ID: 1122954518

View in Genome Browser
Species Human (GRCh38)
Location 14:105064326-105064348
Sequence AGAAAGTTGACAATGGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122954518_1122954524 22 Left 1122954518 14:105064326-105064348 CCAAAGCCCATTGTCAACTTTCT 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1122954524 14:105064371-105064393 TTGCCCAGGCTAGAGTGCAATGG 0: 2189
1: 44143
2: 118007
3: 187814
4: 215396
1122954518_1122954523 8 Left 1122954518 14:105064326-105064348 CCAAAGCCCATTGTCAACTTTCT 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122954518 Original CRISPR AGAAAGTTGACAATGGGCTT TGG (reversed) Intronic
900759198 1:4459792-4459814 AGAAAGTCGACAATGCTCTGAGG - Intergenic
901712604 1:11127501-11127523 AGAAATCTGACAAAGGCCTTGGG + Intronic
902608443 1:17582501-17582523 AGACAGTTGACAAGGTGCGTGGG - Intronic
902632585 1:17714181-17714203 AGGAAGTGGTGAATGGGCTTTGG - Intergenic
906190974 1:43899317-43899339 AGACAGTTCTCAATGGGCTCAGG - Intronic
907267186 1:53269705-53269727 AGAAAGTAGAGAATGGGAATAGG - Intronic
907603469 1:55792919-55792941 AGGAAGGTGAAAATGGGATTTGG + Intergenic
908706448 1:66961713-66961735 AGTAACTTGACAATGTTCTTTGG + Intronic
909185125 1:72477725-72477747 AAAAAAATGACCATGGGCTTTGG - Intergenic
909347317 1:74606154-74606176 AGGCAGTTGACTATAGGCTTAGG - Intronic
910480156 1:87649916-87649938 AGAAAGTGGCCAATAGTCTTTGG - Intergenic
910834950 1:91499758-91499780 AGAAAGAAGACAATGGGATTTGG - Intergenic
911426864 1:97727287-97727309 AGAAAGTTCACAATAGGGTTTGG + Intronic
911534560 1:99084899-99084921 ACAAAGTTAACTATGGACTTTGG + Intergenic
913535109 1:119764465-119764487 GGAAAGTATACAGTGGGCTTGGG - Exonic
916312904 1:163416778-163416800 AAAAAGTTGACAATGGGGCCGGG + Intergenic
916992776 1:170262467-170262489 AGACATTTCACTATGGGCTTAGG - Intergenic
917294482 1:173504607-173504629 AGAATTTTGTCATTGGGCTTGGG + Intronic
917355283 1:174120852-174120874 AGAAGGTTGATATCGGGCTTTGG + Intergenic
917579062 1:176355795-176355817 AGAAGCTTGCCAATGGGATTAGG + Intergenic
917771826 1:178287797-178287819 AGAATGATAACAATGGACTTTGG + Intronic
919533008 1:198748377-198748399 TGAACATTTACAATGGGCTTTGG + Intronic
920219482 1:204386236-204386258 AGATTGTTAACAGTGGGCTTAGG - Intergenic
920360233 1:205410256-205410278 AGAAACTTGAAAATGAGCTCTGG - Intronic
920533284 1:206720782-206720804 AGAAAGTACACATTGGGATTTGG + Intronic
921066841 1:211629348-211629370 AGAAAGTTGCCATTGGATTTTGG - Intergenic
921887777 1:220323754-220323776 GGAGAGTTGGCAAGGGGCTTAGG + Intergenic
923468614 1:234270080-234270102 AGCAAGTGGACAATGGGCATGGG - Intronic
1064093077 10:12401845-12401867 AGAAAGCTGAAAAGAGGCTTTGG + Intronic
1064295568 10:14076261-14076283 TGAAAGATGAAAATGTGCTTGGG + Intronic
1064468777 10:15613871-15613893 AGAACGTTGGCAATGGCCTGTGG - Intronic
1066593700 10:37024675-37024697 AGAGAGTTGACAGTGGGTTTTGG + Intergenic
1069495761 10:68901655-68901677 AGAAAGATGGCCCTGGGCTTTGG + Intronic
1071403815 10:85307664-85307686 AGAAAATTTAAAATGGACTTGGG + Intergenic
1073394774 10:103208706-103208728 AGAAGGGTGACAATGAGATTTGG - Intergenic
1073752516 10:106544819-106544841 ACAAAGATGTGAATGGGCTTTGG + Intergenic
1075994993 10:126870003-126870025 AGATAGTTGACCATGGGGGTGGG - Intergenic
1078285275 11:9947261-9947283 AGAAAGATCACAATGAGCTCAGG + Intronic
1079390740 11:20019817-20019839 AGAGAGTTGACCATTGGCTTTGG + Intronic
1080236339 11:30072726-30072748 TGAGTGTTGACAATGGGCTCAGG - Intergenic
1082862143 11:57866981-57867003 AGGAAGTTGACCAAGAGCTTAGG + Intergenic
1082863705 11:57879008-57879030 AGAAAGTAGACTAGGGGCTGGGG + Intergenic
1083156953 11:60829122-60829144 AAAAAGTTGACATGTGGCTTGGG + Intergenic
1083704731 11:64506077-64506099 ACAAGGTTGACAGGGGGCTTTGG - Intergenic
1084532245 11:69734328-69734350 AGCAAGTTGGCCATGGGCTGGGG + Intergenic
1085894606 11:80623649-80623671 AGAGAGTTGAGAGTGGGTTTTGG - Intergenic
1086354980 11:85986888-85986910 AGAAAGTTTTCACTGGGCCTTGG - Intronic
1086521027 11:87667699-87667721 AGGAGATTGACAAAGGGCTTAGG + Intergenic
1086977817 11:93156675-93156697 AAAAAGTGGGCAAAGGGCTTGGG - Intronic
1087829485 11:102803525-102803547 AGAAACTTGAAAAAGGTCTTTGG + Intergenic
1088131316 11:106495413-106495435 TGATAGAAGACAATGGGCTTAGG + Intergenic
1088782904 11:113153399-113153421 AGAAAGTTGTTACTGGGATTTGG + Intronic
1089720956 11:120420780-120420802 AGAAAGATGACAATGGATTTGGG + Exonic
1090930598 11:131294982-131295004 AGAAGGTTGCCAATTGCCTTAGG + Intergenic
1091222573 11:133937850-133937872 AGCCAGGTGACAATGGGCTTGGG + Exonic
1091542806 12:1477739-1477761 AGGAGGATGACAAGGGGCTTCGG - Intronic
1093137653 12:15471486-15471508 AGAATATTTACAATGGGCTGTGG - Intronic
1093259828 12:16922208-16922230 AGAAAGAAAATAATGGGCTTAGG + Intergenic
1093967880 12:25346218-25346240 AGAAATTTAAAAATGGGCTCTGG - Intergenic
1095470659 12:42533600-42533622 ATAAAGTTGCCAAAGTGCTTGGG + Intronic
1095560358 12:43557377-43557399 AGAAAATGGACAATGGACTTTGG - Intergenic
1097130933 12:56810273-56810295 GGGAAGTTGACAAGGGGCTGAGG - Intergenic
1097732457 12:63144807-63144829 AGACAGTAGAAAATGGGCTGGGG - Exonic
1097909195 12:64950982-64951004 AGAAAGTATAAATTGGGCTTTGG + Intergenic
1098572413 12:72003289-72003311 ACAAAGCTGACAAAGGGCTGGGG + Intronic
1103514915 12:121501150-121501172 AGACACTTGACATTGGGTTTAGG - Intronic
1105328173 13:19389242-19389264 AGAAAGCTGACAAGTGGCCTTGG + Intergenic
1106932717 13:34684235-34684257 AGAAAGTAGACCAGTGGCTTGGG - Intergenic
1107210848 13:37852473-37852495 AGAGAGTACACAATGGGCCTTGG + Intronic
1111328379 13:86730684-86730706 ATAAAGTTGAGACTGGGCATGGG - Intergenic
1111652338 13:91107707-91107729 AGGAAGTTGGCAATGGGTCTGGG + Intergenic
1113413326 13:110109114-110109136 GGCAAGTTGACATTGGTCTTGGG + Intergenic
1115427403 14:33276180-33276202 AGAAAGTTGATAAAGAGCTATGG + Intronic
1115982315 14:39067192-39067214 GGACAGTTTAAAATGGGCTTTGG - Exonic
1116113802 14:40622529-40622551 AGAAAATGGTCAATGTGCTTTGG - Intergenic
1117838438 14:59831952-59831974 AGACTGGAGACAATGGGCTTCGG + Intronic
1120162237 14:81158545-81158567 GGAAAGTTGACACTGAGTTTTGG - Intergenic
1121943553 14:98096402-98096424 AGAATGATAACAATGGACTTTGG - Intergenic
1122954518 14:105064326-105064348 AGAAAGTTGACAATGGGCTTTGG - Intronic
1124005616 15:25793403-25793425 AGAAACTTAACAAGAGGCTTAGG - Intronic
1125101649 15:35919941-35919963 TGAAAATTATCAATGGGCTTGGG - Intergenic
1132113057 15:99116194-99116216 AGAATGCCAACAATGGGCTTTGG - Intronic
1136096897 16:27963308-27963330 AGAAAGATGTCACTGGGCTTGGG - Intronic
1138364871 16:56466887-56466909 AGAGACTTGACAATCTGCTTCGG - Exonic
1138439903 16:57027911-57027933 ATGAAGTGGAGAATGGGCTTTGG + Intronic
1139029846 16:62866687-62866709 TGAAATTTGGCAATGGGTTTAGG - Intergenic
1142732646 17:1871806-1871828 GGAGAGATGACAATGGGGTTCGG - Intronic
1146981409 17:37165312-37165334 ATAAAGGTGAACATGGGCTTTGG + Intronic
1148019232 17:44542453-44542475 AGAAACCTGTGAATGGGCTTTGG - Intergenic
1149427236 17:56566915-56566937 AGAAGTTTGGCAATGGGCCTAGG + Intergenic
1151078027 17:71296721-71296743 ACAAAGTTGAGAAGGGGCCTGGG - Intergenic
1157799502 18:50607706-50607728 GGAAAGATGACAATTGGCCTTGG - Intronic
1166218651 19:41352240-41352262 AGAAAGTTGACCCAGAGCTTGGG - Intronic
927087137 2:19683418-19683440 AGAAAGTTGCCAATTATCTTTGG - Intergenic
927390429 2:22588764-22588786 AGAAAGATGCAAATGGGCTGGGG + Intergenic
928471411 2:31580418-31580440 AGAGAGTTGACAAGCGGCTGCGG - Intronic
929892496 2:45929905-45929927 AGAAATTTGACAGTGGGTTAGGG - Intronic
930629399 2:53735862-53735884 ACAAAGGTGACAATGGTTTTGGG + Intronic
933933055 2:87174658-87174680 ACAAAGCTGACCAAGGGCTTAGG - Intergenic
936360057 2:111790789-111790811 ACAAAGCTGACCAAGGGCTTAGG + Intronic
939177743 2:138769258-138769280 AGAGAGTTTACAATGGGACTTGG + Intronic
940672882 2:156692233-156692255 AGAGAGAAAACAATGGGCTTAGG + Intergenic
943442336 2:187941205-187941227 AGAAAGTTGACCTTAGGTTTTGG - Intergenic
944044370 2:195391905-195391927 AGAAACTTCACAATGGACTTTGG - Intergenic
945693295 2:213069461-213069483 TGAAAGAAGACAGTGGGCTTTGG - Intronic
945814193 2:214583917-214583939 AGAAAGTGGTCAATGCCCTTTGG + Intergenic
1172584737 20:36074911-36074933 AGAGAGTTGACTCTGGGCTACGG - Intergenic
1173353554 20:42266273-42266295 AGAAAATTGACAATGGGCATGGG + Intronic
1175339525 20:58219190-58219212 AGAATGTTGTGAATGGGCCTGGG - Intronic
1175694317 20:61089986-61090008 AGAGAATGGACAATGTGCTTGGG - Intergenic
1176001665 20:62834572-62834594 AAAAAGTTTACACTGGGCTGTGG - Intronic
1179253008 21:39689178-39689200 AGAAAGCTGACATTTGGCTAAGG + Intergenic
1181266550 22:21634148-21634170 AGAAAGTGGCCAAAGGGCTGAGG - Exonic
1182814007 22:33142348-33142370 AGAAATTTAACAAGGGGTTTGGG - Intergenic
1182814386 22:33146674-33146696 ATAAAGTTGACAAGAGGCTCAGG - Intergenic
1182982257 22:34683563-34683585 AGAAAGTTGACAAAGTATTTTGG - Intergenic
1183030321 22:35098965-35098987 AGAAAGCAGACAAAGGGCTATGG - Intergenic
1184980292 22:48090794-48090816 ATAAAGTGGACAAGGGCCTTTGG + Intergenic
949818570 3:8089809-8089831 AGAGAGTTGACAATAGTCTATGG + Intergenic
952154736 3:30630566-30630588 TGACAGTTGTCAATGGGCTGTGG - Intronic
953629091 3:44597001-44597023 AGACAGATAACAGTGGGCTTAGG - Exonic
954784768 3:53084737-53084759 ACAATGTTGACAAAGGGGTTTGG - Intronic
958127713 3:89379492-89379514 TGAAATTTGATAATGGGTTTAGG + Intronic
959592971 3:108099566-108099588 AAAATGTTGCCAATGGGGTTGGG - Intergenic
960635473 3:119780714-119780736 AGAAAGTTGACTTGGGCCTTAGG - Intronic
960641774 3:119831815-119831837 AGACAGGTGATAATGGGCATTGG - Intronic
964128500 3:153262061-153262083 AAAATGTTGACAATGGACATAGG - Intergenic
969168744 4:5341501-5341523 AGAAAGTAGACAAAATGCTTTGG - Intronic
969343819 4:6558880-6558902 AAAAAGATGACGCTGGGCTTTGG - Intronic
973270655 4:48259418-48259440 AGAAAGATGACAAAGGGGCTGGG + Intronic
974576138 4:63725678-63725700 AAAAAGTTGACCATGGGATTTGG - Intergenic
976460690 4:85308513-85308535 AGAAAGATAATAATGGACTTTGG - Intergenic
978053556 4:104234901-104234923 ACAAAGATGATAAAGGGCTTAGG + Intergenic
978709447 4:111760865-111760887 ATGATGTTCACAATGGGCTTTGG - Intergenic
980685922 4:136228293-136228315 AGATATTTGACAATGTGTTTTGG - Intergenic
983921017 4:173344737-173344759 AGAAAGGAGAAAATGGGTTTTGG - Intergenic
988029968 5:25751708-25751730 AGAAAGTGGACGATGATCTTTGG + Intergenic
989348668 5:40458785-40458807 AGAAAATTGACACTGGGAGTAGG + Intergenic
989785433 5:45322212-45322234 ATAAAGGTGTTAATGGGCTTTGG + Intronic
990433977 5:55768936-55768958 AAAAAGTGGACAATGGACATGGG - Intronic
990598245 5:57332243-57332265 AAACAGTTGACCATGGGCTTGGG + Intergenic
990957724 5:61360307-61360329 AGCAAGTTGACAAGGGAGTTTGG + Intronic
992914891 5:81439253-81439275 TAAAAGTTGACAATGGGGATGGG - Intronic
993059065 5:83017175-83017197 AGAAATCTGACAATGGAGTTGGG - Intergenic
996265060 5:121529859-121529881 AGACTGTTGTAAATGGGCTTGGG - Intergenic
996820220 5:127618434-127618456 AGAGAGTTGATAATGGGGGTGGG + Intergenic
998532223 5:142895837-142895859 AAAAAGATTACAATCGGCTTTGG + Intronic
998767382 5:145502938-145502960 TGAAAGATGAAAATGGGTTTTGG - Intronic
999390278 5:151184601-151184623 AAAAAGTTAACAAAGGGCTGCGG + Intronic
999893927 5:156008337-156008359 AGAAAGAAGACAATGGGAATGGG - Intronic
1000422747 5:161057008-161057030 TGGAAGTTCACAATGGGCTCAGG - Intergenic
1000820652 5:165979062-165979084 AGAATGGTGGCAATGGGGTTGGG - Intergenic
1002802615 6:539541-539563 AGAAATTTGACAATCGACTTAGG - Intronic
1003508929 6:6763263-6763285 AGAAAATTTACAAAGGGCTATGG + Intergenic
1007008807 6:38394790-38394812 GGAAAGTTGACACTGGCCGTTGG - Intronic
1009871327 6:69455511-69455533 AGAAATATGACAATTGGCTCAGG + Intergenic
1011360597 6:86520147-86520169 AGAAAGATGAGAGAGGGCTTTGG - Intergenic
1012320623 6:97840331-97840353 AAAGAGTGGACACTGGGCTTTGG + Intergenic
1015766473 6:136722981-136723003 AGAAAGTTTACACTTGGCTGGGG - Intronic
1015870287 6:137769339-137769361 AGAAAGTTGATAACGTGTTTGGG - Intergenic
1016430870 6:143983870-143983892 AGAAAGTTGCTAATGTGGTTTGG + Intronic
1018497781 6:164367885-164367907 AGACAAGTGACATTGGGCTTGGG - Intergenic
1026398702 7:69986555-69986577 GGAAAGTTTACAGTGGCCTTTGG - Intronic
1028011743 7:85653723-85653745 AGTAAGTTGATATTGAGCTTAGG - Intergenic
1028951721 7:96643974-96643996 GAAAAGTTGGGAATGGGCTTGGG - Intronic
1029538714 7:101170719-101170741 AGAATGTTGACAGTGAGTTTGGG - Exonic
1030927551 7:115477154-115477176 AGAAAGTAGATAAAGAGCTTTGG + Intergenic
1031753193 7:125604313-125604335 AGACAGATGAGAATAGGCTTGGG + Intergenic
1034005739 7:147470079-147470101 AGAAAGCTTACAATGGTCTATGG - Intronic
1034737466 7:153442172-153442194 TGAATGTTGACTGTGGGCTTTGG + Intergenic
1035119272 7:156551472-156551494 AGAACTATGCCAATGGGCTTCGG + Intergenic
1036137543 8:6175692-6175714 AGAAAGAAGACAATAGTCTTGGG + Intergenic
1037062510 8:14532366-14532388 AGAAAGTGGATAATGGTCTTTGG + Intronic
1037850275 8:22321936-22321958 AGAATGGAGAAAATGGGCTTTGG - Intronic
1039149846 8:34491858-34491880 AGTAAGTTGGCAATAGGATTTGG - Intergenic
1041331918 8:56735937-56735959 AAAAAGTTGACAGTGGGTCTGGG - Intergenic
1041628946 8:60063101-60063123 AGGAAGTATTCAATGGGCTTGGG + Intergenic
1041765024 8:61410500-61410522 AGAAATTGCACAATGGGCTTTGG - Intronic
1043190112 8:77209970-77209992 AGAAAACTGAAATTGGGCTTTGG - Intergenic
1044220873 8:89668481-89668503 AGAAAGTTGACATTTGTTTTGGG - Intergenic
1046010596 8:108542150-108542172 AGAAAGTTTTTAAGGGGCTTTGG + Intergenic
1046344226 8:112901713-112901735 AGACAGCTGAGAATGGTCTTTGG - Intronic
1048370819 8:133774609-133774631 AGAAAGTCCAAAATGGACTTAGG - Intergenic
1050546860 9:6716600-6716622 AGAAAGTTGCCACTGGGGTAAGG + Intergenic
1051711796 9:19938514-19938536 AAAAAGTTGACTATGGACTCTGG + Intergenic
1052663049 9:31460574-31460596 AGAAAGTTCTCACTGGGCTCTGG + Intergenic
1053206986 9:36194651-36194673 GGAAAGTTGAAAGTGGGTTTGGG + Intronic
1054962185 9:70981154-70981176 ACAAAGCTGACAATGTGATTTGG + Intronic
1055013000 9:71587533-71587555 TGGAAGTTGAGAATGGGTTTTGG - Intergenic
1056208224 9:84340497-84340519 AGAAACTTGCCAAGGGGCTAAGG + Intronic
1057381941 9:94576464-94576486 AGAAACCAGACCATGGGCTTGGG - Intronic
1058726060 9:107805273-107805295 AGATAGTTGACAATGGACTTAGG - Intergenic
1060777417 9:126385595-126385617 AGCATGTTCACACTGGGCTTCGG + Intronic
1186955260 X:14674853-14674875 GGAAAGACAACAATGGGCTTTGG - Intronic
1188275656 X:28197244-28197266 AGAAAGAGGTCAATGGGCATTGG + Intergenic
1189212736 X:39298460-39298482 AGAAAGCAGACAAAGGGCCTGGG + Intergenic
1190076526 X:47321344-47321366 AGAAAGCTGACAATCTCCTTCGG + Intergenic
1191785576 X:64914112-64914134 AAAAAGAAGACAAGGGGCTTGGG - Intergenic
1192024524 X:67435077-67435099 AGAAAGTGGGCTCTGGGCTTAGG - Intergenic
1193353475 X:80489148-80489170 TGAAACTTGACAGTGGGGTTAGG + Intergenic
1195090130 X:101450707-101450729 AGAAAGTACACTATGGGCCTTGG - Intronic
1196220442 X:113108326-113108348 AGAAAATTGGCCATTGGCTTTGG - Intergenic
1197520396 X:127490234-127490256 AGGTAGTCTACAATGGGCTTTGG - Intergenic
1199209817 X:145194823-145194845 AGTAGGTTGACAATTGGCTGGGG - Intergenic
1199345926 X:146739864-146739886 AGAAAGTTGATTATGAGTTTGGG + Intergenic
1199543484 X:148983286-148983308 AGAATGAAGAGAATGGGCTTTGG + Intronic
1200844599 Y:7818778-7818800 AGGAACTTAACATTGGGCTTTGG + Intergenic
1200892686 Y:8340492-8340514 AGGATGTTAACAGTGGGCTTTGG - Intergenic
1202049636 Y:20767126-20767148 AGAAAGCTGAAAATGATCTTGGG + Intronic