGTCAATGGGTTTTTGAGTGG - Intronic
971077139 4:23163103-23163125 GTTGAAAAGTGGATTTGGATTGG + Intergenic
971723412 4:30276226-30276248 ATTGCAAATGGGCTTTGGCTAGG + Intergenic
972167519 4:36305556-36305578 GTTCAAAATGAGATTTGGATGGG + Intronic
974415453 4:61600503-61600525 CTTTACAATAGGCTTTGGTTTGG + Intronic
975227627 4:71892385-71892407 GATGCCGATGGCCTTTGGATGGG - Intergenic
976270937 4:83229813-83229835 GTTCACAGTGGGCTTTTGTTTGG + Intergenic
976470428 4:85421934-85421956 GTTTACATTGGGCTGTGTATTGG + Intergenic
979819262 4:125151010-125151032 GATGCCAATGGCCTTTGAATGGG + Intergenic
987530956 5:19118771-19118793 GTTCAAAATGAGGTTTGGATGGG - Intergenic
988838909 5:35063991-35064013 TTTCACAGTGGGCTTTGGGTTGG + Exonic
990656361 5:57960998-57961020 GCTGAAAATGGGCTTTAGATTGG + Intergenic
990976210 5:61564058-61564080 GTTCAAAATGAGATTTGGATGGG + Intergenic
998661649 5:144245579-144245601 GTTGAACATGAGATTTGGATGGG - Intronic
999182659 5:149681040-149681062 GTTGAAATTGGGCTTGGGCTGGG + Intergenic
999247317 5:150162028-150162050 GTAGTCCAAGGGCTTTGGATGGG - Intergenic
1000046810 5:157528583-157528605 GCAGGAAATGGGCTTTGGATGGG - Intronic
1000736808 5:164913490-164913512 GTTGAGAATGCTCTTTGGGTTGG - Intergenic
1003766572 6:9243589-9243611 AGTGACAATGAGCTTTGGTTAGG + Intergenic
1004729826 6:18346835-18346857 GTTGAAAATGGAATTTGGAAAGG - Intergenic
1008154294 6:47994806-47994828 GTTGGTAATGGCATTTGGATAGG + Intronic
1013342875 6:109232380-109232402 TTGGACAATGGGATGTGGATGGG + Intergenic
1015190499 6:130466941-130466963 CCTGACAATGGGCTCTGGCTAGG - Intergenic
1019765224 7:2844634-2844656 GTGCCCAACGGGCTTTGGATTGG + Intergenic
1021901624 7:25291258-25291280 GTTCAAGATGGGATTTGGATGGG - Intergenic
1022235473 7:28456489-28456511 TGTGACAATGGTCTTTGGCTGGG + Intronic
1025107359 7:56182925-56182947 AATGTCAAGGGGCTTTGGATGGG + Intergenic
1026398976 7:69989758-69989780 GTTCCCAATGGGCTATGGACAGG - Intronic
1027298793 7:76807752-76807774 GTTCCCAGTGTGCTTTGGATTGG - Intergenic
1027953898 7:84855649-84855671 ATTCACAATGAGATTTGGATAGG + Intergenic
1027984050 7:85262728-85262750 TTTGACAGTGTGTTTTGGATGGG + Intergenic
1032899972 7:136295949-136295971 GTTGACAATTGGCTGTGGTTAGG + Intergenic
1036962321 8:13258505-13258527 GAACACAATGGACTTTGGATTGG + Intronic
1038387956 8:27167273-27167295 GTTGACAGTGCGCTGTGCATGGG + Intergenic
1043678262 8:82988937-82988959 GTTGAAGATGAGATTTGGATGGG - Intergenic
1044817994 8:96132470-96132492 GTTGATATTTGGCTTTGGATAGG - Intergenic
1044881712 8:96729981-96730003 GTTGAAAATGGGCTTGGGTCTGG + Intronic
1046737995 8:117797818-117797840 TTTGAGAATGGACTATGGATGGG + Exonic
1046869511 8:119189705-119189727 TTTGAAAATGGGCTGTGAATAGG - Intronic
1048701449 8:137095141-137095163 GTTGGCAATGGGTTTTTCATAGG - Intergenic
1049183322 8:141234740-141234762 GATGACAACAGGCTTTGGAGAGG + Intronic
1049662492 8:143825910-143825932 GTTGACAGTGGGATGTGGCTCGG + Intronic
1054791615 9:69261781-69261803 TTTGACCCTTGGCTTTGGATTGG + Intergenic
1056712862 9:89005257-89005279 TTTGAGAATGGTCTTTTGATAGG + Intergenic
1056817032 9:89809501-89809523 GTGGAGGATGGGCTTTAGATAGG - Intergenic
1057484413 9:95471233-95471255 TTCCACAAAGGGCTTTGGATGGG + Intronic
1058589960 9:106554720-106554742 ATTGACATTGGGATTTTGATAGG - Intergenic
1060423404 9:123485550-123485572 CCTGACCATGGGCTTTGGAGAGG + Intronic
1185803772 X:3038040-3038062 GTTGAAGATGAGCTTTGGATGGG + Intergenic
1186853322 X:13601671-13601693 TTTGAAAATGGGCATTGGAAGGG + Intronic
1192153393 X:68725859-68725881 GCTGACAATGGGCTAGGGACTGG + Intergenic
1200978571 Y:9239950-9239972 GTTGACAATGGGCCCGGGATGGG - Intergenic
1201921175 Y:19234505-19234527 ATTGACAATGGGCATTGTTTTGG - Intergenic