ID: 1122954520

View in Genome Browser
Species Human (GRCh38)
Location 14:105064333-105064355
Sequence AAAAATAAGAAAGTTGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1828
Summary {0: 1, 1: 0, 2: 14, 3: 171, 4: 1642}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122954520_1122954523 1 Left 1122954520 14:105064333-105064355 CCATTGTCAACTTTCTTATTTTT 0: 1
1: 0
2: 14
3: 171
4: 1642
Right 1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 81
1122954520_1122954527 26 Left 1122954520 14:105064333-105064355 CCATTGTCAACTTTCTTATTTTT 0: 1
1: 0
2: 14
3: 171
4: 1642
Right 1122954527 14:105064382-105064404 AGAGTGCAATGGCGCGATCTCGG 0: 299
1: 7643
2: 53401
3: 132564
4: 159960
1122954520_1122954524 15 Left 1122954520 14:105064333-105064355 CCATTGTCAACTTTCTTATTTTT 0: 1
1: 0
2: 14
3: 171
4: 1642
Right 1122954524 14:105064371-105064393 TTGCCCAGGCTAGAGTGCAATGG 0: 2189
1: 44143
2: 118007
3: 187814
4: 215396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122954520 Original CRISPR AAAAATAAGAAAGTTGACAA TGG (reversed) Intronic
900279631 1:1858333-1858355 AAAAATAAAATAGTTAAAAACGG - Intronic
901297235 1:8170046-8170068 AAAAAAAAAAAAAGTGACAAGGG + Intergenic
901501817 1:9657267-9657289 AAAAATAATAATGTGGAAAATGG - Intronic
902175114 1:14643992-14644014 AAAAAAAAAAAAGTGGGCAAAGG - Intronic
902308358 1:15561098-15561120 AAAAAAAAAAAAGATGAAAAGGG - Intronic
902556180 1:17248201-17248223 AAAAAAAAGAAACTTGCCCAAGG + Intergenic
902966966 1:20012386-20012408 AGAAATAGGAAAGATGAAAAAGG + Intergenic
903292116 1:22320859-22320881 ATAAATAATAATGATGACAATGG + Intergenic
903393059 1:22978377-22978399 AAAAAAAAAAAACTTTACAAAGG + Intergenic
903439448 1:23376639-23376661 AAAAAAAAAAAACTTGAAAATGG - Intergenic
903585774 1:24414369-24414391 AAAAAAAAAAAAATTGACATGGG + Intronic
903800719 1:25965935-25965957 AAAAAGAAAAAAGTGGACAAAGG + Intronic
903848581 1:26292858-26292880 AAAAAAAAGAAAGCTGCAAATGG + Intronic
903954753 1:27017610-27017632 AAAAAAAAAAAGATTGACAAAGG - Intergenic
903982837 1:27202298-27202320 AAAAAAAAGAAAGTAGACTGTGG - Intergenic
904321477 1:29700314-29700336 AAAAAGCAGAAAGATAACAATGG + Intergenic
904666963 1:32130401-32130423 GAAAATAAGTAACTTGACACAGG + Intronic
904700664 1:32356021-32356043 AAAAAAAAGAAAAAAGACAAAGG - Intronic
904739430 1:32661860-32661882 AAAAAAAAAAAAGTGGGCAAAGG - Intronic
905432927 1:37937470-37937492 AAAAATATAAAAGTTGGCCAGGG + Intronic
905520126 1:38591451-38591473 AAAAATAGGAAAATTCAGAAAGG - Intergenic
905603690 1:39276442-39276464 AAAGATAAGATAGATTACAAAGG - Intronic
906268539 1:44455339-44455361 AAAAATAAGAAAGAGGAAAACGG + Intronic
906306088 1:44720209-44720231 AAAAAAAAAAAAGTTGGCCATGG + Intronic
906433309 1:45773700-45773722 AAAAATAAGAAAATTTATAATGG - Intergenic
906466806 1:46088883-46088905 AAAAAAAAAAAAGGTCACAAAGG + Intronic
906673033 1:47672271-47672293 AATATTAAGAAAGTTCTCAAAGG - Intergenic
906843566 1:49165742-49165764 AAAAATAAGAAAGTTATTGAGGG + Intronic
907152111 1:52298795-52298817 AAAAAAAAAAACATTGACAAAGG - Intronic
907352691 1:53846080-53846102 AAAAAAAAAAAAATTTACAAAGG + Intergenic
907374623 1:54025853-54025875 AAAAAAAAAAAAGTAGGCAATGG - Intergenic
907590313 1:55660668-55660690 AAAAAAAAAAAAGTGGACAAAGG - Intergenic
907591433 1:55676122-55676144 AAAAAAAAAAAAGTGGGCAAAGG - Intergenic
907654116 1:56324924-56324946 AAAAATAAGAGGTTTGACAAAGG + Intergenic
907791076 1:57664127-57664149 AAAAAAAAGGATGTTGGCAAGGG + Intronic
907958998 1:59260828-59260850 AAAGTTAAGAAAGTAAACAATGG - Intergenic
907990313 1:59575743-59575765 AAAAATAAGAAAGTTTAGCAAGG - Intronic
908069418 1:60441832-60441854 AAAAATAAGAAAATGGGAAACGG + Intergenic
908331927 1:63079470-63079492 GAAAATAAGAAAAATGGCAAGGG + Intergenic
908336617 1:63131992-63132014 ACTAATAAGAAAGTCAACAAGGG + Intergenic
908522906 1:64961980-64962002 TAAAAAAAGAAAGATAACAAGGG + Intronic
908633519 1:66136714-66136736 AAAAAAAAGAATGTTCAAAAAGG + Intronic
908657024 1:66399015-66399037 AAAATTAAGAAAGTTGGCTGGGG + Intergenic
908897083 1:68912535-68912557 AAAAATAAAGAAATTGAGAAAGG - Intergenic
908906734 1:69021478-69021500 ATAAATAAGAAAGTACTCAAGGG - Intergenic
909163605 1:72186997-72187019 GAAAAAAAGAAAATTGACCAAGG - Intronic
909218065 1:72917390-72917412 AAAAAGAAAAAAGATAACAAAGG - Intergenic
909660875 1:78080331-78080353 AAAAATAAGTAATTTGCCTAAGG - Intronic
909861432 1:80610586-80610608 AAAAATCAAAAAGTGGGCAAAGG - Intergenic
910190915 1:84594653-84594675 AAAAATTAAAAAGTGGGCAAAGG + Intergenic
910197350 1:84656491-84656513 CAAAATCAGTAAGTTGACATAGG + Intronic
910444493 1:87286469-87286491 AAAAATAAGAAACTTTACAGTGG - Intergenic
910749449 1:90613021-90613043 AAAACTATTAAAGTTGACATTGG - Intergenic
910758698 1:90715828-90715850 AAAAAAAAATAAGATGACAATGG - Intronic
910834952 1:91499765-91499787 AAATAAAAGAAAGAAGACAATGG - Intergenic
910847805 1:91620181-91620203 AAAAAAAAGAAAGCTGGCATTGG + Intergenic
911177887 1:94835147-94835169 AAAACTAAGAAACTTGTCACAGG + Intronic
911187524 1:94918509-94918531 AAAAAAAAAAAAGTCGGCAAGGG + Intronic
911379797 1:97098899-97098921 AAATGGAAGAAAGTTCACAATGG + Intronic
911564425 1:99446324-99446346 ATGAATAAGACACTTGACAAAGG - Intergenic
911629193 1:100163602-100163624 AAAAAAAAAAAAATTGAGAAAGG + Intronic
911655721 1:100441139-100441161 AAAATTTAGAAAGTTCACACTGG + Intronic
911682880 1:100738690-100738712 AAATAGAAGAAAGATGACAAAGG - Exonic
911749288 1:101477980-101478002 AAAAATAATGGTGTTGACAAAGG + Intergenic
911768672 1:101711268-101711290 TAAAATAAGAAAGATGAGAAGGG - Intergenic
911884473 1:103280217-103280239 AAAAATCAAAAAGTGGGCAAAGG - Intergenic
911994729 1:104751209-104751231 ACAAAAAAAAAACTTGACAATGG - Intergenic
912303319 1:108539129-108539151 AAAAATGTGGAAGTTGTCAATGG - Intergenic
912335008 1:108853945-108853967 AAAAAAAAGAAATGTGACCAAGG + Intronic
912369782 1:109164939-109164961 GGAAATAAGAGAGTGGACAAGGG + Intronic
912991968 1:114496839-114496861 AGAAATAAGAAAGTTTAAAATGG - Intronic
913157207 1:116111598-116111620 AAAAAAAAAAAATTTCACAATGG - Intergenic
913431235 1:118793830-118793852 AAAAATAAAAAAGATCATAAGGG + Intergenic
913438279 1:118870252-118870274 ACAGAAAAAAAAGTTGACAAAGG + Intergenic
913483129 1:119308724-119308746 GAAACTAAGAAACTTGACAGAGG + Intergenic
914379304 1:147102303-147102325 AAAAATAAGATGAATGACAAAGG + Intergenic
914399462 1:147304182-147304204 AAGAATAAAAAAGTGGACAAAGG + Intergenic
914697769 1:150101271-150101293 AAAAAAAAAAAAGTGGGCAAAGG + Intronic
914769755 1:150673604-150673626 AGAAAAGAGAAAGTTGAGAAGGG + Intronic
914842023 1:151256423-151256445 AAAAAAAAAAAAGTGGGCAAAGG - Intronic
914842074 1:151256738-151256760 AAAAAAAAAAAAGTGGGCAAAGG - Intronic
914865650 1:151426170-151426192 AAAAGTAGGAAAGTAGGCAAAGG - Intronic
915365486 1:155312989-155313011 AAAAAAAAAAAAGGTGACAGAGG + Intronic
915647114 1:157280688-157280710 AAAAAAAAAAAAAATGACAATGG - Intergenic
915804750 1:158834222-158834244 AAAAAAAAAAAAATTGATAAAGG - Intronic
916165162 1:161960322-161960344 AACAAGAAGAAATCTGACAAAGG - Exonic
916253610 1:162763552-162763574 GAAAACAAGAAAGTTATCAAAGG - Intronic
916294994 1:163208616-163208638 AAAAATAAAGAAATGGACAAGGG + Intronic
916312956 1:163417087-163417109 AAAAAAAAAAAAGTTGACAATGG + Intergenic
916316024 1:163448582-163448604 AAATATAAGAAGGTTGAGAAGGG - Intergenic
916701487 1:167300448-167300470 AAAAATAAGAGTTTTCACAATGG - Intronic
916869281 1:168895028-168895050 AAAGAAAAGAAAGTTGTCCAGGG - Intergenic
916908859 1:169321985-169322007 AAAGCCAAGAAAGATGACAAAGG + Intronic
917083601 1:171282558-171282580 AAAAATATAACAGTTGACATAGG + Intronic
917144045 1:171868775-171868797 AAAAAAAAGAAATTGTACAAAGG - Intronic
917162626 1:172075142-172075164 AAAAATCAAAAAGTGGGCAAAGG - Intronic
917345510 1:174024253-174024275 AAAAAAAAAAAAGTTAAAAATGG + Intergenic
917965657 1:180176968-180176990 AAAATTGGGAAAGATGACAAAGG - Intronic
918057815 1:181037631-181037653 CAAATTGAGAAAGATGACAAAGG + Intronic
918173383 1:182020974-182020996 AAAAACAGGAGAGTTGAGAATGG - Intergenic
918188035 1:182144757-182144779 AAAAAAAAGAAAGTAGAAAATGG + Intergenic
918223732 1:182459248-182459270 AAAAATAAGAAAAAAGAAAAAGG - Intronic
918228223 1:182506969-182506991 AAAAAAAAGAAAGGTGAGCAGGG - Intronic
918313815 1:183306020-183306042 ACAAATAAGAAAGCTGTAAAGGG - Intronic
918400716 1:184160089-184160111 AGAAAGTTGAAAGTTGACAAGGG + Intergenic
918606814 1:186437447-186437469 AAAAAAAAGACTGTTTACAAGGG - Intergenic
918660493 1:187081882-187081904 AAAAAAAAGAAAGAGGAAAAAGG - Intergenic
918904352 1:190474158-190474180 AAAAATCAGAAACTGGACCAAGG - Intronic
918931021 1:190857290-190857312 AAAAATTAAAAAGTGGGCAAAGG - Intergenic
918955631 1:191203453-191203475 AAAAATCAAAAAGTGGGCAAAGG + Intergenic
918967752 1:191373623-191373645 AAAAATCAAAAAGTGGGCAAAGG - Intergenic
919017163 1:192053351-192053373 AAAGAGAAGAAAGTAGTCAAGGG + Intergenic
919172125 1:193968096-193968118 AAAAAAAAAAAAGTGGATAAAGG + Intergenic
919189561 1:194198523-194198545 AATATTGTGAAAGTTGACAAGGG + Intergenic
919270735 1:195340857-195340879 AAAAACAAGAGAATTGACAAAGG + Intergenic
919497031 1:198285824-198285846 AAAAATAAACAAGTAGAAAAAGG - Intronic
919523387 1:198617327-198617349 AAAGAAAAGAAAATGGACAAAGG + Intergenic
919884999 1:201926965-201926987 ACAAACAAGAAAATTGACAATGG + Intronic
919890920 1:201973607-201973629 CAAAACAAGAAAATTGACAATGG + Intergenic
919891653 1:201979875-201979897 CAAAATAAGAAATTGGACCAAGG - Intergenic
919956360 1:202420957-202420979 AAAAAAAAAAAAGTTGGCAGAGG - Intronic
920156232 1:203954369-203954391 AACAATAAGAATGTTGAAAGAGG + Intergenic
920172567 1:204080896-204080918 AAAAAAAAAAAAGTCAACAAAGG - Intronic
920384527 1:205560392-205560414 AAAAATTAAAAAGTGGGCAAAGG + Intergenic
920584995 1:207150215-207150237 AAAAAGAAGAAAGGTGGAAAAGG - Intergenic
920707522 1:208265420-208265442 AAAAATAAAAAATTTAAAAATGG - Intergenic
920790977 1:209092086-209092108 AAAACTAAAAAAGATGAGAACGG + Intergenic
920902451 1:210124567-210124589 AAAAATTAGAAAGATCAGAAGGG + Intronic
920911886 1:210226249-210226271 TAAAATAAAAAATTTGAGAAGGG - Intergenic
920968715 1:210723742-210723764 AAAAACAAGCAAGTTAACCATGG + Intronic
920982826 1:210854405-210854427 AAAAATAAGAAAATAGAGAAAGG + Intronic
921191957 1:212718029-212718051 AAAATTAAGAAATCTGACAATGG - Intergenic
921204222 1:212834444-212834466 AAAAAAAAAAAAGTGGACGAAGG - Intronic
921230415 1:213064666-213064688 AAAAAAAAAAAAGTTCACAAAGG - Intronic
921403739 1:214755576-214755598 AAAAATATGAAAATTCAGAAAGG - Intergenic
921436040 1:215123386-215123408 AAAAATAAGAAAATACAAAAAGG - Intronic
921481687 1:215671421-215671443 AAGAATAACAAAGTTGAGAATGG + Intronic
921491050 1:215776496-215776518 AAAAATAAGCATGGAGACAATGG + Intronic
921553145 1:216563917-216563939 AAAGGTAAGAATTTTGACAAAGG + Intronic
921557618 1:216617506-216617528 AAAAAAAAAAAAGTTGAGGATGG + Intronic
921711228 1:218375397-218375419 AAAAAAAAAAAAGTTCAGAAAGG - Intronic
921748175 1:218761692-218761714 AGGAATAAGAAAGCTGATAAAGG + Intergenic
921771247 1:219042349-219042371 AATTATAAGAATGTGGACAATGG - Intergenic
921816869 1:219574253-219574275 AAAAAGAAGAAAGTTATAAAGGG + Intergenic
921938287 1:220814757-220814779 AAAAAAAAGAAAGCTGACTGAGG + Exonic
922083370 1:222320455-222320477 AAACAAAAGAAAAATGACAATGG + Intergenic
922276699 1:224085986-224086008 AAAAATAATAAATTTGACTGGGG - Intergenic
922349813 1:224726074-224726096 AAAAACAAGATTGTGGACAATGG + Intronic
922636873 1:227182584-227182606 TAAAACAAAAAAATTGACAATGG + Intronic
922994073 1:229942053-229942075 AAAAATAAGAGAGTCCTCAAAGG + Intergenic
923047713 1:230367697-230367719 AAAAATAATAAAATTTAAAAAGG + Intronic
923710406 1:236384396-236384418 AAAAACAAAAAAATTGAAAAAGG - Intronic
923787391 1:237081296-237081318 AAAAAAAAGAAAGTCAACAAAGG + Intronic
924215483 1:241817066-241817088 AAAAATAAAAAACTCGACAAGGG + Intergenic
924224682 1:241911421-241911443 AAAATGTAGAAAGATGACAAGGG - Intergenic
924314402 1:242781024-242781046 AAAAATGAGGAAATTGACATTGG + Intergenic
924425488 1:243946312-243946334 AAAAACAAAAAACTAGACAAAGG + Intergenic
924785240 1:247190399-247190421 AAACATAAGAAAATTCACACTGG - Intergenic
924885762 1:248214832-248214854 AAAAATCAAAAAGTGGGCAAAGG + Intergenic
924918983 1:248606078-248606100 AAAAATTAAAAAGTAGGCAAAGG - Intergenic
1062852167 10:752933-752955 AATAATAAGAAAGATGAAAAGGG + Intergenic
1063052038 10:2461759-2461781 AAAAATAAAAAATAGGACAATGG - Intergenic
1063070819 10:2661643-2661665 GAATATATGACAGTTGACAAAGG - Intergenic
1063104401 10:2980427-2980449 AAAAAAAAAAAAGTAGACCAAGG - Intergenic
1063191055 10:3695537-3695559 AATAAGAAGAATGTTGACAATGG + Intergenic
1063338477 10:5240066-5240088 AAAAATCAAAAAGTGGGCAAAGG + Intergenic
1063678405 10:8162525-8162547 AAAAAAAAAAAATTTGAAAAGGG + Intergenic
1063767216 10:9156066-9156088 AAAGATAAGAAACTTGAAATTGG - Intergenic
1064173460 10:13054169-13054191 AAAAAGAGGAAACTTGGCAAGGG + Intronic
1064365623 10:14705031-14705053 AAAAAAAAAAAAATAGACAAAGG + Intronic
1064529336 10:16291386-16291408 AAAAATAAAAAATTTTAGAAAGG - Intergenic
1064861643 10:19833063-19833085 AAAAATAAGGAAGTTGGAAGTGG + Intronic
1064929554 10:20609240-20609262 ATAAATAATAAAGCTGACACAGG - Intergenic
1065146272 10:22771396-22771418 AAAAAAAAAAAAGTGGGCAAAGG + Intergenic
1065345939 10:24748214-24748236 AAAAAAAAAAAAGTTTAAAATGG + Intergenic
1065717283 10:28584586-28584608 AACAATGAGAAGGCTGACAAAGG + Intronic
1065813353 10:29463051-29463073 AATAATAAAAAGGTTGGCAATGG + Intronic
1065958282 10:30711885-30711907 AATAATAAAAAGGTTGGCAATGG - Intergenic
1066069340 10:31790388-31790410 AAAAATACTAAGATTGACAAAGG - Intergenic
1066137693 10:32467096-32467118 AAAAAAAAAAAAGTGGACAAAGG - Intronic
1066153346 10:32648834-32648856 CACCATAAAAAAGTTGACAAAGG - Intronic
1066826765 10:39602286-39602308 AAAAAAATGAATGGTGACAAAGG - Intergenic
1067411843 10:46071434-46071456 AAAAAGAATAAAGTTGATAGCGG + Intergenic
1067674246 10:48356907-48356929 AAAAAAAAAAAAGTTTAAAATGG + Intronic
1067900212 10:50232254-50232276 AATGATTAGAAAGATGACAAAGG - Intronic
1068317178 10:55361312-55361334 AAAAAGAAGATAATTAACAAGGG - Intronic
1068754004 10:60630476-60630498 GAAAATAAGTAAGTAAACAAAGG + Intronic
1068916586 10:62439135-62439157 AAAACTAAGAAAGTGGGAAATGG - Intronic
1069021719 10:63495767-63495789 AAGAAGAAGAAAATTGAGAAAGG + Intergenic
1069022414 10:63503792-63503814 AGAACTACGAAAGTTGTCAAAGG - Intergenic
1069110930 10:64445343-64445365 AAAAACAAACAAGTTGATAACGG + Intergenic
1069159639 10:65078303-65078325 AAGTATAAGAAAGAGGACAAAGG - Intergenic
1069200496 10:65609111-65609133 AAAAAGACAAAAGATGACAATGG + Intergenic
1069341639 10:67416623-67416645 AAAAAAAAACAAGTGGACAAAGG + Intronic
1069354421 10:67567232-67567254 AAAAATAAGAAATGAGAAAATGG + Intronic
1069436334 10:68387359-68387381 AAAAAAAAGAATGTTGTCCAAGG + Intronic
1069811749 10:71165615-71165637 AAAAAGAAAAAAGTAGGCAAAGG + Intergenic
1070266832 10:74911252-74911274 AAGAAAAAGAAAGTAGACTAAGG - Intronic
1071003055 10:80852953-80852975 AAGACTAAGAAAATTGAAAAAGG + Intergenic
1071213390 10:83370382-83370404 AGAAATGAGAAAATTGAGAATGG - Intergenic
1071280644 10:84099560-84099582 ATAAAAAAGAAAGTTTACACTGG + Intergenic
1071365909 10:84900433-84900455 AAAAATAAAATAGTGGAGAAAGG + Intergenic
1071410288 10:85384785-85384807 AAAAAAAAAAAAATTAACAAAGG + Intergenic
1071522085 10:86337688-86337710 AAAAAAAAAAAAGTTCCCAAAGG - Intronic
1071556774 10:86610235-86610257 AAAAATGAGAAATATGAGAATGG + Intergenic
1071759485 10:88584103-88584125 ACCAATAAGAAAATTGACAATGG + Intronic
1071991763 10:91106589-91106611 AAAAAAAAAAAAGTGGGCAAAGG - Intergenic
1072109523 10:92305411-92305433 AAAAAAAAGAATATTTACAAAGG + Intronic
1072111735 10:92327871-92327893 AAAAAAAAGTAAGTTTACAGTGG + Intronic
1072134654 10:92533721-92533743 AAAAAAAAAAAAGCTGACCAAGG + Intronic
1072244632 10:93532120-93532142 AAAAATACTAAAATAGACAAGGG + Intergenic
1072402837 10:95122775-95122797 AAAAATAAACAACTTGACAGGGG - Intergenic
1072517855 10:96203784-96203806 AAAAAAAAAAAAGTTAAAAAAGG + Intronic
1072588480 10:96804193-96804215 AAAAAAAAAAAAGTTCAAAAAGG - Intergenic
1072651597 10:97300185-97300207 AAAAAGAAGAATGTAGACAAGGG - Intergenic
1073331527 10:102673071-102673093 AAAAAAAAAAAATTTGTCAATGG - Intergenic
1073521880 10:104138864-104138886 AAATATAAGAAACTGGATAAGGG + Intronic
1073659523 10:105459380-105459402 AGAAAAAAGAAAGTTGAACATGG + Intergenic
1073896660 10:108168293-108168315 CACAATCAGAAAATTGACAATGG + Intergenic
1074132819 10:110597147-110597169 AAAAAAAAAAAAGGTGACAGGGG + Intronic
1074156132 10:110801431-110801453 AAAAAAAAAAAAGTTTTCAATGG + Intronic
1074277667 10:112019644-112019666 AAAAATAAAAAAGCTGACAAGGG + Intergenic
1074367254 10:112869043-112869065 AAAAATAAGAAATTTTAAAGGGG + Intergenic
1074512871 10:114133941-114133963 AAGAAAAAGAAAGTGGAGAAAGG + Intronic
1074557899 10:114508712-114508734 AAAAATAAGAAAGAGTAAAATGG + Intronic
1074561311 10:114538105-114538127 AAAAAGAAGGAAGGGGACAAAGG + Intronic
1074789824 10:116875649-116875671 AAAAATAAGGGTGTTGAGAAGGG + Intronic
1075045694 10:119144647-119144669 AAAACTAAGCAAGTTGACCAAGG + Intronic
1075302033 10:121333466-121333488 AAAAAAGAGAAAGGTGTCAACGG + Intergenic
1075365825 10:121887730-121887752 AAAAATAAAACAGATGGCAATGG + Intronic
1075452872 10:122564922-122564944 AAAGAGAAGAAAACTGACAAGGG - Intronic
1075888803 10:125927544-125927566 AAAAAAAAAAAAGTTTATAATGG - Intronic
1076137186 10:128053251-128053273 AAAAATAAAAATGTTAAAAAAGG + Intronic
1076609887 10:131717511-131717533 AAAAAAAAAAAAGTGGGCAAAGG + Intergenic
1077652498 11:3985988-3986010 AAAAGTAAGAAAGATTTCAAAGG - Intronic
1077790007 11:5429125-5429147 AATAATAAGAATGTGGAAAATGG - Intronic
1078226008 11:9392158-9392180 AAAAAAAAAGAATTTGACAAAGG - Intronic
1078303063 11:10153659-10153681 GAAAATAATAAAGTTGAGAATGG + Intronic
1078745007 11:14104414-14104436 AAAAAGAAGACAGTTGCTAAAGG - Intronic
1078816560 11:14828478-14828500 AAACATAAAAAAGTGGGCAAAGG + Intronic
1078817629 11:14842277-14842299 AAAAAGAACACAGTTGGCAAGGG - Intronic
1078890657 11:15554984-15555006 AAAAATAGTTAAGTTGGCAACGG - Intergenic
1079412035 11:20197625-20197647 TAAAATAAGAAAGAAGTCAATGG + Intergenic
1079495676 11:21040988-21041010 AAATAGGAGAAAGTTGACAAAGG - Intronic
1079543223 11:21601147-21601169 AAAAGTAAGAACGTTGAACAGGG + Intergenic
1079579902 11:22050939-22050961 AAAAAAAACAAAGTGGGCAAAGG - Intergenic
1079588523 11:22154561-22154583 AAATATAAGCAAGTTGAATATGG + Intergenic
1079715835 11:23743402-23743424 ATAAATATGAAATTTGAAAATGG + Intergenic
1080077915 11:28174022-28174044 AAAAATGAGTAACTTTACAATGG - Intronic
1080136378 11:28859228-28859250 AAAAAAAAAAAAGTTGGTAATGG - Intergenic
1080197633 11:29630874-29630896 AAAAGTAAGAAAGTTGAGGGAGG + Intergenic
1080412707 11:32040910-32040932 AAAAAGAAGGAAGTAGAAAAAGG - Intronic
1080560236 11:33456568-33456590 AAAAATATGAAAATTGACCAGGG - Intergenic
1080854657 11:36101875-36101897 AAAAAAAAAAAAGATGACAGTGG - Intronic
1081230359 11:40578677-40578699 AAAAATAAAAGAGTTGAAAAAGG - Intronic
1081298320 11:41419538-41419560 GAAAATCAGAAAGGTCACAATGG + Intronic
1081345237 11:41977724-41977746 GAAAATAAGAAAGTAGACCATGG - Intergenic
1081386815 11:42481726-42481748 AAAAAAAAGAAAGTAGTGAATGG - Intergenic
1081412131 11:42772331-42772353 AAAAATAAGAAAGTAGTTTAAGG - Intergenic
1081422704 11:42890702-42890724 AAAAATAAAAAGGTCTACAAGGG + Intergenic
1082064836 11:47891635-47891657 AAAAAAAAAAAAATTTACAAAGG - Intergenic
1082686829 11:56248366-56248388 AAAGAAAAGAAAGTTGATACTGG - Intergenic
1082701458 11:56436810-56436832 AAGAATCAGAAAGTTAACAGGGG + Intergenic
1082915634 11:58433175-58433197 AAACATTAAAAAGTGGACAAAGG + Intergenic
1083073390 11:60010933-60010955 AAAAAAAAGAAAGAAGAAAAAGG - Intergenic
1083373183 11:62198091-62198113 AAAAATCAAAAAGTGGGCAAAGG - Intergenic
1083387088 11:62319239-62319261 AAAAATAAAAAATTTTAAAAAGG - Intergenic
1083502901 11:63127800-63127822 AAAAATCAAAAAGTGGGCAAAGG - Intronic
1083556189 11:63630437-63630459 AAAAAAAAAAAAGTTGCCAAAGG + Intronic
1084017448 11:66393609-66393631 AAAAAAAAGAAAGTTGACACAGG - Intergenic
1084594739 11:70110170-70110192 AAAAAAAAGAAAGTGAACATAGG - Intronic
1085070736 11:73542402-73542424 GAAAGTAAGAAAGTAGTCAAAGG - Intronic
1085131744 11:74045551-74045573 AGAAAAAAGAAAATTGAAAAAGG - Intronic
1085181415 11:74540078-74540100 AAAAAGAAGAGAGTAGAAAAGGG - Intronic
1085185037 11:74568651-74568673 TAAAATAAGACAGTTGCAAATGG - Intronic
1085243819 11:75081121-75081143 AAAAAGAAAAAAGTGGGCAAAGG - Intergenic
1086042831 11:82499548-82499570 AAAAAGAATAATGTTGACAGAGG + Intergenic
1086054741 11:82633413-82633435 AATAATAGGAAAGTTGAGGAGGG + Intergenic
1086112211 11:83212059-83212081 AAAAATAAATAAGTTGTCTATGG - Intronic
1086270605 11:85061061-85061083 AAAAATTAAAAAATGGACAAAGG - Intronic
1086326338 11:85704710-85704732 AAAAAAAAGAAAGGTAAAAAAGG - Intronic
1086388279 11:86333033-86333055 AAAGAGAAGAAAATTGACAGAGG + Intronic
1086447336 11:86881905-86881927 AAAAATAAAAAGGTTTACAAGGG - Intronic
1086450774 11:86914243-86914265 AAAAGAAAGAAAGTTGCAAAAGG + Intronic
1086582853 11:88419510-88419532 AAAAATATGAAAAAAGACAAAGG - Intergenic
1086736337 11:90310005-90310027 AAGAATCAGAAAGTATACAAAGG - Intergenic
1087510789 11:99090645-99090667 AAAAAAAAGAAATGTGTCAAAGG + Intronic
1087528570 11:99350231-99350253 AAAAGTAAGCAAATTAACAACGG + Intronic
1087652525 11:100884714-100884736 AGAAATAAAAGAATTGACAAGGG - Intronic
1087731509 11:101783468-101783490 AAAAATTAAAAAGTAGGCAAAGG - Intronic
1088026877 11:105196096-105196118 AAAAATCAGAATGTAGACTATGG + Intergenic
1088310738 11:108457642-108457664 CAAAAAAAGAAAGTTAAAAACGG + Intronic
1088362579 11:109006450-109006472 AAAAAATAAAAAGTAGACAAAGG + Intergenic
1088809405 11:113380768-113380790 AAAAAAAAAAAAGTGGGCAAAGG - Intronic
1089225204 11:116914197-116914219 AAAAAAAAAAAAATTGAGAAGGG - Intronic
1089415373 11:118284863-118284885 AAAAAAAAAAAAATTGAGAAAGG - Intergenic
1089763054 11:120742352-120742374 AAAAAAAAAAAAGTGGGCAAAGG + Intronic
1089856428 11:121549214-121549236 AAAAAGAAAAAATTTGACTAGGG - Intronic
1090155482 11:124433245-124433267 AAAAAAAAGAAAATTGCAAAAGG + Intergenic
1090538573 11:127675013-127675035 AAACATAAGGAACTTGACACAGG + Intergenic
1090566825 11:128003309-128003331 AAAAATAAAAAAGTTCTCCAGGG - Intergenic
1090576875 11:128114611-128114633 AGAGATAAGACAGTTGAAAATGG - Intergenic
1090620604 11:128557649-128557671 GAAAAAAAGAAAGTTGAGGATGG - Intronic
1090677594 11:129015345-129015367 AAAAATAAGTACATTGACATTGG - Intronic
1090761785 11:129843608-129843630 AAAAAAAAAAAAGTGGGCAAAGG + Intronic
1090883748 11:130858026-130858048 AAAAATAAGGAATACGACAATGG - Intergenic
1090904610 11:131064338-131064360 AGAAACAAGAAAATTCACAACGG + Intergenic
1090927983 11:131268590-131268612 AAAAATCAAAAAGTGGGCAAAGG - Intergenic
1091100683 11:132870132-132870154 AAGCATAAGAAAGCTGACATTGG + Intronic
1091204880 11:133813432-133813454 AAACATTAAAAAGTGGACAAAGG + Intergenic
1091412007 12:247976-247998 AAAAAGAAGAAAGCTAACAATGG + Intronic
1092110409 12:5958365-5958387 CAAAATAAGAAAGTTGATATAGG + Intronic
1092224812 12:6741199-6741221 AACCAAAAGAAAGTTGAAAATGG + Intergenic
1092254514 12:6918992-6919014 AAAAAAAAAAAAGTTGTCACTGG + Intronic
1092323324 12:7502202-7502224 AAAAATAGGAAAGAATACAAAGG - Intronic
1092349496 12:7744530-7744552 AAAAATATAAAACTTGGCAAAGG + Intronic
1092876153 12:12849832-12849854 AAAAATAAAAAAATTAACCAAGG + Intergenic
1092895862 12:13009824-13009846 AAAAAAAAAAAAATAGACAAAGG - Intergenic
1093107319 12:15104264-15104286 AAAAAAAAAAAAGCAGACAATGG - Intergenic
1093150234 12:15612094-15612116 AAAAAAAAAAAAGTAGGCAAAGG - Intergenic
1093222193 12:16435545-16435567 AATACTAAGAATGATGACAAAGG - Intronic
1093363188 12:18257686-18257708 AGAAAAAAGAAAGAAGACAAAGG + Intronic
1093366501 12:18305923-18305945 AAAAAAAAAAAAGATAACAATGG - Intronic
1093409993 12:18853472-18853494 AAAAAGAAGGAAGATGCCAAAGG - Intergenic
1093498743 12:19785557-19785579 AAAAAAAAAAAAATTGGCAATGG - Intergenic
1093680917 12:22002321-22002343 ATTATTAAGAAAGTTCACAAAGG - Intergenic
1093825614 12:23683910-23683932 AAAAATATTGAAGTTAACAAAGG + Intronic
1093869375 12:24269452-24269474 CAAAATAAGAAACTTCACATAGG - Intergenic
1094025224 12:25954918-25954940 AAAAATAAGAAAATAAAGAAGGG - Intergenic
1094138304 12:27152566-27152588 AAAAATAAGAAAGAGGCCAGTGG - Intergenic
1094335809 12:29351834-29351856 AAAAATTAGAAAATTAAAAATGG - Intronic
1094401335 12:30063468-30063490 AAAAATAAAAAAATTTAAAAAGG + Intergenic
1094558295 12:31524721-31524743 AAAAAAAAGAAATTTGAGCAAGG + Intronic
1094809183 12:34121406-34121428 AAAGACAAGAGAGGTGACAAAGG - Intergenic
1095040700 12:37437057-37437079 AAAAATAAAAAGGTGGACCATGG + Intergenic
1095299695 12:40569253-40569275 AAAAATAATAATGTTTACAAGGG + Intronic
1095411000 12:41922828-41922850 GAAAATAAGAAATTTCACTAAGG - Intergenic
1095539090 12:43287362-43287384 AAAAATAACAAAATGAACAAAGG - Intergenic
1095545441 12:43362834-43362856 AAAAAAAAAAAAGGTGAAAAGGG + Intronic
1095560359 12:43557384-43557406 AAGAATGAGAAAATGGACAATGG - Intergenic
1095586273 12:43853271-43853293 AAAAATAAAAAAGGTAACACTGG - Intronic
1095695640 12:45140962-45140984 AAAAATAATAAAGATAAAAACGG + Intergenic
1095704223 12:45220380-45220402 AAAAATGTGACAGTTGAAAAGGG - Intronic
1095898050 12:47300548-47300570 AAAAAAAAAAAAGTTCACAATGG - Intergenic
1095904451 12:47363202-47363224 AGAAATAAGAAAGCTGTTAATGG + Intergenic
1095927846 12:47596679-47596701 AAAAAAATGAAACTTTACAATGG - Intergenic
1096041253 12:48519802-48519824 AAAAAAAAAAAAGTGGGCAAAGG - Intronic
1096337612 12:50768273-50768295 AAATATAAGACAGTTCACAGAGG - Intronic
1096662680 12:53137734-53137756 AAAAATAAGGAAGGTTATAAGGG - Intergenic
1097113905 12:56682997-56683019 AAAAAAAAAAAAATTTACAAAGG + Intronic
1097134714 12:56842418-56842440 AAACATTAAAAAGTGGACAAAGG - Intergenic
1097373340 12:58810750-58810772 AGAAATAAAAAATATGACAAAGG + Intronic
1097518989 12:60644911-60644933 AAAGATAAGTAAGTTAATAAGGG - Intergenic
1097543150 12:60965032-60965054 AAAAAAAAAAAAGTTCAGAAGGG + Intergenic
1097701494 12:62825056-62825078 AAAAATCAAAAAGTGGGCAAAGG + Intronic
1097808197 12:63988549-63988571 AAGAAAATGAAAGTAGACAATGG - Intronic
1097847005 12:64377183-64377205 AAAAAAAAAAAAGTGGGCAAAGG - Intronic
1097904128 12:64902854-64902876 AAAAATTGAAAAGGTGACAAAGG - Intergenic
1098056963 12:66517441-66517463 AATAATAAGAATGTTGAGAATGG + Intronic
1098111794 12:67129863-67129885 AAAACTGAGAAACTTAACAAAGG + Intergenic
1098178475 12:67819549-67819571 AACAATAAGAAGTTTAACAAAGG + Intergenic
1098491065 12:71079175-71079197 AAAAATAAAAATGTATACAATGG - Intronic
1098593234 12:72239214-72239236 AAAAATCAAAAAGTGGGCAAAGG - Intronic
1098594663 12:72257809-72257831 GAAAATAAAAAAGTTTAAAAAGG + Intronic
1098649252 12:72943333-72943355 AAAAATTAGAAAATGGCCAAAGG - Intergenic
1098700901 12:73624400-73624422 AAAAATAAGAAAGAAAACTATGG + Intergenic
1098925359 12:76343390-76343412 AAAAATAAGAAGGTCTATAAAGG + Intergenic
1099107450 12:78514624-78514646 AAAAATCAAAAAGTGGGCAAAGG + Intergenic
1099303505 12:80926940-80926962 AAAAAAAAAAAAATTGACATTGG + Intronic
1099374937 12:81887702-81887724 AAAAATAAGAAAGCAAACAAAGG - Intergenic
1099391372 12:82083712-82083734 AAAAAAAAGAAAGATAATAAGGG - Intergenic
1099530148 12:83769048-83769070 AAAAATCAGAAAGAGGAGAATGG + Intergenic
1099540238 12:83899226-83899248 AAAAATCAAAAAGTGGACAAAGG - Intergenic
1099546617 12:83990038-83990060 AAAAATAAGTAAGTGAAAAATGG - Intergenic
1099558095 12:84136398-84136420 TAGAATAAGAAAGTGGAGAAAGG - Intergenic
1099604308 12:84782837-84782859 AAAACAAAGAAATTTCACAATGG - Intergenic
1099781134 12:87197105-87197127 AAAACTCAGAAAGTTTGCAATGG + Intergenic
1100220379 12:92498507-92498529 AAAAAGAAGGAAATTGGCAAAGG + Intergenic
1100772489 12:97938694-97938716 AAAAATAATATATTTGACACTGG - Intergenic
1100894596 12:99166818-99166840 AAAAAGAACAAAGTTGACAAAGG + Intronic
1100980006 12:100156410-100156432 AAAAATAAAAAATTTTAAAAAGG - Intergenic
1101267720 12:103107871-103107893 CAAAATTAGAAAGTTTAAAAGGG + Intergenic
1101388367 12:104277865-104277887 AAAAAAAAGAATCTTGCCAAAGG - Intronic
1101393136 12:104321528-104321550 AAAATTTAGAAAGTTGACAAAGG - Intronic
1101686063 12:107022743-107022765 ATAAATTAGAAACTTGAAAATGG - Intronic
1101966134 12:109283254-109283276 AAAAATATAAAAGTTATCAATGG + Intronic
1102184861 12:110940115-110940137 AAAAATAAAAAAATTAACCATGG - Intergenic
1102242373 12:111332798-111332820 AAAAACAAGAAATTTTACAGTGG + Intronic
1102275695 12:111580516-111580538 AAAAAAAAAAAAGATGACAACGG + Intronic
1102369817 12:112373193-112373215 AAAGTTAAGTAACTTGACAAAGG - Intronic
1102377281 12:112432855-112432877 AAAAAAAAAAAAGTTAAAAATGG - Intronic
1102475849 12:113187766-113187788 AAAAAAAAAAAAATTGAAAATGG + Intronic
1102564748 12:113788869-113788891 TAAAATAAGAATATAGACAAAGG - Intergenic
1102769248 12:115459138-115459160 AAAAAAAAGAAAATTAAGAAGGG + Intergenic
1102769422 12:115461823-115461845 AAGAATAAGAGAGTTAAAAAAGG - Intergenic
1102877929 12:116462080-116462102 AAAAAAAAGCAACTTGACCATGG + Intergenic
1103145908 12:118595774-118595796 AAAAAAAAGGAGGTTGAGAAGGG + Intergenic
1103420274 12:120775309-120775331 AAAAATAAAAAAATTAACCAAGG - Intronic
1103577183 12:121886885-121886907 ATAAATAATAAAGTTAAAAAGGG - Intergenic
1103747880 12:123138440-123138462 AAAAATAAAAATGTTTAAAATGG + Intronic
1103873537 12:124109303-124109325 AAGAAGAAGTAAATTGACAAAGG + Intronic
1104152454 12:126096640-126096662 AAAAAAAAAAAAGTGGACTAAGG - Intergenic
1104287884 12:127441767-127441789 AAAAAGAACAAAGTTTACAGAGG + Intergenic
1104435558 12:128753468-128753490 AAAATTGACAAAATTGACAATGG - Intergenic
1104868622 12:131977493-131977515 AAAAAAAAAAAACTTGATAAAGG - Intronic
1105417540 13:20226298-20226320 AAAAAAAAGAAAATTGAAATGGG + Intronic
1105591334 13:21795506-21795528 AAAATTAGGAAAGTTGTCACAGG - Intergenic
1105900848 13:24751772-24751794 AAAAAAAAGATACTTGAAAATGG - Intergenic
1106011886 13:25831921-25831943 AAAAATAAAGAAATTGACTATGG - Intronic
1106171385 13:27291374-27291396 AAAAAAAAAAAAGTTGACCCAGG + Intergenic
1106259192 13:28050524-28050546 AAAAATGAGAAAGAAGATAAAGG + Intronic
1106332409 13:28751337-28751359 AAAAAAAAGAAAGGGGAAAAAGG + Intergenic
1106465473 13:30010396-30010418 AAAAATTAGAAAGTTGAAGATGG + Intergenic
1107179318 13:37440142-37440164 AAAAATACTAAAATTTACAAAGG - Intergenic
1107204643 13:37768851-37768873 AAAAAGCAGAAAGTAGGCAAAGG - Intronic
1107323438 13:39213644-39213666 AAAAAAAAGAAATTTGAAAGAGG - Intergenic
1107370437 13:39740756-39740778 AAATATAAGAAATGTCACAATGG - Intronic
1107713377 13:43172662-43172684 AAAAAAAAAAAAGTAGGCAATGG - Intergenic
1107922375 13:45222372-45222394 ACAAATAAAAAACTTAACAAGGG - Intronic
1108035663 13:46288341-46288363 ATAAATAAGAAAATTAAAAATGG - Intergenic
1108093706 13:46878575-46878597 AAAAATGAGAAGGTAGAGAATGG + Intronic
1108194411 13:47978004-47978026 GAAAATAAGAAAGAACACAAAGG + Intronic
1108338985 13:49477450-49477472 AAAAATAAAAGAGTCTACAATGG + Intronic
1108835936 13:54548742-54548764 AAAAATAAGAAAGAAAAGAAAGG + Intergenic
1109001903 13:56815187-56815209 AAAAAAAAAAAAGAAGACAAAGG + Intergenic
1109089381 13:58020847-58020869 AAAAATAAGAATACTTACAAAGG - Intergenic
1109217494 13:59606258-59606280 AAAAAAAAGAAAGCTTAAAAGGG + Intergenic
1109540872 13:63777263-63777285 AAACATCAGAAAGTGGGCAAAGG - Intergenic
1109574404 13:64234299-64234321 CAAAATAAGAAAGTAAACTATGG + Intergenic
1109861913 13:68211204-68211226 AAAAAAAAGAAAGTTTTCTAAGG + Intergenic
1109980797 13:69903616-69903638 AAAAAAAAGAATGTGAACAAGGG - Intronic
1110184435 13:72656746-72656768 AAAGAAAAGAAAGAGGACAAAGG + Intergenic
1110215188 13:73017354-73017376 AAAAGTAAGACAATTCACAATGG - Intergenic
1110310614 13:74044864-74044886 AAAAAAAAAAAAGTTACCAATGG + Intronic
1110821050 13:79916624-79916646 TAAAATAAAGAAGTTGACACGGG + Intergenic
1110840417 13:80135598-80135620 AAAAACAAAAAAGTGGGCAAAGG + Intergenic
1111189868 13:84792929-84792951 AAATTTAAGTAAGTTGAAAAGGG + Intergenic
1111287582 13:86115674-86115696 GAAAGTAAGAAACTTGAAAAAGG - Intergenic
1111492184 13:88994019-88994041 AACAACAAAAAACTTGACAAAGG - Intergenic
1111656858 13:91164698-91164720 AATAAAAAGAAAGTAGACAGCGG - Intergenic
1111877523 13:93915776-93915798 AAAAATAAGAGGGTGGTCAAGGG - Intronic
1111942930 13:94632256-94632278 AAAAATCAGAAAGTTGAAAAAGG + Exonic
1112055419 13:95685956-95685978 AAAAAAAAAAAAGTGGGCAAAGG - Intronic
1112064574 13:95779585-95779607 CAAAACAAGAAAGAGGACAAGGG - Intronic
1112107517 13:96257522-96257544 AAAATTAAGTAACTTGTCAAGGG - Intronic
1112186099 13:97129058-97129080 AAAAAAAAAAAAATTGTCAATGG + Intergenic
1112296797 13:98194954-98194976 AAAAACAAGAAAGCTGAGAAGGG - Intronic
1112500004 13:99935485-99935507 AAAAATAAGACTGGGGACAATGG + Intergenic
1112878530 13:104076818-104076840 AAAAATAACAATATTGAAAACGG + Intergenic
1112883769 13:104143307-104143329 AAAAATAAGAAAATTGAACATGG + Intergenic
1113016544 13:105834470-105834492 GAAAATAAGAAGGATGACAAAGG - Intergenic
1113728247 13:112621287-112621309 AAAAAAAAAAAAGTGGACCAGGG + Intergenic
1114195557 14:20473118-20473140 AACAGTAATAAAGTTGACAAAGG - Intronic
1114374329 14:22127653-22127675 AAAGAAAAGAAAGGTGTCAAGGG - Intergenic
1114448305 14:22806885-22806907 AAAAAAAAAAAAGTTAACAGTGG - Intronic
1114514942 14:23292921-23292943 AAAAATAAAAAAATTAAAAAAGG + Intronic
1114917018 14:27281435-27281457 AAATATAAAAAAGATGAAAATGG + Intergenic
1114972599 14:28052101-28052123 AAAAAAAAGAAAGTGGCCATGGG + Intergenic
1115108809 14:29795887-29795909 AAAAAGGACAAAGTTTACAAAGG + Intronic
1115128870 14:30028686-30028708 AACAAAAAGAAAGTTGAAATAGG - Intronic
1115215474 14:31009595-31009617 AAAAAAAAAAAAATTGGCAATGG - Intronic
1115235530 14:31206623-31206645 AAAAATAAAAAAATTAAAAAAGG + Intronic
1115286434 14:31718223-31718245 AAATATAACAAAATTGACAGAGG - Intronic
1115389893 14:32842526-32842548 AAAAATAAAAAATTAGACACTGG + Intergenic
1116112149 14:40599540-40599562 AAAAATAAGGATGTTGATCAAGG - Intergenic
1116125756 14:40782606-40782628 AAGAATAACCAAGTTAACAATGG + Intergenic
1116196697 14:41736428-41736450 AAAAATCAAAAAGTGGGCAAAGG - Intronic
1116296006 14:43110816-43110838 AAGAATAAGAGAAATGACAAGGG - Intergenic
1117296225 14:54381869-54381891 ATAAATCAGAAAGTAGAGAAGGG + Intergenic
1117347680 14:54849963-54849985 AAACAAAAAAAAATTGACAAAGG - Intronic
1117347727 14:54850273-54850295 ATATATAAAAAAATTGACAAAGG - Intronic
1117475584 14:56091482-56091504 AAAAATAAGTAAGTAAGCAAAGG + Intergenic
1117484374 14:56179407-56179429 AAAAATAAAAACATTAACAAAGG - Intronic
1117774428 14:59168138-59168160 AAAAATCGGAAAGTTGTCAAAGG - Intergenic
1117888119 14:60386944-60386966 AAAAATCAAAAAGTGGGCAAAGG + Intergenic
1117893112 14:60448351-60448373 AAAAATAAAAAAGTGGGCAAAGG + Intronic
1117906824 14:60598048-60598070 AAAAATAATAAAGTTGGAAAGGG + Intergenic
1117909798 14:60625994-60626016 AAAAAAAAAAATGTTGACATTGG + Intergenic
1117941719 14:60973937-60973959 AAAAATTAGAAAATTTAAAATGG - Exonic
1118004680 14:61554686-61554708 ACAAATGAGAAAGTTGAAATTGG - Intronic
1118124907 14:62890709-62890731 AAAAAAAAAAAAGTGGGCAAAGG + Intronic
1118147870 14:63159584-63159606 GAAGATAAGAAATTTGTCAAGGG - Intergenic
1118225229 14:63892715-63892737 AAAAAAAAGAAAGTACACCAAGG - Intronic
1118639718 14:67781090-67781112 AAAAATAACAAAATTAACATTGG - Intronic
1118651246 14:67897641-67897663 AAAAAAAAAAAAGTGAACAAGGG - Intronic
1118952883 14:70450422-70450444 AAACATAAGAAGGTTAAGAAAGG - Intergenic
1119011021 14:70988972-70988994 AAAAAAAGGAAAGCTGACTAAGG - Intronic
1119202542 14:72767486-72767508 AAAAATAAAAAAGCTCTCAATGG + Intronic
1119223059 14:72924906-72924928 AGAAAAAAAAAAGTAGACAATGG - Intergenic
1119286555 14:73459325-73459347 AAAAAAAAAAAAGTTGCTAATGG - Intronic
1119510304 14:75206117-75206139 AAAGAAAAGAAAGGTGAGAATGG + Intergenic
1120334124 14:83131492-83131514 AAAAAAAAAAAAATTGCCAATGG + Intergenic
1120355706 14:83430731-83430753 AAGAAAAAGAAAGTTCACTATGG + Intergenic
1120358336 14:83462041-83462063 CCAAATAAGAAAATTTACAATGG + Intergenic
1120369580 14:83615426-83615448 AAAAAAAAAAAAGTAGATAAGGG - Intergenic
1120380372 14:83770570-83770592 AAAATTAAGAAGAATGACAAAGG + Intergenic
1120747786 14:88167467-88167489 AAAAGAAAGCAAGTTGAAAAGGG + Intergenic
1121348288 14:93152546-93152568 AAAAAAAAAACACTTGACAAAGG + Intergenic
1121599044 14:95189266-95189288 AAACATAAGAGAGTTGAAAGTGG + Exonic
1121818957 14:96950637-96950659 AAAAATAAGAAAGCACTCAAAGG - Intergenic
1121845907 14:97171953-97171975 AAAAATAAGAAAACACACAAGGG - Intergenic
1122103738 14:99435057-99435079 AAAATTAACAAAGTAGTCAAAGG + Intronic
1122758819 14:104004964-104004986 AAAAAAAAGAAGGAGGACAAAGG - Intronic
1122954520 14:105064333-105064355 AAAAATAAGAAAGTTGACAATGG - Intronic
1123051284 14:105545366-105545388 AAAAAAAAAAAAGTTGTAAAAGG + Intergenic
1123199436 14:106648346-106648368 ATGAATAAGAAAGAAGACAAGGG - Intergenic
1202928536 14_KI270725v1_random:17197-17219 AGCAAAAAGAAAGCTGACAATGG + Intergenic
1123793077 15:23742770-23742792 AAAAATCAGAAAATATACAAGGG - Intergenic
1123916947 15:25040658-25040680 ATAAATGACAAAGGTGACAAAGG + Intergenic
1124056708 15:26247144-26247166 AAAAAAAAAAAAATTGACAAAGG - Intergenic
1124159494 15:27255578-27255600 AAAAAAAGGAAAGATGAAAATGG - Intronic
1124367626 15:29084142-29084164 AAAAATAAGAGAATTCACTAAGG - Intronic
1124698153 15:31884860-31884882 AAAAAAAAGTAAATTAACAATGG - Intergenic
1124698203 15:31885179-31885201 AAAAAAAAGTAAATTTACAATGG - Intergenic
1124780846 15:32631664-32631686 AAAAATAAAAAATGTGTCAATGG - Intronic
1124933868 15:34151426-34151448 AAAAAAAAAAAAGTAGGCAAAGG - Intronic
1125043222 15:35215951-35215973 AAAGATAAGAAAGATGCCTATGG - Intergenic
1125121153 15:36160094-36160116 AAAAATAAGATAAATGACACTGG + Intergenic
1125370345 15:38969119-38969141 AAAAATTAAAAAGTGGGCAAAGG + Intergenic
1125387004 15:39148414-39148436 GAAAATATGAAAGTAGTCAATGG - Intergenic
1125651279 15:41320149-41320171 AAAAATAATCAAGTTGACTGGGG + Intronic
1125988306 15:44078047-44078069 AAAAATAAGATTATTGAGAATGG + Intronic
1126386443 15:48098477-48098499 AAAGTTAAGAAAATTGACCAAGG - Intergenic
1126447846 15:48769616-48769638 AAAAAATAGTAAGTTTACAATGG - Intronic
1126481860 15:49132977-49132999 AAAAAAAAAAATGTTTACAATGG - Intronic
1126659728 15:51020998-51021020 AAAAAAAAAAAAGTAGGCAAAGG - Intergenic
1126712478 15:51475021-51475043 AAAAAAAAGTAACTTTACAATGG + Intronic
1126816219 15:52457428-52457450 AAAAAAAAAAAAGTAGACAAAGG + Intronic
1127163455 15:56217097-56217119 AAAGAAAATAAATTTGACAATGG - Intronic
1127452084 15:59126369-59126391 AAACATCAAAAAGTAGACAAAGG - Intergenic
1127608428 15:60613768-60613790 AAAAAAAAAAAAGGTGTCAAAGG + Intronic
1127721616 15:61707063-61707085 AAGAATAAAAAAGTTGAATAAGG + Intergenic
1128189365 15:65676772-65676794 AAAAACAAGCAATTTTACAAAGG + Intronic
1128207686 15:65867888-65867910 AAAAAAAAAAAAGTGGAAAATGG - Intronic
1128296458 15:66524807-66524829 AGAAAGAAGAAAGGTGAGAAAGG - Intronic
1128368104 15:67019037-67019059 AAAAAAAAGACAGCTGACACAGG + Intergenic
1128778844 15:70344702-70344724 AAAAATAAAAGTGTTGACACAGG + Intergenic
1129527719 15:76232034-76232056 AAAAATAACAAACTTCTCAAAGG + Intronic
1129790003 15:78334728-78334750 AAAAATAGGAAAGGTGACTCAGG - Intergenic
1129974076 15:79806656-79806678 AAAAAAAAAAAAATTTACAACGG + Intergenic
1130165057 15:81447368-81447390 AAAATTAAAAAAGTAGACATTGG + Intergenic
1130731258 15:86494413-86494435 CAACATAAGAAAGTTGACTATGG + Intronic
1130758696 15:86794977-86794999 AAAAGCAAGAAAATTGCCAAAGG + Intronic
1130840094 15:87690959-87690981 AAAAAAAAAAAAGTAGACATGGG + Intergenic
1131012464 15:89030145-89030167 AAAAAAAAAAAAGTTCACAGTGG + Intergenic
1131235576 15:90693974-90693996 AAAAAAAAAAAAGTTGTCAGAGG + Intergenic
1131581506 15:93647800-93647822 AGAAATCAGAAAGTTGTCAGGGG + Intergenic
1131655705 15:94456329-94456351 AAAAATTAGACAGTTGAAATAGG + Intronic
1131850027 15:96530356-96530378 AAATATAAAAATATTGACAAGGG - Intergenic
1131917388 15:97283769-97283791 AAATATAATAAAGTAAACAAAGG - Intergenic
1131922365 15:97342647-97342669 ACAAATCTGAAAGCTGACAAAGG + Intergenic
1131954143 15:97713552-97713574 ATAAATAAAAGAGTTGAAAATGG - Intergenic
1131969797 15:97880449-97880471 AAACACCAGAATGTTGACAATGG - Intergenic
1132425815 15:101716012-101716034 AAAAAAAAGAAAATAGGCAAAGG - Intronic
1132801306 16:1755525-1755547 AAAAATAAGAACGTCAACAAAGG + Intronic
1132921107 16:2393598-2393620 AACAAAAAGAAAATTGAGAAAGG + Intergenic
1133070080 16:3240602-3240624 AAAAATAAAAAAATTAAAAAAGG - Intergenic
1133333872 16:4994006-4994028 GCAAATAAGAAAATGGACAAAGG - Intronic
1133387570 16:5382382-5382404 AAAAAAAAAAAAGATGAAAATGG - Intergenic
1133419512 16:5633855-5633877 AAAAAAAAAAAAGTAGACAAAGG + Intergenic
1133799902 16:9076694-9076716 AAAAATAAGAAAGAAAAAAAAGG + Intergenic
1133937530 16:10281296-10281318 AAAAATAAAAAATATAACAAAGG - Intergenic
1134128185 16:11630560-11630582 AAAAAAAAAAAAGTTGGCCAGGG - Intronic
1134206929 16:12246131-12246153 AAGGATAACAAAGTTGACATAGG - Intronic
1134378129 16:13698576-13698598 AAGAATAAAAATGGTGACAAAGG + Intergenic
1134813563 16:17187581-17187603 AAAAAAAAGAAAGATTAAAAAGG + Intronic
1134887831 16:17809656-17809678 AAAACTAAGAATGATGACATAGG + Intergenic
1135098669 16:19586660-19586682 TAAAATGAGAAAATTGAGAATGG - Intronic
1135106148 16:19651601-19651623 AAAGAGAAGCAAGGTGACAAAGG - Intronic
1135127043 16:19819495-19819517 AAAAAAAAAAAATTTCACAAGGG + Intronic
1135169869 16:20174327-20174349 TAAAATATGAAAGTAGACACTGG - Intergenic
1135251785 16:20906566-20906588 ACAAATAAGAAATGGGACAAAGG - Intronic
1135506907 16:23046339-23046361 CAAAATAAGTAATTTAACAAAGG - Intergenic
1135685095 16:24492504-24492526 AAAAAAAAGAAAATTGTCATGGG + Intergenic
1135691808 16:24543831-24543853 GAGAGTAAGAAAGGTGACAAGGG - Intronic
1135937566 16:26794086-26794108 AAAAATAAAAAATTTTAAAAAGG + Intergenic
1136039467 16:27566537-27566559 AAAAAAAAGGAAGTTGAAATGGG + Intronic
1136043219 16:27596529-27596551 AAAAAGAAAAAAGTTGTCAATGG - Intronic
1136523465 16:30812807-30812829 AAAAAAAAAAAAGATTACAAAGG + Intergenic
1136688335 16:32009262-32009284 AAAAAAAAAAAAGATGATAAGGG - Intergenic
1136788933 16:32952817-32952839 AAAAAAAAAAAAGATGATAAGGG - Intergenic
1136880879 16:33901117-33901139 AAAAAAAAAAAAGATGATAAGGG + Intergenic
1137501839 16:49017880-49017902 AAAAAAAAAAGAGTTGACCAAGG - Intergenic
1137535923 16:49325803-49325825 AAAAATAAGAAACATGCAAATGG - Intergenic
1137827082 16:51507671-51507693 ATAAATAAGACAATTAACAATGG + Intergenic
1137907943 16:52344119-52344141 AAAAATAACAAAGATAAAAATGG + Intergenic
1137962358 16:52895367-52895389 GAAAATAGGAAAGGGGACAAAGG - Intergenic
1138001098 16:53280687-53280709 AAAAAAAAGAAATTTGTCTAAGG + Intronic
1138668291 16:58591758-58591780 AAAAAAAAAAAAGTTAACTATGG + Intronic
1138789907 16:59891169-59891191 AATAATTAGAAATTTAACAAAGG - Intergenic
1138824679 16:60304624-60304646 AAAAAGAAGAAATTTAACCAAGG + Intergenic
1138955896 16:61970412-61970434 AAAAATGGGAAACTTGATAATGG + Intronic
1139155051 16:64431489-64431511 AAAAAAAAAAAAGGTCACAAAGG - Intergenic
1139223439 16:65209663-65209685 AAAAAAAAAAAAGTTGAGAAAGG - Intergenic
1139424210 16:66869035-66869057 AAAAAAAAAAAAGTTGACCAAGG + Intronic
1139562303 16:67750747-67750769 AAAAAAAAGAAAGTGAAAAAAGG - Intronic
1139602846 16:67997329-67997351 AAAAATAAAAAATTTGGCCAAGG - Intronic
1139715134 16:68807118-68807140 GGAAATAAGAGAGTTGAAAATGG - Intronic
1139718704 16:68835538-68835560 AAATAAAACAAATTTGACAATGG - Exonic
1139748657 16:69094970-69094992 AAAAAAAAAAAAGTTAACAATGG - Intergenic
1139768451 16:69252894-69252916 AAAAAAAAAAAAACTGACAAAGG - Intronic
1140394559 16:74615527-74615549 AAAAAAAAGAAAGTTGGCCAAGG + Intergenic
1140591851 16:76363059-76363081 AAAAAAAAAAAAATAGACAATGG + Intronic
1140766182 16:78159979-78160001 AAAACTAATAAAATTGATAAAGG - Intronic
1140808814 16:78557619-78557641 AAAAATAAGACAGTTTTCAGTGG - Intronic
1141985717 16:87578449-87578471 AAAAAAAAGAAAGATATCAACGG - Intergenic
1203091133 16_KI270728v1_random:1214306-1214328 AAAAAAAAAAAAGATGATAAGGG - Intergenic
1143086648 17:4421133-4421155 AAAAAAAAGAAAGTGGCCACGGG - Intergenic
1143094193 17:4468303-4468325 AAAAAAAAGAAAGAGGACAAAGG + Intronic
1143226084 17:5304588-5304610 AAAAAAAAAAAAGTAGGCAATGG + Intronic
1143257501 17:5572718-5572740 AAAAAAAAAAAAGTGGACAAAGG + Intronic
1143304370 17:5934116-5934138 AAGAAAAAAAAAGTTGACATGGG - Intronic
1143643936 17:8217420-8217442 AAAAAAAAGAAATTTTACACTGG - Intergenic
1144413714 17:15025270-15025292 AAAAGTAAGAACATTGAAAAGGG - Intergenic
1144454631 17:15408691-15408713 AAAAATAAAAATGTTTAAAATGG + Intergenic
1144501350 17:15788093-15788115 AAAAAGAAGAAATTAGAGAAGGG - Intergenic
1144549567 17:16228040-16228062 AAAAAAAAAAAAGTTTAAAATGG - Intronic
1145163525 17:20590767-20590789 AAAAAGAAGAAATTAGAGAAGGG - Intergenic
1145247343 17:21278185-21278207 AAAAAAAAAAAAGCTGATAATGG + Intergenic
1145377139 17:22361310-22361332 AAAAATAAAAAGGTGGACCATGG - Intergenic
1145762259 17:27431996-27432018 CAAAATAAGAAATTTAACATGGG + Intergenic
1146089319 17:29860428-29860450 AAAAAAAAAAAAGTGGGCAAAGG - Intronic
1146103406 17:30008168-30008190 GAAAATAAGAAAATTGTTAAAGG + Intronic
1146170948 17:30632684-30632706 AAAGATTAGAAAGTTTAGAAAGG + Intergenic
1146331668 17:31932957-31932979 AAAAAAAAAAAAGTCAACAAAGG - Intergenic
1146344400 17:32048688-32048710 AAAGATTAGAAAGTTTAGAAAGG + Intronic
1146357176 17:32143715-32143737 TAAAATAAGAAAGTGGGCCAGGG + Intronic
1146454753 17:33000568-33000590 AAAAAAAAAAAAGTGGGCAAAGG - Intergenic
1147149321 17:38504968-38504990 AAAAAAAAAAAAGATGATAAGGG - Intronic
1147682250 17:42257751-42257773 AAAAAGAAGAAAGTAAACATTGG - Intronic
1147692538 17:42325457-42325479 AAAATCAAGAAAGTTGGGAAAGG + Intronic
1147694762 17:42343180-42343202 AAAAAAAACAAAGGTTACAAAGG + Intronic
1148107400 17:45126649-45126671 AAAAAAAAAAAAGTATACAATGG - Intronic
1148257365 17:46147057-46147079 AAAAATAAAAAATTTTAAAAGGG + Intronic
1148879484 17:50714789-50714811 AAAAAAAAGAAAGGTGACTGAGG + Intergenic
1148882418 17:50739945-50739967 GAAAATAATAAAGTCGGCAATGG + Intronic
1148884579 17:50762581-50762603 AAAAACAAAAAAATTGCCAAAGG + Intergenic
1148973374 17:51504702-51504724 AAAAATATGACATTTGAAAATGG - Intergenic
1149426491 17:56559433-56559455 AAAAAAAAGAATTTTAACAAGGG + Intergenic
1149779203 17:59383008-59383030 AAAAATATGAAAATGAACAAGGG + Intronic
1150454043 17:65292856-65292878 AAAGATAAGAAAGGTCACCATGG - Intergenic
1150549776 17:66198609-66198631 AAAGATAGAAAAGCTGACAAGGG + Intergenic
1150614587 17:66759528-66759550 AAAAAAAAAAAAATGGACAAGGG + Intronic
1150812052 17:68364200-68364222 AAAAACAAGTAAGATGACAGAGG - Intronic
1150942955 17:69713264-69713286 AAAAATTAGAAATTTGATACAGG + Intergenic
1151046957 17:70931751-70931773 AAAAAAAAAAAAGTTTTCAAAGG - Intergenic
1151113007 17:71701614-71701636 AAAAAAAAGAAAGAAGACAAAGG + Intergenic
1151195518 17:72428621-72428643 AAAAATACTTAAGTTTACAATGG + Intergenic
1151365752 17:73614989-73615011 AAAAAAAAGAAAGTTTGTAAAGG + Intronic
1151582051 17:74985560-74985582 AAAAGAAAGAAAGTTGACTAGGG - Intergenic
1152270009 17:79319031-79319053 AAAAAAAAGAAATTTGACTGTGG + Intronic
1152347666 17:79763354-79763376 AAAAATAAAAAATTTTAAAAAGG + Intergenic
1152415137 17:80154961-80154983 AAAAAAAAAAAGTTTGACAAGGG + Intergenic
1153012610 18:553126-553148 AAAAATAAAAGAATTTACAATGG + Intergenic
1153034359 18:745773-745795 AAAATTAGGAAACTTGACAATGG - Exonic
1153261963 18:3232899-3232921 AAAAATAGGAAAATTGGCCAAGG - Intergenic
1153422521 18:4923905-4923927 AAAAATAAAAAAGCTTAAAATGG + Intergenic
1153746326 18:8183766-8183788 AAAAATAAACAGGTAGACAAAGG + Intronic
1153836319 18:8967487-8967509 AAAAAAAAGAAAACTCACAAGGG + Intergenic
1154067385 18:11120626-11120648 AAAAAGAAGAAAATTTAAAAAGG + Intronic
1154136339 18:11782682-11782704 AAAAATAAGAAAATGAAAAAGGG + Intronic
1154266790 18:12885262-12885284 AAAAAAAAAAAAGTTGGCTACGG + Intronic
1154381652 18:13857073-13857095 TAAAATATGAAATGTGACAAAGG - Intergenic
1154407854 18:14111569-14111591 AATAATAACAAAGATGAAAAAGG + Intronic
1154511243 18:15104749-15104771 AAAAAAAAAAAAGTGGGCAAAGG + Intergenic
1155102696 18:22628602-22628624 GAAAAGAAAAAAGTTTACAAAGG + Intergenic
1155200224 18:23510647-23510669 AAAAAAAAAAAAGTGGGCAAAGG + Intronic
1155361370 18:25006499-25006521 AAAAAAAAAAAAGTTGGCCAGGG - Intergenic
1155494518 18:26429509-26429531 AAAAAAAAGAAAAGTGACTATGG + Intergenic
1155565586 18:27130828-27130850 AAGAAAAAGCAAGTTGCCAAAGG + Intronic
1155798967 18:30075861-30075883 AAAAAGATGAGAGATGACAAAGG - Intergenic
1155882639 18:31169042-31169064 AAAAATTAGAAAGATGAAAATGG + Intergenic
1155964271 18:32020922-32020944 AAAAAAAAGAAAGTTTTGAAAGG + Intronic
1156073544 18:33243768-33243790 AAATATGTGAAAGATGACAAAGG + Intronic
1156208124 18:34907917-34907939 AAAAATAAGAAAGAAGACCCAGG + Intergenic
1156477336 18:37414159-37414181 AAAAATAAGAAACTTGAAACTGG - Intronic
1156692474 18:39724805-39724827 AAGAATCTGAAAGTTGGCAAGGG + Intergenic
1156970736 18:43151456-43151478 AAAAAAAAAAAAATTGAAAAAGG + Intergenic
1157034397 18:43953655-43953677 AAAAAGAAGAAACTGGCCAAAGG - Intergenic
1157056880 18:44239978-44240000 AAAAATAAAAATGTTGAAAGTGG + Intergenic
1157202703 18:45672533-45672555 AAAAAAAAAAAAATTCACAAAGG + Intronic
1157291890 18:46415556-46415578 AAAAATAAAAAAGTTGCTGAAGG + Intronic
1157310800 18:46551599-46551621 AAAAAAATGACAGTTTACAAAGG - Intronic
1157367670 18:47080855-47080877 AAAAATTTTAAAGTGGACAAAGG - Intronic
1157593417 18:48849572-48849594 AAAAAAAAAAAAGTTTAAAATGG - Intronic
1157601925 18:48898195-48898217 AAAAAAAAAAAAGATGAAAAGGG + Intergenic
1157666929 18:49495153-49495175 AAAAAGAAGAAAGGTGGAAAAGG - Intergenic
1157766839 18:50304306-50304328 AAAAAGAATAAAGTTGAAGAAGG - Intergenic
1158109604 18:53926709-53926731 AAAAATTAAAAAGATGACACAGG + Intergenic
1158183637 18:54746300-54746322 AAAAATCAGGAAGTTGACTTTGG + Intronic
1158433136 18:57410218-57410240 AAAAATAAAAAAATTAAAAAAGG - Intergenic
1158771100 18:60518295-60518317 AAAGATAAGAGAGTTGAGAATGG + Intergenic
1158787477 18:60732516-60732538 TAAAATAAGAAAGAAGACAAAGG - Intergenic
1158948387 18:62467998-62468020 AAAACTAAAAAAGTTTAAAAGGG - Intergenic
1159047084 18:63379209-63379231 AAAGATAAGAAAACAGACAAAGG + Intergenic
1159197367 18:65135261-65135283 AAAAATAATAAAGTCAAAAATGG - Intergenic
1159353977 18:67312957-67312979 AAAAATAACAAATTTAAAAAAGG + Intergenic
1159427975 18:68313885-68313907 ACCAATAAGAAAGAGGACAATGG + Intergenic
1159452554 18:68620905-68620927 AAAAATCAAAAAGTAGGCAAAGG + Intergenic
1159528639 18:69627422-69627444 AAAAATAAGAAAGTTTAGGAAGG - Intronic
1159632839 18:70768643-70768665 AAAAAAAAAAAAGTGGGCAAAGG + Intergenic
1159667339 18:71177834-71177856 ATAAATAAGTAAATTAACAAGGG - Intergenic
1159825299 18:73201671-73201693 AAAAAGAAGAAAGCTGGGAAAGG - Intronic
1160025690 18:75213643-75213665 AAAGGTTTGAAAGTTGACAAGGG + Intronic
1160470437 18:79128042-79128064 AAAAAAAAAAAAGTCGGCAAAGG - Intronic
1161136308 19:2622063-2622085 AAAAAAAAAAAAGTTGATGAGGG - Intronic
1161413195 19:4128682-4128704 AAAAAAAATAAAGTTGACAATGG + Intergenic
1161527640 19:4767041-4767063 AATAATAAAAAAATTGAAAAAGG - Intergenic
1161561399 19:4974745-4974767 AAAAAAAAGAAGGTAGTCAAAGG + Intronic
1161895057 19:7073992-7074014 AAAAAAAAAAAAGTGGTCAAGGG - Intronic
1162244140 19:9384915-9384937 TAAAATCAGGAAGATGACAATGG + Intergenic
1162448594 19:10740073-10740095 AGAAATAAAAAAGATGATAAGGG - Intronic
1162602312 19:11678069-11678091 AAAAATAAGAATTTTTATAAGGG - Intergenic
1162732745 19:12728816-12728838 AAAAAAAAGAAAGTGGAAGAGGG + Intergenic
1163068958 19:14821882-14821904 AGAAAGAAGAATGGTGACAATGG - Intronic
1163310893 19:16513976-16513998 AAAAATTAAAAAATTGAAAAGGG - Intronic
1163679807 19:18674603-18674625 AAAAAGAAAAAAGTAAACAAGGG + Intergenic
1163681047 19:18682881-18682903 AAAAAAAAGAAAGTCGTTAAGGG + Intergenic
1163730261 19:18945018-18945040 AAAAAAAAGAAAGCTGTCACAGG - Intergenic
1163933326 19:20419950-20419972 AAAAAAAAAAAAGTAGGCAAAGG + Intergenic
1164434854 19:28220262-28220284 AAGAATAGGAGAGTTGAAAAGGG + Intergenic
1164746092 19:30614933-30614955 AAAAAAAAAAAAATTGAAAAGGG - Intronic
1164811854 19:31163741-31163763 AAGAACAAGAAAGATGACTATGG + Intergenic
1164893118 19:31842096-31842118 AAAATTCAGAAAGATGACATTGG - Intergenic
1165083158 19:33322755-33322777 AAAAAAAAAAAAGTGGACAAAGG + Intergenic
1165107508 19:33481163-33481185 AGAAATAAAAAAGTTTATAAGGG + Intronic
1165263742 19:34642728-34642750 AAAAAAAAAAAAGTGGGCAAAGG + Intronic
1165411107 19:35662174-35662196 AAAAAAAAAAAAGCTGAAAAGGG - Intergenic
1165546310 19:36539441-36539463 AAAAACAATAAAGATCACAATGG + Intronic
1165548625 19:36563425-36563447 AAAAAAAAAAAAGTTGTCTATGG + Intronic
1165763949 19:38338516-38338538 AAAAATAACAAAAATAACAATGG - Intronic
1166017096 19:39990402-39990424 AAAAATAATAAAGATTAGAATGG + Intronic
1166057195 19:40298046-40298068 AAAAAAAAGAATGGTGACTAGGG + Intergenic
1166186383 19:41141885-41141907 AAAAATAAGAAAATTAGCTAGGG + Intergenic
1166288329 19:41846016-41846038 AAAAAAAAGAAAGTGGAGCAGGG + Intronic
1166376724 19:42331557-42331579 AAAAAAAGAAATGTTGACAATGG - Intronic
1166428107 19:42697681-42697703 ATAAATAAGAAAAAAGACAAGGG + Intronic
1166520617 19:43477818-43477840 AAAAAGAAGAAAATTAACAGTGG + Intronic
1166527850 19:43524398-43524420 AAAAAAAAAAAAGTTGCCTAAGG + Intronic
1166532556 19:43551851-43551873 AAAAATCAGAGAGAAGACAAAGG + Intronic
1166581396 19:43903172-43903194 AAGAAAAAGAAAATTGAGAAGGG + Intergenic
1166582262 19:43912204-43912226 GAAAATGAGTCAGTTGACAAGGG + Intergenic
1166597456 19:44062559-44062581 AAACCTAAGAAAGTTGAAAATGG - Intronic
1166848292 19:45744025-45744047 AAAAATAAGAAGCTTGTAAAAGG - Intronic
1167100747 19:47403152-47403174 AAAAAGAAGAAATTAGAGAAGGG + Exonic
1167378900 19:49127400-49127422 AAAAAAAAGAAAGTAGGGAAAGG + Intronic
1167400969 19:49268908-49268930 AAAAAAAAAAAAAATGACAAAGG - Intergenic
1167417071 19:49380110-49380132 TAAAAAAATAAAATTGACAAGGG - Intergenic
1167550466 19:50156899-50156921 ACAATTAAGGAAGTTGACAGTGG + Intronic
1167785354 19:51631088-51631110 AAAAAAAAAAAAGTTCAAAAGGG + Intronic
1168169903 19:54578945-54578967 AAAAATCAAAAAGTGGGCAAAGG - Intronic
1168522672 19:57064977-57064999 AAAAAAAAAAAAGTTGACTTGGG - Intergenic
1168628827 19:57940928-57940950 AAACATCAGAACGTTCACAAGGG - Exonic
925037809 2:704576-704598 AAAAATAAAAAAGTGGGCTAAGG + Intergenic
925264637 2:2558496-2558518 CAAAATTAGTAAGTTTACAAGGG + Intergenic
925531337 2:4866046-4866068 GTATATAAGAAAGTGGACAAGGG - Intergenic
926260795 2:11258881-11258903 AAAAAAAAGAAAACTGAAAAGGG + Intronic
926379679 2:12274289-12274311 AAAAATACAAAAGATGAGAAGGG - Intergenic
926417577 2:12665061-12665083 GAAAATTTGAAAGTTGATAAAGG - Intergenic
926546079 2:14241996-14242018 AAATATGAGAAAGTTGTCATTGG + Intergenic
926565999 2:14474790-14474812 AAAAAAACAAAAGTTGACAAGGG + Intergenic
926669078 2:15559076-15559098 AAAAAAAAAAAAGTAGACACAGG + Intronic
927046954 2:19288734-19288756 AAAAAAAAAAAAGTTGGCACAGG - Intergenic
927217986 2:20680469-20680491 AAAAATAAGAAAATGAAAAATGG - Intergenic
927404618 2:22753336-22753358 AGAAATAAGCCAGTTTACAAAGG + Intergenic
927567959 2:24130632-24130654 AAAAATCAAAAAGTGGGCAAAGG - Intronic
928160764 2:28922077-28922099 AAAAATAAGAAATCTCAGAAAGG - Intronic
928344518 2:30478998-30479020 CAAAATAAGAATGTTCATAATGG + Intronic
928549883 2:32359658-32359680 AAAAATTTGGAAGTTAACAATGG + Intronic
928783800 2:34856687-34856709 AAAAATAAAAAAGCTGGCAGGGG + Intergenic
928851416 2:35751791-35751813 AAAAATAATATATTTGATAAAGG + Intergenic
928898476 2:36292536-36292558 AAAAAAAAAAAAGAAGACAAAGG + Intergenic
928901865 2:36327408-36327430 AAAAATAAGAAGGATTATAAGGG + Intergenic
929160728 2:38829570-38829592 AAAAAATAGAAAGTTGCCAGTGG - Intronic
929312544 2:40442417-40442439 AAACATCAAAAAGTGGACAAAGG + Intronic
929487078 2:42364259-42364281 AAAAAAAAAAAAATTGACAGTGG + Intronic
929518341 2:42625025-42625047 AAAAATAAAAAAGTAAATAAAGG - Intronic
929570684 2:43021095-43021117 AAAAAAAAAAAAGTTGAGACAGG + Intergenic
929975704 2:46632359-46632381 AAAAAAAAGAAACTAGACTAAGG + Intergenic
929991173 2:46788206-46788228 AAAAAAAAAAAAGTTAACTATGG + Intergenic
930123820 2:47781480-47781502 AAAAAAAAGAATATTGCCAAAGG - Intronic
930352367 2:50273374-50273396 AAATAAAAGAAAGTGGAAAATGG - Intronic
930413841 2:51063888-51063910 AAAAATATTAAAGGTGACCAAGG - Intergenic
930644785 2:53894254-53894276 AAAAAAAAGAAAGTTGAGAAAGG - Intronic
930690639 2:54359924-54359946 AATGATAAAAAAGTTGAGAATGG + Intronic
930783402 2:55246629-55246651 AAAAATAAGAAAAAAGACAATGG + Intronic
930815652 2:55595016-55595038 AAAAAAAAAAAAGTTTAAAAGGG - Intronic
931001397 2:57788062-57788084 AAAAATAAAAAAATTAAAAAGGG - Intergenic
931174078 2:59835331-59835353 AAAAATAAGAAAAAAGAGAAGGG - Intergenic
931307298 2:61042611-61042633 AAAAATTAGAAAATTTAAAATGG + Intronic
931467945 2:62507814-62507836 AAACAGAAGCAAGATGACAAAGG - Intronic
931571767 2:63676205-63676227 AAGAAGAAGAAAGTTTACAAAGG + Intronic
931593332 2:63910743-63910765 AAAAAAAAGTAAGTTGTCATAGG + Intronic
931918326 2:66983746-66983768 AAAAAAAAAAAAGTGGATAAAGG + Intergenic
932067158 2:68576707-68576729 AAAAATGAGAAAAATGACAAAGG - Intronic
932219923 2:69991415-69991437 AAAAAGAAGACATTTTACAAGGG - Intergenic
932282246 2:70503588-70503610 AAAAAAAAGAAACTTGCCTAAGG + Intronic
932321709 2:70827340-70827362 AAAAAAAAGAAAGTTGCCTTGGG + Intergenic
932380736 2:71279549-71279571 AAAAATTAAAAAGTTTAAAAAGG + Intronic
932516642 2:72357690-72357712 AAAAAAAAAAAAGATGATAATGG + Intronic
932827513 2:74955333-74955355 TAACATAAGACAGTTGACAATGG - Intergenic
932924120 2:75951568-75951590 AAAAATCAGAAAATTAACATTGG + Intergenic
932948036 2:76260469-76260491 AAAAATAAAAAAATTGACTATGG - Intergenic
932977466 2:76621227-76621249 ACAAATAGGAATGTTGACAGGGG + Intergenic
933361392 2:81290839-81290861 CAAAATAAGGAATTTAACAAAGG - Intergenic
933409996 2:81913286-81913308 GAAAAGAAGAATATTGACAATGG + Intergenic
933467108 2:82666635-82666657 AAAAAAAAAAAAGTTGAGATTGG - Intergenic
933526949 2:83453648-83453670 AAAAAAAAAAAAATTGAGAAGGG - Intergenic
933814566 2:86055298-86055320 AAAAAAAAGAGAGTGGGCAATGG + Intronic
933997892 2:87683405-87683427 ATATATAAGTAAGTGGACAAGGG - Intergenic
934162300 2:89261534-89261556 AAAAATTAAAAGGTGGACAAAGG + Intergenic
934514715 2:94979511-94979533 AAAAATAAGACAGTCATCAAGGG + Intergenic
934546440 2:95220507-95220529 AAACATAAGAAAGTTCTAAAAGG - Intronic
934923163 2:98362163-98362185 AAAAAAAAAAAAGTGGGCAAAGG - Intronic
935308219 2:101758715-101758737 AAATATGAGAAATTTGGCAAAGG + Intronic
935310978 2:101783041-101783063 AAAAATAAGAAAATTCGGAAAGG + Intronic
935375739 2:102395105-102395127 GAAAATAGGAAAATTGAAAAGGG + Intronic
935399222 2:102643016-102643038 AGAAATCAAAAAGTTCACAAGGG - Intronic
935480255 2:103579118-103579140 AAAAATAAAAAGGCTTACAAAGG - Intergenic
935866642 2:107394242-107394264 TAAAATATGTAAGTTGACAAAGG - Intergenic
935867429 2:107405445-107405467 AAAAAAAAAAATGCTGACAAAGG + Intergenic
935877859 2:107531400-107531422 AAAATTAATAAAGTGGAAAAAGG - Intergenic
935956034 2:108377581-108377603 AAAAATAACAAAGCTGACCCTGG + Intergenic
936162191 2:110092369-110092391 AAAAATAAAAAACTTTACAGAGG - Intronic
936182471 2:110278985-110279007 AAAAATAAAAAACTTTACAGAGG + Intergenic
936295959 2:111267461-111267483 ATATATAAGTAAGTGGACAAGGG + Intergenic
936395064 2:112120364-112120386 AAAAAAAAAAAAGTAGAGAAAGG + Intergenic
936464250 2:112733091-112733113 AGAAAAAAGAAAGTGGAGAAAGG + Intronic
936637593 2:114276937-114276959 AAAAAAAAAAAAGATAACAAGGG - Intergenic
936726658 2:115326722-115326744 AAAAATATTAAAATAGACAAAGG + Intronic
936899186 2:117465338-117465360 AAAAATAAGAAACGTGATATAGG - Intergenic
937526916 2:122782484-122782506 AAAAATCAAAAAGTGGGCAAAGG - Intergenic
937577415 2:123440727-123440749 CAAAATAAGCAGGTTGAAAAAGG - Intergenic
937673599 2:124564827-124564849 AAAAATTAGAAATTTGAAATTGG + Intronic
937753848 2:125512363-125512385 AAAAACAAGACAATGGACAATGG - Intergenic
937927511 2:127178351-127178373 AAAAATAAAAAAATTAATAAAGG - Intergenic
937954178 2:127410383-127410405 AAAAAAAAAAAAGTTCAAAAAGG - Intergenic
938120997 2:128633257-128633279 AAAAATAAGCAAGTTGAAGCAGG - Intergenic
938126803 2:128680145-128680167 AAACATAAAAAATTTAACAATGG + Intergenic
938286870 2:130126317-130126339 AAAAAAAAGAAAGAAAACAAAGG + Intronic
938313829 2:130313213-130313235 AAAAAAAAAAAAGTTGGAAAAGG - Intergenic
938344067 2:130554492-130554514 AAAAATAAAAAAGTAAAAAAAGG - Intergenic
938345766 2:130566230-130566252 AAAAATAAAAAAGTAAAAAAAGG + Intergenic
938371694 2:130772553-130772575 AAAAAAAAAAAAGAAGACAAGGG + Intergenic
938428725 2:131212556-131212578 AAAAAAAAGAAAGAAAACAAAGG - Intronic
938469627 2:131546584-131546606 AAAAAAAAGAAAGAAAACAAAGG - Intergenic
938728411 2:134127038-134127060 AATACTAAGAAAGGTGCCAAAGG - Intronic
938731930 2:134153340-134153362 AAAAAAAAGAAAGAAGACCAAGG - Intronic
938747453 2:134293207-134293229 GAAAATACGAAAATTGAAAATGG + Intronic
938988372 2:136602302-136602324 AAAAAAAAGAAAAATGAAAAGGG + Intergenic
939019466 2:136941678-136941700 AAAAATCAAAAAGTGGGCAAAGG - Intronic
939135308 2:138286608-138286630 TAAGATAAGAAAGTAGACAAAGG + Intergenic
939204257 2:139079673-139079695 AAAAAAAAAAAACTTGAAAAGGG + Intergenic
939221273 2:139304388-139304410 AAAAATTATAAAGTTTAAAAAGG - Intergenic
939246577 2:139632687-139632709 AAAAATAACAAAATTGAATAAGG - Intergenic
939322729 2:140645519-140645541 AAAAAAAAGAATATTGGCAAAGG - Intronic
939491475 2:142882320-142882342 TAAAAAAAAAAAGTTGAAAAGGG - Intronic
939560092 2:143721680-143721702 AAAAAAAAAAAAGTTTAAAAAGG - Intronic
939714962 2:145572202-145572224 AAAAAAAAAAAAGTGGATAAAGG + Intergenic
939750550 2:146039853-146039875 AACAATAATAGAGTTTACAATGG + Intergenic
939814658 2:146879091-146879113 AAAAATAAAAAAATGGCCAAAGG - Intergenic
940248925 2:151652144-151652166 AAAAATAAGAAGGTATATAATGG + Intronic
940270448 2:151884321-151884343 AAAAATAAAAAAATTAAAAAAGG + Intronic
940292259 2:152088806-152088828 GAAAATAGGGAAGTTTACAAAGG + Intronic
940462113 2:153978377-153978399 AAAACTATGATACTTGACAAAGG - Intronic
940516413 2:154689522-154689544 AAACATAAGAAAGTTGGGAGAGG - Intergenic
941098273 2:161266570-161266592 AAAAATTTGCAAGTTAACAATGG + Intergenic
941108240 2:161387239-161387261 AAAAATAAGAAAGTGTATTAAGG - Intronic
941134040 2:161690963-161690985 AAAAAAAAGAAATTTGAAAGTGG + Intronic
941181919 2:162269536-162269558 TAACATATGAAAGTTGACATAGG + Intronic
941246572 2:163105467-163105489 AAAGTTAAGAAAGTAGAAAAAGG - Intergenic
941784866 2:169486384-169486406 AAAAACAATAAATTTGAGAATGG - Intronic
942363811 2:175200400-175200422 AAAAAAAAGAAAAATAACAAGGG + Intergenic
942392742 2:175512984-175513006 AAAAGTAAGAAAGAAGAGAAAGG + Intergenic
942435772 2:175974054-175974076 AAAAATTAGAAAATTTAAAATGG - Intronic
942528871 2:176886825-176886847 AAAGAGAAGAAACATGACAATGG - Intergenic
942606962 2:177702318-177702340 AAAAAAAAAAAAGTTCAAAAAGG + Intronic
942641056 2:178060923-178060945 AAAAAAAAGAATATTTACAATGG - Intronic
942659606 2:178250524-178250546 AAAAATCAGCACTTTGACAAAGG + Intronic
942661064 2:178265736-178265758 GAAAATAAAAAAGTTTACGAAGG - Intronic
942733768 2:179087187-179087209 TAAAATAAAAAATTTAACAATGG - Intergenic
942792953 2:179781529-179781551 AAAAATAATAAAGTTTTTAAAGG + Intronic
942924871 2:181419647-181419669 CAGAATAAGGAAGTTGAAAAGGG + Intergenic
942949003 2:181701640-181701662 AAAATTAAGGAAGTTAACAAAGG + Intergenic
942958810 2:181805192-181805214 AACAATAAGCATGTTCACAATGG - Intergenic
943093398 2:183400270-183400292 AAAAATCAAAAAGTGGACAAAGG - Intergenic
943242403 2:185402009-185402031 AAAAATAAGCAAAGAGACAAGGG + Intergenic
943323785 2:186474258-186474280 AAAAAAAAAAAAGTATACAAAGG + Intergenic
943391179 2:187270147-187270169 AAAAATAACAAATTTGAAAAGGG - Intergenic
943530067 2:189068448-189068470 AAAACTTACAGAGTTGACAAGGG + Intronic
943638329 2:190331291-190331313 AAAAAAAAAAAAGTTGGTAAAGG + Intronic
943736916 2:191366371-191366393 AAAAAAAAAACAGTTGACTAAGG - Intronic
943980025 2:194538347-194538369 AAAAAAAAGTAAGTTTACAATGG - Intergenic
944019068 2:195078955-195078977 AAAAATCAAAAAGTGGGCAAAGG + Intergenic
944028746 2:195205859-195205881 AAAAATAAAATAGGTGAAAAGGG - Intergenic
944252877 2:197595024-197595046 CAAAACAAGAAATTTGAAAATGG - Intronic
944564459 2:200973545-200973567 CAAAATAAGAAACAAGACAAAGG - Intergenic
944567691 2:201007444-201007466 AAAAATGAGAAGGTTTACATAGG + Intronic
944721935 2:202431948-202431970 AAACGTAAGAAACTTAACAATGG - Intronic
944745817 2:202654655-202654677 AAAAAAAAAAAAGATTACAAAGG - Intronic
944948829 2:204723083-204723105 AAAATTAAGAAAGGTGACTCAGG - Intronic
944962934 2:204896789-204896811 CAGAATAAGGAAGTTAACAATGG - Intronic
945334595 2:208577777-208577799 AAACATAAAAAAGTGGGCAAAGG - Intronic
945396740 2:209327276-209327298 AAAAAAAAAAAAGTTGACTTTGG + Intergenic
945510582 2:210697524-210697546 GAAAATAAGAAATTTTATAAGGG - Intergenic
945606597 2:211940491-211940513 AAAAGTAAGAATGATCACAAAGG + Intronic
945750116 2:213771283-213771305 AAACATTAAAAAGTGGACAAAGG - Intronic
945827977 2:214747884-214747906 AAAAATAAAAAAATTAAAAAAGG + Intronic
945895335 2:215474675-215474697 AAAAACAAGAAAACAGACAAAGG - Intergenic
945908117 2:215616756-215616778 AAAAATAAGAAAATTAAAAAGGG - Intergenic
946129699 2:217596900-217596922 GAAGATAAGAAAGTTGTCAGTGG - Intronic
947020327 2:225667344-225667366 AGACATAAGACAGTTTACAAAGG + Intergenic
947259900 2:228209273-228209295 AAAAAAAAGAAATTAAACAATGG + Intergenic
947305828 2:228745979-228746001 AAAAATAAGAAATGAGAAAATGG - Intergenic
948169364 2:235888709-235888731 AAAAAAAAAAAAGTTGATAGAGG + Intronic
948564459 2:238874986-238875008 AAAAACAATGAAGTTGACCAAGG + Intronic
948708989 2:239813621-239813643 AAAAAAAAAAAAGTTGGCCAGGG - Intergenic
948964937 2:241371800-241371822 AAACATAAGACATTTCACAAGGG + Intronic
1169115518 20:3062843-3062865 AAAAAAAAAAAAGTGGCCAAAGG + Intergenic
1169493227 20:6088994-6089016 AAAAATAAGGAACTTGAACAAGG - Exonic
1169619955 20:7494667-7494689 AAAAATTAAAAAGTGGTCAAAGG + Intergenic
1169642574 20:7770955-7770977 AAAAAGAAGAAAACTGACAGTGG - Intergenic
1169702411 20:8462155-8462177 GAAAATAAGAAAAATCACAAGGG + Intronic
1169812611 20:9623735-9623757 AACAACAGGAAAGTTGACAAAGG + Intronic
1169838413 20:9906510-9906532 AAAAATGTGAAAGGTGACACTGG - Intergenic
1169882844 20:10366424-10366446 AAAAAGAAGAAAGGTAAAAAAGG - Intergenic
1170007148 20:11681599-11681621 AAAAATAAGCATGGTGAAAAGGG - Intergenic
1170342041 20:15340086-15340108 AGAAAAAGAAAAGTTGACAAAGG - Intronic
1170687584 20:18583404-18583426 AAAAAAAAAAAAGTGCACAAAGG + Intronic
1171526345 20:25814587-25814609 AAAAATAAAAAGGTGGACCATGG + Intronic
1171550482 20:26041298-26041320 AAAAATAAAAAGGTGGACCATGG - Intergenic
1171805799 20:29679221-29679243 AAAAATAAAAAGGTGGACCATGG - Intergenic
1171838262 20:30177214-30177236 AAAAATAAAAAGGTGGACCATGG + Intergenic
1171843365 20:30242500-30242522 AAAAATATGAAGGAGGACAAAGG + Intergenic
1172256784 20:33525642-33525664 AAAAATAAAAAAGTAGATTAGGG - Intronic
1172451840 20:35031380-35031402 AAAAAAAAAAAAGTTAACCAGGG - Intronic
1173038409 20:39435289-39435311 AAAAAAAAAAAAGTTCAAAAAGG - Intergenic
1173127439 20:40352592-40352614 AAAATAAAAAAAGTTGAAAAAGG + Intergenic
1173255027 20:41388116-41388138 AAAAATAAAAAAATTAACCAGGG + Intergenic
1173535290 20:43806156-43806178 AAAAAAAAAAAGGTTTACAATGG - Intergenic
1173683249 20:44902478-44902500 AAGAAAAAGAAAGTTCCCAATGG - Intronic
1174026953 20:47585036-47585058 AAAAAAAAAAAAGTTAAGAAAGG - Intronic
1174641522 20:52048684-52048706 AAACATAAGTCAGTTTACAAAGG - Intergenic
1174993781 20:55543120-55543142 CAGAATATGAAAGTTCACAATGG - Intergenic
1175166616 20:57048654-57048676 AAAAAAAAAAAGGTTCACAAAGG + Intergenic
1175256549 20:57651125-57651147 CAAAATAGGAAAGTTAACCACGG - Exonic
1175377581 20:58539822-58539844 AAAAATAAGAAAATAAAAAAGGG - Intergenic
1175956775 20:62614824-62614846 AACAATAACAAGGTTAACAATGG - Intergenic
1176156095 20:63621686-63621708 AAAAAAAAAAAAGTTTAAAATGG + Intronic
1176590563 21:8645840-8645862 AGCAAAAAGAAAGCTGACAATGG + Intergenic
1177021048 21:15858715-15858737 TAAAATCAGAAACTAGACAAAGG - Intronic
1177129147 21:17235149-17235171 AAAAAAAAAAAAGATGTCAATGG + Intergenic
1177131530 21:17262072-17262094 AAAAAAAAAAAACTTTACAAAGG + Intergenic
1177225620 21:18250299-18250321 AAAAATCAGAATATTTACAATGG - Intronic
1177233450 21:18353552-18353574 AGAAATGAGAAATTGGACAATGG - Intronic
1177329738 21:19642709-19642731 AAAAAAAAAAAAATTGAGAAGGG - Intergenic
1177508473 21:22050240-22050262 AACAATGAGAAAGTGGTCAATGG + Intergenic
1177618858 21:23560827-23560849 AAAAAAAAAAAAATTGACAAAGG - Intergenic
1177921804 21:27161970-27161992 TAAAATAATGAAGTTGACAAAGG + Intergenic
1178015767 21:28344178-28344200 AAAGAAAAGAAACTTGACACTGG + Intergenic
1178063514 21:28877351-28877373 AAAAAAAAGAAAGAAGAGAAGGG + Intronic
1178183541 21:30192635-30192657 ACAAATAAGGAAGTTGTCAATGG - Intergenic
1178200761 21:30402213-30402235 TAAAATAAGTAATTTGACCAAGG + Intronic
1178306610 21:31495968-31495990 AAAAAAAAAAAAGATTACAATGG + Intronic
1178414976 21:32397079-32397101 AAAAATAAGTAAATGGATAAAGG + Intergenic
1178552703 21:33554644-33554666 AAAAATAAGAACCGTGATAAGGG + Exonic
1178792969 21:35717257-35717279 AAAAAAAAAAGAGTAGACAAAGG - Intronic
1178866956 21:36336219-36336241 AAAAACAAAAAAGCTGACCATGG - Intronic
1178941331 21:36909197-36909219 AAAAAAAAGAAAGGTAACAAAGG + Intronic
1179030547 21:37716102-37716124 AAACATAAGGAAAGTGACAAGGG - Intronic
1179115642 21:38489573-38489595 AAAAATAAGAATATTGTCCAAGG - Intronic
1179254303 21:39701590-39701612 AAAAACAGAAAACTTGACAAAGG - Intergenic
1179299407 21:40092815-40092837 GAAAATAAGTAAGTTGGTAAGGG - Intronic
1179424029 21:41258820-41258842 AAAGATAAAAAACATGACAATGG - Intronic
1179646178 21:42777700-42777722 AAAGAACAGAAAGTTCACAAAGG + Intergenic
1180023445 21:45143937-45143959 AAAAAAAAGACAACTGACAATGG - Intronic
1180176533 21:46093176-46093198 GAAAATGAGAATGTTGAGAAGGG + Intergenic
1180273390 22:10622873-10622895 AGCAAAAAGAAAGCTGACAATGG + Intergenic
1180295584 22:10931329-10931351 AAAAATCAAAAAGTGGGCAAAGG - Intergenic
1180794273 22:18594270-18594292 AAAAAAAAGAAAGCTGATGAGGG - Intergenic
1180907048 22:19421560-19421582 AAAAATTAGAAAATGCACAAAGG - Intronic
1181227467 22:21401050-21401072 AAAAAAAAGAAAGCTGATGAGGG + Intergenic
1181251183 22:21533789-21533811 AAAAAAAAGAAAGCTGATGAGGG - Intergenic
1181420853 22:22797581-22797603 AAAAAAAAAAAAGTGGGCAAAGG + Intronic
1181839951 22:25648240-25648262 AAAATTAGGAAACTTGACAATGG + Intronic
1182374147 22:29834141-29834163 GAAAATAAGAAACTTGCCCAAGG + Intronic
1182494799 22:30698414-30698436 AAAAATTAAAAAGTTGAGAGTGG - Intronic
1182513800 22:30840040-30840062 AAAAAAAAGAAAGCTGAAACTGG - Intronic
1182513817 22:30840328-30840350 AAAAAAAAGAAAGCTGAAACTGG + Intronic
1182564773 22:31189596-31189618 AAAAAAAAAAAATTTGACACAGG - Intronic
1182717841 22:32373284-32373306 AAAAAAAAAAAAGTTGATGATGG + Intronic
1182764301 22:32747493-32747515 AAATATAATAATGTTGATAAAGG - Intronic
1184026516 22:41861495-41861517 AAAAAAAAAAAAATTGACAATGG + Intronic
1184380500 22:44142403-44142425 AAAAAAAAAAAAGATGACAGTGG + Intronic
1184429447 22:44432862-44432884 AAAGAAATGAAAGTTGAAAAAGG - Intergenic
949124388 3:429071-429093 AAAAACAAGAAAGTTGGGAAAGG + Intergenic
949136709 3:575834-575856 AGCAAAAAGAAAGCTGACAATGG - Intergenic
949150834 3:765386-765408 AAAAATAAGAAAATTTTTAAGGG + Intergenic
949423715 3:3893488-3893510 AAAATTAAGAAACTTGCCACAGG + Intronic
949977766 3:9476467-9476489 AAAAAAAAAAAAGTTTTCAAAGG + Exonic
950295897 3:11830150-11830172 AAAAATATTAAAGTTTCCAAAGG - Intronic
950563826 3:13752425-13752447 AAAAAAAAGAAATTAAACAAAGG - Intergenic
950731493 3:14963332-14963354 AAAAATAAGTAATTAGCCAAAGG + Intronic
950742703 3:15063055-15063077 AAAAAAAAGAAAGTTAATAATGG + Intronic
950974923 3:17230403-17230425 AATCATAAGAAACTTAACAATGG + Intronic
951102159 3:18701985-18702007 ATAAATAATAAAGATGATAAAGG - Intergenic
951133855 3:19080087-19080109 AATAATATGAATGTTGAGAAGGG - Intergenic
951188710 3:19744363-19744385 AAATATAAGAAAGGTGATTAGGG - Intergenic
951210286 3:19967138-19967160 AAAAAAAAAAAAATGGACAAAGG - Intronic
951279355 3:20729012-20729034 AAAAAAAAAAAAGATGAAAAAGG - Intergenic
951582655 3:24182229-24182251 AAAAAAAAGAAAGACCACAATGG + Intronic
951612827 3:24510965-24510987 AAAATTAAGAAATTTGCCCAAGG + Intergenic
952000197 3:28776370-28776392 GAAAATAAGAAAGCTGGAAAAGG + Intergenic
952037687 3:29222189-29222211 AAATATAAGGAAGTCAACAAGGG + Intergenic
952068227 3:29598679-29598701 AAAAATAAAAAAGATGATGAAGG - Intronic
952106097 3:30070800-30070822 AAAAAAAAAAAAGTGGACAAAGG + Intergenic
952376552 3:32772529-32772551 AAAAATAAAAAATTTTAAAAAGG + Intronic
952614302 3:35250860-35250882 AAAAAAAAAAAAGTTAAAAAAGG - Intergenic
952695715 3:36263444-36263466 AAAAAGAAGAAAGCTGAAGAAGG - Intergenic
952769315 3:36983339-36983361 ACAAACAGGAAAGTAGACAATGG + Intergenic
953079701 3:39604612-39604634 ATAAATACAAAAGTTGACAAAGG - Intergenic
953320826 3:41969804-41969826 AAAAATAAGACACTTGGGAAAGG + Intergenic
953399140 3:42597561-42597583 AAAAAAAAAAAAGGTGACATAGG + Intronic
953400939 3:42616243-42616265 ATAAATAAAAAGGTTTACAATGG + Intronic
953973723 3:47367083-47367105 AAAAATAAAAAATTAGCCAAGGG + Intergenic
954214830 3:49118779-49118801 AAAAAGAAAAAAGTTTAAAAAGG + Intronic
954241717 3:49299067-49299089 AAAAAAAAGAAAGTTGAGGCCGG - Intronic
954505624 3:51069662-51069684 AAATATGAGAAAGTAGAAAAGGG - Intronic
954552547 3:51494000-51494022 AAAAAAAAAAAAGTTGAAATAGG + Intronic
955028704 3:55195644-55195666 AAAAACAATAAAGATGATAATGG + Intergenic
955361106 3:58275632-58275654 AAAAATAAAAAAGAGGATAAGGG - Intronic
955739810 3:62078005-62078027 AAAAAAAAAAAAGTTAGCAAAGG + Intronic
955928635 3:64032905-64032927 AAAAATAAGAAATAAGAAAATGG + Intergenic
956004611 3:64765048-64765070 AAAAATATGAAAGTGTAGAAAGG + Intergenic
956161585 3:66359688-66359710 AAGAATAAGAAACAAGACAATGG - Intronic
956259170 3:67318311-67318333 CAAGATAAGAAAATTGACACTGG + Intergenic
956309456 3:67863151-67863173 AAAAAAAAAAAAGCTGAAAATGG - Intergenic
956909108 3:73798767-73798789 AAAGATTAGAAAGTTGGAAATGG - Intergenic
956925662 3:73985144-73985166 AAAAAAAAAAAAGGAGACAAAGG + Intergenic
957010768 3:75003707-75003729 AAAAATCAGAAAGTGGGCAAAGG - Intergenic
957489911 3:80910297-80910319 AAACATCAGAAAGTGGGCAAAGG + Intergenic
957609173 3:82445359-82445381 AAAAAATAGAGAGTAGACAATGG + Intergenic
957700730 3:83707681-83707703 AAAAATTAAAAAGTTGGCAAAGG - Intergenic
957877633 3:86169950-86169972 AAACTGAAGAAAGTTGATAAAGG + Intergenic
957883594 3:86254243-86254265 AAGAATCAGAAATTTGAAAAAGG - Intergenic
957990360 3:87619238-87619260 AAATATAAGGAAGTTATCAAAGG - Intergenic
958007244 3:87827350-87827372 AAAAAAAATTAAGTTGATAAGGG - Intergenic
958030008 3:88097350-88097372 AAAAAAAAAACTGTTGACAAAGG - Intronic
958073430 3:88644245-88644267 AAAAATCATAAAGTGGAAAATGG + Intergenic
958118739 3:89256907-89256929 AAAAATAAGGATGTTGCTAAAGG + Intronic
958484143 3:94681840-94681862 AAACATTAAAAAGTGGACAAAGG + Intergenic
958577267 3:95967147-95967169 AAAAAAAAAAAAGTTGAGCATGG + Intergenic
958652189 3:96951304-96951326 AAAAATAAAAAACTTAACAAAGG - Intronic
958783180 3:98567045-98567067 AAAATAAGAAAAGTTGACAAAGG - Intronic
958801337 3:98759595-98759617 AAAAAAAAAAAACTTGTCAAAGG - Intronic
959128124 3:102316257-102316279 AAAAATAAGCAAATTGCTAAAGG + Intronic
959267374 3:104159575-104159597 AAAAAAAAAAAACTTGACTAGGG - Intergenic
959276972 3:104287848-104287870 AGAAAAAAGAAAGTAGCCAAAGG + Intergenic
959364619 3:105441460-105441482 AAGCAAAGGAAAGTTGACAAGGG - Intronic
959427752 3:106213927-106213949 AAAAAGAAAAAAGAGGACAATGG - Intergenic
959474716 3:106795600-106795622 AAATATGATAAAGTTGGCAAAGG + Intergenic
959590772 3:108078042-108078064 GAAAATCAGGAAGTTCACAATGG - Intronic
959665074 3:108911491-108911513 AAGAATAACCAAGTTGTCAAGGG + Intronic
959806785 3:110563732-110563754 AAAAATTAGAAAAATGTCAATGG - Intergenic
959909797 3:111751145-111751167 AAAAAGCAGAAAGGAGACAATGG + Intronic
960074199 3:113465105-113465127 AAAAAAAAAAAAGTTCACAAAGG + Intronic
960140549 3:114148120-114148142 AAGAATAAAAAAGTTAACACAGG + Intronic
960234695 3:115268392-115268414 AAACATTAAAAAGTGGACAAAGG + Intergenic
960395099 3:117127624-117127646 AGAAATAAAAAAGGTGACAAAGG - Intronic
960400544 3:117192509-117192531 AAAAAAAAAAAAGCTGACACTGG + Intergenic
960437672 3:117647175-117647197 AAAAAAAAGAATGTTGAAAATGG + Intergenic
960468872 3:118035004-118035026 AAAATGAAGAAACTTGAAAAAGG - Intergenic
960637288 3:119796125-119796147 AAAAATCACAAAGTTGAACATGG - Intronic
960677249 3:120207754-120207776 AAAAAAAAGAAATTGGACATTGG - Intronic
960797435 3:121502076-121502098 CAAAAAAAGAAAGTCAACAAAGG + Intronic
960925319 3:122790188-122790210 AAAAGTAAGGAAGTAGAGAAAGG - Intronic
961596696 3:128023278-128023300 AAAAAAAAGAAATCTGACACTGG + Intergenic
961648412 3:128405008-128405030 AAAAAAAAAAAAAGTGACAAGGG - Intronic
961686320 3:128634332-128634354 AAAAAAAAAAAGGTTGACAAAGG + Intronic
961838471 3:129685406-129685428 AAAAAAAAAAAAGATGAGAAGGG + Intronic
961954843 3:130790602-130790624 GAAAGCAAGAAACTTGACAAAGG + Intergenic
961982759 3:131098567-131098589 AAAAAAAAAAAAGTGGGCAAAGG - Intronic
962111460 3:132454305-132454327 AAAAAAAAAAAAATTGAAAATGG - Intronic
962200063 3:133393679-133393701 AAAAATATGTAACTTGACAAAGG + Intronic
962486484 3:135847741-135847763 AATAATAATAATATTGACAAAGG - Intergenic
962486750 3:135851061-135851083 AAGAATAAGCAATTTGACCAAGG + Intergenic
962513354 3:136125322-136125344 AAAAATAAAAAATTTAAAAAAGG + Intronic
963112861 3:141701205-141701227 AAGATTCAGAAGGTTGACAATGG - Intergenic
963306505 3:143659548-143659570 ATAGATTAGAAAGTTGCCAAGGG + Intronic
963446553 3:145417123-145417145 AAAAATAGGAAATTTAAAAAAGG + Intergenic
963578777 3:147097857-147097879 AAAAATTAGAGAGTTTATAATGG - Intergenic
963589461 3:147238840-147238862 AAAAATAAAACAGTTGCAAAAGG + Intergenic
963859380 3:150292423-150292445 AAAAATAAGAAAGTGGAAAGTGG - Intergenic
964153504 3:153557643-153557665 AAAAAAAAAAAAGTGGGCAAAGG - Intergenic
964154799 3:153571974-153571996 AAAAATGATAAAGTTCTCAAAGG + Intergenic
964270810 3:154954287-154954309 AAAAAAAAAAAAGTTGATGATGG + Intergenic
964272303 3:154970343-154970365 ACAATTAAGAAATGTGACAACGG + Intergenic
964373018 3:156021004-156021026 AAAAAGAAGAAAGATAAGAAAGG + Intergenic
964401045 3:156298977-156298999 AGAAATAAGAGAGTTAGCAATGG + Intronic
964511404 3:157456194-157456216 AAAAATTACAAAGTGGGCAAAGG - Intronic
964517069 3:157523067-157523089 AACAATAATAAAGTTGGAAAAGG - Intronic
964750515 3:160049951-160049973 AAAAATAAAAAAATGTACAAAGG + Intergenic
964772165 3:160235768-160235790 AAAAATGAAAAAGATGAAAACGG - Intronic
964848768 3:161071267-161071289 AAAATAAAGAAAGTTGGCTATGG - Exonic
965382649 3:168009436-168009458 AAAAAAAAAAAAATTGAGAATGG + Exonic
965425298 3:168515269-168515291 ACAAAGAAGAGAGTTGACAAGGG - Intergenic
965699517 3:171445425-171445447 AAAAAAAAAAAAGTTGAGAGAGG + Intronic
965851544 3:173032547-173032569 AAAAATAAGAACTTTTAGAAGGG + Intronic
965904121 3:173681897-173681919 AGAAATAAGGAGGTTGACTAGGG - Intronic
965904131 3:173682095-173682117 AAAAATGAGAAAAAAGACAAGGG - Intronic
966047199 3:175566278-175566300 AGTAATAAGCAAATTGACAATGG + Intronic
966141708 3:176765047-176765069 CAAAATCAGAAAGTTGACACTGG - Intergenic
966489406 3:180510427-180510449 CAAAATAAGACAGCAGACAAGGG + Intergenic
966587610 3:181644898-181644920 AAAAAAAAGAAAAATGAGAAAGG + Intergenic
966722235 3:183075535-183075557 AAAAAAAAAAAAGTGGGCAAAGG - Intronic
967018896 3:185505301-185505323 AAAAAAAAAAAAAGTGACAAAGG + Intergenic
967128555 3:186449028-186449050 AAAAATCAAAAAGTTGTCAGAGG - Intergenic
967325807 3:188238365-188238387 AAAAAAAAAAAAGTTCATAAAGG - Intronic
967404078 3:189097246-189097268 AAAAATTAGAATGTTGGAAAAGG - Intronic
967457567 3:189706225-189706247 AAAAAGAAGTAAGTTCACAATGG - Intronic
967540689 3:190664334-190664356 AAAAATAAGAAGTATGAAAAGGG + Intergenic
967600581 3:191382846-191382868 AAAAATGAGGAAGTTGACTTTGG + Intronic
967637876 3:191825447-191825469 AAACATTAAAAAGTGGACAAAGG + Intergenic
967781986 3:193450156-193450178 AAATATAAGTAATATGACAAGGG - Intronic
967782490 3:193455352-193455374 AAAAAAAAAAAAGTAGGCAAAGG + Intronic
967797780 3:193616755-193616777 TAAACTAAGAAATCTGACAAAGG - Intronic
967901512 3:194458381-194458403 AAAACAAAGAAAATTGCCAATGG - Intronic
967954794 3:194869740-194869762 AAAAATATGAAAGCTCCCAAAGG - Intergenic
968980366 4:3845448-3845470 AAAAAAAAGAAAGTTAAAAAGGG - Intergenic
969038498 4:4275425-4275447 AAAAAAAAGAATGATGAGAATGG - Intronic
970550577 4:17177024-17177046 AGAAATAAGACAGTATACAAGGG + Intergenic
970643039 4:18088833-18088855 AAAAAAAAAAAATTAGACAATGG - Intergenic
970699598 4:18719723-18719745 AAGAATGAGAAAGAAGACAAAGG - Intergenic
970980436 4:22090173-22090195 ACAAATAAGAAATTTAAAAATGG + Intergenic
971097252 4:23421558-23421580 AAAACAAGGAAAGTTTACAAGGG - Intergenic
971133270 4:23837394-23837416 AAAAAAAAAAGAGTTGACAAAGG + Intronic
971221148 4:24707025-24707047 AAAAACTAGAAAATTGACATTGG + Intergenic
971229135 4:24784330-24784352 AAAAATAAAAACACTGACAATGG - Intergenic
971311876 4:25532070-25532092 AAAAAAAGAAAAATTGACAAAGG - Intergenic
971323259 4:25622504-25622526 AAAAAGAAAAAAGTGGAGAAAGG + Intergenic
971437796 4:26646133-26646155 AAAAAAAAAAAAGTGGGCAAAGG + Intronic
971676341 4:29634172-29634194 AAAAAAAAAAAAGTGGGCAAAGG + Intergenic
972005190 4:34093208-34093230 AAAAATAAAAATGATGAAAAAGG + Intergenic
972160702 4:36223346-36223368 AAAAATAATAAAATCGACATAGG - Intronic
972387952 4:38586084-38586106 AAAAAAAAAAAAGCTGAAAAGGG - Intergenic
972681588 4:41311568-41311590 AAAACTAAGAAAATTAACATTGG - Intergenic
972684271 4:41336427-41336449 AAAAATAAAATAGTTGAGGATGG - Intergenic
972877200 4:43377208-43377230 AAAAATTAAAAAGTGGGCAAAGG + Intergenic
972989712 4:44809730-44809752 AAAAATTAAAAAGTGGGCAAAGG - Intergenic
973045201 4:45528637-45528659 AGAAAAAAGAAAGTTGCCAATGG + Intergenic
973085386 4:46053168-46053190 AAAAATAATATAACTGACAATGG - Intronic
973653990 4:53026866-53026888 ACAAATTCCAAAGTTGACAATGG + Intronic
973690495 4:53424159-53424181 GAAAATAAAAATTTTGACAATGG + Intronic
973735054 4:53863655-53863677 AAAAATGAGAAAGATGATAGGGG + Intronic
973743502 4:53941112-53941134 AAAAATTAAAAAGTGGGCAAAGG + Intronic
973999930 4:56501829-56501851 AAAAAGAAGAAAGGTGGAAAAGG + Exonic
974604887 4:64139444-64139466 AAAAAAAAGAAAATTTAAAAAGG - Intergenic
974606242 4:64156068-64156090 AAAAATATGAAATTTGGCAGGGG - Intergenic
974748844 4:66110737-66110759 AAAAAAAAAAAAGTGGACAAAGG + Intergenic
974815024 4:66992844-66992866 AAAAATGAAAAAGTTATCAATGG + Intergenic
975022616 4:69508013-69508035 AAAAATTAAAAAGTGGGCAAAGG + Intronic
975327266 4:73072752-73072774 AATAATAAGAAAGATGGCAAGGG - Intergenic
975566350 4:75759606-75759628 AAAAGAAAGAAAGTAGACATTGG + Intronic
975617435 4:76260985-76261007 AAAAAAAAAAAAGTGTACAAAGG + Intronic
975670991 4:76780537-76780559 AAAAAAAAAAAAAATGACAAGGG + Exonic
975904100 4:79188929-79188951 AAATATAAGAAACTTGTGAAGGG + Intergenic
975927654 4:79477888-79477910 GAAAGAAAGAAAGTGGACAAAGG - Intergenic
976065693 4:81184727-81184749 GAAACTAAGAATGTTGAAAAAGG + Intronic
976183522 4:82421823-82421845 AAAAAAAAAAAAGTTGACTAAGG - Intergenic
976259020 4:83128157-83128179 GAAAAAAAGAAAATTGAAAAGGG + Intronic
976563394 4:86527329-86527351 AAAAAAAAAAAAGTAGGCAAAGG + Intronic
976591155 4:86851035-86851057 AAAAAAAAGAAGGTTGACTAAGG - Intergenic
976608050 4:87001197-87001219 AAAAAAAAAAAAGTAGAAAAAGG - Intronic
976742640 4:88372828-88372850 AAAAACAAAAAAGGTGAAAATGG - Intergenic
976759112 4:88529302-88529324 AAAAATAAAAAAGTTGGCTATGG + Intronic
976840993 4:89432173-89432195 AAAAAACAGAAAGTTTAAAATGG + Intergenic
977189798 4:93985473-93985495 AATAAAGAGAAAGTTAACAAAGG - Intergenic
977331518 4:95642885-95642907 AAACATAAGAAGGGTGACCAAGG + Intergenic
977358591 4:95977521-95977543 AAAAAAAAAAAAGTTGTTAATGG + Intergenic
977447374 4:97148043-97148065 AATATGTAGAAAGTTGACAATGG - Intergenic
977484354 4:97623421-97623443 AAAAATTAAAAAGTGGGCAAAGG + Intronic
977529896 4:98188570-98188592 AAAAATAAAAAAATTAACCAGGG - Intergenic
977601468 4:98937915-98937937 AATAATAACAAAAATGACAAGGG + Intergenic
977805195 4:101289050-101289072 AAAAAAAAGAAAAATGACACTGG + Intronic
977914186 4:102572478-102572500 AAAAATAAGCAAGTTTACAAGGG + Intronic
977968041 4:103178312-103178334 ATGAAAAAGAAAGCTGACAAGGG - Intronic
978115139 4:105010692-105010714 AAAGAAAAAAAAGGTGACAAGGG + Intergenic
978159440 4:105528260-105528282 AAGAATAAGAAAAGTGACATAGG - Intergenic
978287000 4:107091162-107091184 TAAAATAAAAAAGTGGACAAAGG + Intronic
978509223 4:109497541-109497563 AAAAAAAAGAAAGGTGGGAATGG - Intronic
978534399 4:109745748-109745770 AAAGATAAAAAGGTTTACAAAGG - Intronic
978594620 4:110363443-110363465 AATAATAAAAAAATTGACCATGG + Intergenic
978667103 4:111196989-111197011 AATAATTAAAAATTTGACAAAGG + Intergenic
978961438 4:114684259-114684281 AATAATAAGAATACTGACAAAGG - Intergenic
978961978 4:114691082-114691104 AAAAAAAAAAAAGTTGGCCATGG - Intergenic
978977284 4:114893567-114893589 ACACATCAGAAAGTGGACAAAGG - Intronic
979056270 4:115998690-115998712 AAAAAAAAAAAAGTTGATTATGG + Intergenic
979236086 4:118401939-118401961 AAAAAAAATAAATTTCACAATGG + Intergenic
979406785 4:120322271-120322293 AAAAATAAAAAGGTTTACATAGG + Intergenic
979687564 4:123527514-123527536 AAAAAGAACAAATTTGAAAAGGG - Intergenic
979926004 4:126565082-126565104 AATAATAATAAAGTTAACAGAGG + Intergenic
980139024 4:128893889-128893911 AAAAATAAGTAACTTGCCTAGGG + Intronic
980174698 4:129330369-129330391 AAAAATTAGAAAGTTATAAATGG - Intergenic
980399623 4:132264092-132264114 AAAAATAAGACAGAAGAGAAAGG + Intergenic
980529390 4:134031730-134031752 AAAAATAAGAGAGATGATATGGG + Intergenic
980658443 4:135822335-135822357 AAAAATAAGAAAGGTAAAATTGG - Intergenic
980796837 4:137696589-137696611 AAAAATAAGAAACATGTCTAAGG + Intergenic
981028452 4:140099900-140099922 AAAAATCAGAAATTTGATCATGG + Intronic
981117531 4:141009629-141009651 AAAAATAAATAGGATGACAATGG - Intronic
981244690 4:142521432-142521454 AAAAATAGAAAATTTAACAAAGG - Intronic
981297159 4:143145665-143145687 AAAAATCAAAAAGTGGGCAAAGG + Intergenic
981402509 4:144329988-144330010 AAAAATAAAAAAGATGACCTAGG - Intergenic
981415550 4:144488629-144488651 AAAAATAAAAAGGTTGAAAGGGG + Intergenic
981627858 4:146780375-146780397 AAAAATAAGAACATTTACAATGG - Intronic
981662417 4:147183602-147183624 AAAAAAAAGAAACTTGAAGATGG + Intergenic
981690387 4:147501441-147501463 AAAATCAAGAAAGTAGAAAAAGG + Intronic
981941786 4:150288718-150288740 TAAAAAAAAAAAGTTGCCAATGG - Intronic
981949331 4:150387088-150387110 AAAAATTAAAAAGTGGGCAAAGG - Intronic
981966498 4:150610132-150610154 ATACAGAAGAAAGCTGACAAAGG + Intronic
981973979 4:150700917-150700939 AAAAATAAAAAAGTTAGCCAGGG - Intronic
981974083 4:150702244-150702266 AAAAATGAGATAATGGACAAAGG + Intronic
982197070 4:152927294-152927316 ACCAATAAGAAATTTGTCAAAGG + Intergenic
982318015 4:154050773-154050795 AAAAAAAAGAAACCTGAGAAAGG - Intergenic
982326407 4:154133753-154133775 AAAAATAACAAACTTAACAAAGG - Intergenic
982371528 4:154638818-154638840 AACAGTAAGAAGGTTGAGAATGG + Intronic
982436417 4:155386211-155386233 AAAATTAAGAAACTTAACATGGG + Intergenic
982509733 4:156266628-156266650 AAAAAAAAAAAAATTGACACCGG - Intergenic
982562655 4:156949004-156949026 AAATATGAGAAAGGTGAGAAAGG + Intronic
982914356 4:161187021-161187043 AGAAGTAAGAAATTTGCCAAAGG - Intergenic
983120389 4:163876689-163876711 CAAAATAAGGAGGTTGAAAAAGG + Intronic
983199189 4:164842693-164842715 AAAATTAAGGAAATTGAGAAAGG + Intergenic
983215625 4:164999722-164999744 AAAAAAAAAAAAACTGACAATGG + Intergenic
983256959 4:165410602-165410624 AAAGAAAAGAAAGGTTACAAAGG + Intronic
983277304 4:165634140-165634162 AAAATTAAGAAAGAAAACAAAGG + Intergenic
983517341 4:168672091-168672113 AAAAATAAGAAAATTTTAAATGG - Intronic
983643100 4:169961862-169961884 AAAAAAAAAAAAGTGGGCAAAGG + Intergenic
983701800 4:170605828-170605850 AAAAATAACAAAGATGAACAAGG + Intergenic
983785726 4:171727695-171727717 AAAAAAAAGAAGTTAGACAAAGG + Intergenic
983900051 4:173124122-173124144 AAAAATAATAAAGTTGACTGTGG - Intergenic
984168375 4:176331581-176331603 AAAAATAAAAAAATTTAAAAAGG - Exonic
984342570 4:178476355-178476377 AAAAATAAGTAAGTGAATAAGGG + Intergenic
984464614 4:180082466-180082488 AAAGATAAGACATTTGAAAATGG + Intergenic
984531200 4:180918592-180918614 AAAAAAAAGAAAGCCTACAATGG - Intergenic
984581687 4:181517236-181517258 TAAAATAAGAAAATGGGCAATGG - Intergenic
985045812 4:185939503-185939525 AAAAAAAAGAAAGTTGAGACAGG - Intronic
985371577 4:189290747-189290769 AAATATAAAAAACTAGACAAAGG + Intergenic
986795133 5:11202777-11202799 AAAAAAAAGAAATTGGAGAAAGG - Intronic
986876732 5:12120268-12120290 AAAAATAAGGAAATTGAGAATGG - Intergenic
987042836 5:14078730-14078752 CAAAAAAAGAAAGTTGATTAGGG + Intergenic
987422335 5:17735257-17735279 AAACTTCAGAAAGTTGACACTGG + Intergenic
987430436 5:17826070-17826092 AAAAAAAAAAAAGTGGGCAAAGG + Intergenic
987603778 5:20107070-20107092 AAAAAAAAGAAAGTTATAAAAGG - Intronic
987669338 5:20987000-20987022 AAAAATCAAAAAGTGGGCAAAGG - Intergenic
988131563 5:27113330-27113352 AAAAATCAAAAAGTGGGCAATGG + Intronic
988213232 5:28236070-28236092 TAAAAAAAAAAAGTTTACAAAGG + Intergenic
988218740 5:28314180-28314202 AAGATTAAGTAACTTGACAAAGG - Intergenic
988268525 5:28983889-28983911 AAACATCAGAAAGTGGGCAAAGG - Intergenic
988277988 5:29107685-29107707 TAAAAAAAGAAAGCTGACATAGG - Intergenic
988279075 5:29122083-29122105 GAAAAAAAGAAAGATGATAAAGG + Intergenic
988393773 5:30669937-30669959 AAAAGTAGGGAAGTTGACAGTGG - Intergenic
988402583 5:30780698-30780720 AAAAATCAAAAAGTGGGCAAAGG + Intergenic
988576852 5:32434392-32434414 AAGGAGAAGAAAGTTGACACAGG - Intronic
988650865 5:33149147-33149169 ATATATAAGAAAGTTGATATAGG + Intergenic
988824898 5:34926405-34926427 AAAAATAGGACAGTTGTTAAAGG + Intergenic
988830579 5:34983120-34983142 AAATATCAGAAAGTGGAAAATGG + Intergenic
988852006 5:35189586-35189608 AAAAAAAAGAAAGTTGTTATGGG + Intronic
989015134 5:36922234-36922256 AAAAATAAGGAGGTGGAAAATGG - Intronic
989589290 5:43098531-43098553 AAAAAAAAGAAAGTTGTCCGGGG + Intronic
989692812 5:44165710-44165732 ACAAATACAAAAATTGACAAGGG - Intergenic
990152589 5:52836314-52836336 TAAAATAAGAAAGTGGACTGTGG + Intronic
990225197 5:53643248-53643270 TAAAATAAGAAATTTGTAAAAGG + Intronic
990285563 5:54297777-54297799 AAAAAAAAGAAAGTAGAAGATGG - Intronic
990357358 5:54982685-54982707 ACAAATAAGGAACTTGATAAGGG - Intronic
990395049 5:55369139-55369161 AAAAATAATAAAGATGAACAAGG + Intronic
990472385 5:56128031-56128053 AAACATAGAAAAGTTGATAAAGG - Intronic
990664522 5:58056536-58056558 AAAAATAAAATTGATGACAATGG - Intergenic
990729452 5:58792443-58792465 AAAAGCAAGAAATTTTACAAAGG + Intronic
990805822 5:59660469-59660491 AAAAAGAAGAAATTAGAAAAGGG - Intronic
990850007 5:60192275-60192297 AAAAATAAAATACTTGAAAATGG + Intronic
991164390 5:63546527-63546549 AAAAATGACAAAGTTGTAAAGGG - Intergenic
991354350 5:65752238-65752260 AAAAAAAAAAAAATTCACAAAGG + Intronic
991900468 5:71455210-71455232 AAAAACAAAAAAGTACACAAAGG + Intergenic
991901725 5:71467843-71467865 AAAAATTAGAAAGTAGAGATAGG + Intronic
991998234 5:72409729-72409751 AAAAAAAAGAAAGATTACACAGG + Intergenic
992015008 5:72566810-72566832 AAAAAAAAGAAAGAAGAAAAAGG + Intergenic
992164292 5:74033564-74033586 AAAAATAAGATATTTGCAAAAGG + Intergenic
992302103 5:75393616-75393638 AAAAAAAAGAAAGTCTAGAAGGG + Intronic
992325158 5:75653188-75653210 ACTGAGAAGAAAGTTGACAAGGG - Exonic
992426975 5:76667863-76667885 AAAAAAAAGAAAGTGGACTAAGG - Intronic
992437585 5:76770024-76770046 AAAAAAAAAAAAGTGGGCAAAGG + Intergenic
992969454 5:82041544-82041566 AAAATTAAGAAAATAGAAAAAGG + Intronic
993059067 5:83017182-83017204 CAAAGTAAGAAATCTGACAATGG - Intergenic
993249117 5:85493077-85493099 AAAAATCAAAAAGTGGGCAAAGG - Intergenic
993388102 5:87284245-87284267 ATAAATAAGAAAGCTAACAATGG - Intronic
993645434 5:90455482-90455504 AAAAAAGAGAAATTTGGCAAAGG - Intergenic
994612486 5:102061378-102061400 AAAAAGAAGAAAGATAAGAAGGG - Intergenic
994787563 5:104183679-104183701 ACAAATAAGTAAATTGAAAATGG - Intergenic
994954135 5:106506018-106506040 AAAAATTTTTAAGTTGACAAGGG + Intergenic
995157542 5:108932846-108932868 AAAAAAAAAAAAGTGGGCAAAGG - Intronic
995286359 5:110393486-110393508 AAAAATAAAAGAGATGAAAAAGG - Intronic
995636509 5:114199179-114199201 AAAAATAGTAAAAATGACAAAGG - Intergenic
995880701 5:116841687-116841709 AAAAATAAGCAAGTTATCTAAGG - Intergenic
995893716 5:116986436-116986458 AAAAAAAAAAAAGTGGGCAACGG - Intergenic
996006387 5:118425831-118425853 AAAAATTAAAAAGTGGACAAAGG + Intergenic
996118850 5:119648606-119648628 AAAAAAAAGAAAAATGAAAAAGG + Intergenic
996457914 5:123706280-123706302 AAAAATAAGAACTCTGCCAAAGG - Intergenic
996698982 5:126430031-126430053 AAAAATTAGAAAGGTGTTAAAGG - Intronic
997153874 5:131529750-131529772 AAAAATTAGAAAATTGGCCAGGG + Intronic
997871587 5:137510422-137510444 ATAATTAAGAATGTTTACAAAGG + Intronic
998934052 5:147215679-147215701 AAAAAGAAGGAAGGTGAAAATGG + Intergenic
999020303 5:148158413-148158435 AAAAAAAAAAAAGTGGGCAAAGG - Intergenic
999609732 5:153355634-153355656 AAAAATAATAAATTTGAAAATGG + Intergenic
999834670 5:155356446-155356468 AAAAAAAAAAAAAGTGACAAAGG + Intergenic
1000099457 5:158001214-158001236 AAAAAAAAGAAAGATGCCCAAGG + Intergenic
1000407062 5:160899336-160899358 AAAAATAAGAAAGTGGGGAAAGG + Intergenic
1000494861 5:161969541-161969563 AAAAATGAGGAAGTTCACATTGG + Intergenic
1000616529 5:163433900-163433922 AAAAATATCAGAGTTGTCAAAGG + Intergenic
1000707225 5:164526738-164526760 AAAAAAAAGAAAGTTTAAGAGGG - Intergenic
1000714462 5:164623391-164623413 AAAAAAAAAAAAGTTGCCACTGG + Intergenic
1000870876 5:166575637-166575659 AAAAATAAGAGAGTAGAAAATGG - Intergenic
1000918060 5:167105920-167105942 AAAAAAAAGAAAGTGATCAAAGG + Intergenic
1001065815 5:168534361-168534383 AAAAAAAAAAAAGTTTAAAACGG + Intergenic
1001625423 5:173128728-173128750 GAAAATAAAAGAGTAGACAAAGG - Intronic
1001818018 5:174687228-174687250 AAAAATAATAAAGTAGCCAGTGG - Intergenic
1001978980 5:176024934-176024956 AAAAAAAAGAAAGTTGGGTATGG - Intronic
1002177932 5:177412765-177412787 AACAACAAAAAAGGTGACAAAGG - Intronic
1002238437 5:177818832-177818854 AAAAAAAAGAAAGTTGGGTATGG + Intergenic
1002282531 5:178140520-178140542 AAAAATTAGGAAGTTTACAGTGG - Intronic
1002798309 6:495113-495135 AAAAAAAAGAATGTTCACCATGG - Intronic
1002812448 6:644527-644549 AAAAAGCAGAAAGATGGCAAAGG + Intronic
1002971889 6:2031496-2031518 AAAAAAAATCAAGTTGAAAAGGG + Intronic
1003009482 6:2413294-2413316 CAAAAAAAGAAAGTGGGCAATGG - Intergenic
1003060582 6:2859422-2859444 AAAAACAAGTAAGATAACAAGGG + Intergenic
1003461093 6:6329003-6329025 AAATATAAGAAATTTTATAAGGG + Intergenic
1003509461 6:6767497-6767519 AAAAATTAGAGAGTTTACACTGG - Intergenic
1003810742 6:9777113-9777135 AAAAAAAAAAAAGTCTACAAAGG - Intronic
1004175997 6:13340685-13340707 AGAAAGAAAAGAGTTGACAAGGG + Intergenic
1004598491 6:17124582-17124604 AAAATTAAGAAAAAAGACAAAGG - Intronic
1004614272 6:17275023-17275045 AAAAAAAAAAAAGTGGTCAAAGG + Intergenic
1004978202 6:20991855-20991877 AAAAAAAAAAAAGTTTAAAATGG + Intronic
1005152952 6:22773415-22773437 ACAGATAAGAAACTTGTCAAAGG - Intergenic
1005403309 6:25458187-25458209 AAAAACAAAGAAGTTGACAAGGG - Intronic
1005473683 6:26186654-26186676 AAAAAAAAAAAAGTTATCAATGG - Intergenic
1005576123 6:27191091-27191113 AAAAAAAAAAAAGTGGAAAAAGG + Intergenic
1005961496 6:30696719-30696741 AAAAAAAAGAAAGTTAAATACGG - Intergenic
1005977771 6:30813300-30813322 AAAAATAGGACAGCTGATAAGGG - Intergenic
1006003578 6:30985766-30985788 AAATAAAAAAAAGTTGACACTGG - Intronic
1006201200 6:32293096-32293118 AAAAACACAAAAGGTGACAAAGG - Exonic
1006524881 6:34595753-34595775 ATAAATAAGAAGGTTCACACAGG + Intronic
1006542934 6:34755323-34755345 AAAATTAAAAAAATTAACAAGGG + Intergenic
1006653827 6:35573167-35573189 AAAAATCAGAAAATCGGCAATGG - Intergenic
1006857178 6:37142705-37142727 AGCATTAAGAAAGTTCACAAAGG + Intergenic
1006882294 6:37350888-37350910 AAAAAAAAGTAAGTTTACAGTGG + Intergenic
1006886420 6:37385847-37385869 AAAAAAAAAAAAAATGACAAAGG - Intronic
1006993121 6:38232655-38232677 AAAAAAAAAAAAGTTGCGAAAGG - Intronic
1007081791 6:39110905-39110927 AAAAAAAAGATACTTGAAAATGG + Intronic
1007373276 6:41440735-41440757 AAAAGGAAGAAAATTAACAAAGG - Intergenic
1008014375 6:46501853-46501875 AAAGCTAAGCAACTTGACAATGG + Intergenic
1008084023 6:47224839-47224861 CAAAATCAGAAAATTGACATTGG - Intergenic
1008096146 6:47341595-47341617 AAAAATAAAAATATTTACAATGG + Intergenic
1008294525 6:49759215-49759237 ACAAATACAAAAGTTGAAAATGG - Intergenic
1008381018 6:50840066-50840088 AATACTAACAAAGCTGACAAGGG + Intronic
1008396304 6:51011737-51011759 AAAAAAAAGAAAGCTCCCAATGG - Intergenic
1008486159 6:52038379-52038401 AAAAAAAAAAAAGTTGGCAGGGG + Intronic
1008702959 6:54123722-54123744 AAAAATAAGAAAATTAACATTGG + Intronic
1008971401 6:57373285-57373307 AAACATTAAAAAGTGGACAAAGG - Intronic
1009272661 6:61634268-61634290 AAAAAAAAAAAAGTTGGAAATGG + Intergenic
1009330666 6:62415944-62415966 ACAAATAAGAAAGTAGTCAGAGG + Intergenic
1009428386 6:63539768-63539790 AAAAAAAAAAAAATTGGCAAAGG + Intronic
1009442534 6:63698246-63698268 AAAAAGAAGAAAGTTGAAAAAGG + Exonic
1009467394 6:63988890-63988912 TAAAATAAGAAAATAGGCAAAGG + Intronic
1009709149 6:67295406-67295428 AAAAAAAAAAAAGTGGGCAAAGG - Intergenic
1009803645 6:68573963-68573985 AAAAATAAGTAAGTAAACATTGG + Intergenic
1009860187 6:69319689-69319711 AAAAATAAAAAAGATGAAGAGGG - Intronic
1009924982 6:70109719-70109741 AAAGAAAACAAAATTGACAAAGG + Intronic
1010036956 6:71336953-71336975 AAACATTAAAAAGTTAACAAAGG + Intergenic
1010065360 6:71676245-71676267 AAAAATCAGAAAGTATGCAATGG - Intergenic
1010412392 6:75575214-75575236 AAAAAAAAAAAGGTGGACAAAGG + Intergenic
1010420815 6:75673309-75673331 AAAAAAAAAAAAGTAGACATTGG - Intronic
1010425965 6:75729119-75729141 AAAAAAAAGAAAATTTAAAAAGG + Intergenic
1010434861 6:75817311-75817333 AAAAAAAAAAAAGTAGATAAAGG + Intronic
1010510140 6:76708380-76708402 AAAAATAATAAAGCAGAGAAGGG + Intergenic
1010559350 6:77329670-77329692 AAAAATATGAACTTGGACAAGGG - Intergenic
1010568032 6:77441668-77441690 AAAAAAAAAAAAATTGCCAATGG + Intergenic
1010624519 6:78121128-78121150 AAACATCAAAAAGTAGACAAAGG + Intergenic
1010662300 6:78585287-78585309 AAAAACAAGAAAAAAGACAAAGG - Intergenic
1010682829 6:78817088-78817110 AAAAAAAAAAAAGTTGGAAAAGG + Intergenic
1010711831 6:79184086-79184108 TAAAATATGACAGATGACAATGG + Intergenic
1010899724 6:81411195-81411217 AAAATTAAGAAAGTAAACTAAGG + Intergenic
1010928635 6:81773786-81773808 AAAAATAAGAAACTTGCTCAAGG + Intergenic
1010986320 6:82428920-82428942 AATAACAATAAGGTTGACAATGG + Intergenic
1011113194 6:83860702-83860724 AAAAATAAGAAAATCGATAAGGG - Intronic
1011138567 6:84127600-84127622 TAAACTAAGAAAGCTGATAAAGG + Intronic
1011278999 6:85658017-85658039 AAAAAAAAGAAAACTGATAAGGG + Intergenic
1011302758 6:85893530-85893552 AAAATAAATAAAGTTGACAAAGG - Intergenic
1011514401 6:88136824-88136846 CAAAACAAGAAAGTGGCCAAAGG + Intergenic
1011564089 6:88656787-88656809 AAAAAAAAGTAAGTTGAGGAAGG + Intronic
1011567771 6:88696765-88696787 ACAAGTAAGAAAATTGACTATGG + Intronic
1011612599 6:89168100-89168122 AAAAATAAGAAACATAAAAAAGG - Intergenic
1011693276 6:89888721-89888743 AAAAAAAAAAAAATTAACAAAGG - Intergenic
1011769376 6:90659110-90659132 AAAAATTAAAAAGTGGTCAAAGG + Intergenic
1011797042 6:90967774-90967796 AAAAATTATAAAATGGACAAAGG + Intergenic
1011892123 6:92177352-92177374 AAAAATATGAAAGTAAACAATGG - Intergenic
1011986626 6:93455576-93455598 AAAAAAAAGAAAATAGAAAAAGG - Intergenic
1012042325 6:94224003-94224025 AAAAAAAAAAAAATTGAGAAGGG + Intergenic
1012220990 6:96649155-96649177 AAAAATAAGAATTTTTAAAAAGG - Intergenic
1012324411 6:97897550-97897572 AAGAATAAGAGAGTTTATAAAGG + Intergenic
1012501649 6:99895198-99895220 AAAAAAAAGAGAGAGGACAATGG - Intergenic
1012783064 6:103587929-103587951 AAAAATAAAACAGATGAAAAAGG - Intergenic
1012873652 6:104700148-104700170 AAAAAAAAGAAAGCTGTCACTGG + Intergenic
1012876240 6:104731249-104731271 ATAAATTAGAAAAATGACAAAGG + Intronic
1013002757 6:106040979-106041001 AAAAATAGGAAAGTAAACTAAGG - Intergenic
1013011641 6:106125894-106125916 AAAAAAAAGAAATGTAACAAAGG + Intergenic
1013202113 6:107908748-107908770 TAAATTAAGAAATGTGACAAAGG + Intronic
1013252302 6:108346356-108346378 AAAAAAAAAAAAGTAGAAAAAGG - Intronic
1013288840 6:108703349-108703371 AAAAATAAGAAGGAGGAAAAGGG + Intergenic
1013326801 6:109054015-109054037 AAATATTAAAAAATTGACAAGGG - Intronic
1013390854 6:109684901-109684923 AAAAAAAAAAAAGTAGGCAAAGG + Intronic
1013501335 6:110754974-110754996 AAAAAAAAAAAAATTCACAAGGG - Intronic
1013660540 6:112291872-112291894 AAAAATAAAAAAATTTCCAAAGG - Intergenic
1013722086 6:113042533-113042555 AAAAATAAAAAAGTGGGCAAAGG + Intergenic
1013772961 6:113647940-113647962 AAAAAAAAAAAAGTTGGCCAGGG - Intergenic
1013844569 6:114434332-114434354 AAAAAAAAGAAAGCTGAAACTGG - Intergenic
1013967169 6:115968876-115968898 AGATTTAAGAAAGTTTACAAAGG + Intronic
1014092427 6:117419046-117419068 ATAAACAAGACAGTTTACAAAGG + Intronic
1014256617 6:119166748-119166770 AAAAAGAAGAAATTTAACACAGG - Intergenic
1014524051 6:122480033-122480055 AAAAAAAAAAAAATTGACTATGG - Intronic
1014821191 6:125990058-125990080 AAAAATAAGAATTTTGGCAGAGG - Intronic
1014966021 6:127752482-127752504 AAAAATACAAAAGATCACAATGG + Intronic
1015304617 6:131693986-131694008 AAAAACCACAAAGATGACAAAGG - Intronic
1015375805 6:132508871-132508893 AAATAAAACAAAGTTAACAATGG + Intronic
1015477103 6:133666203-133666225 AAAAAAAAAAAAGTAGGCAAAGG + Intergenic
1015776137 6:136816285-136816307 AAAAAAAAGAAAGCTGAAACTGG - Intergenic
1016053700 6:139556455-139556477 TAAAATAAAAAAGTTGACAAAGG + Intergenic
1016066260 6:139686457-139686479 AAAATTTAGAAAGATGACACAGG + Intergenic
1016117585 6:140306535-140306557 ACAAATAATAAATTTGATAAAGG + Intergenic
1016402270 6:143693645-143693667 AAAAATCAGAAAAAAGACAATGG - Intronic
1016711320 6:147175489-147175511 AAAAATATGAAAGTTAGCCAGGG + Intergenic
1016737461 6:147494692-147494714 AAAAAAAATAAAGTGGAGAAAGG - Intergenic
1016860828 6:148717241-148717263 AAAAAAAAAAAAAATGACAAAGG - Intergenic
1017051964 6:150401786-150401808 TTAATTAAGAAAGTTGAAAATGG + Exonic
1017174164 6:151486577-151486599 AAAAATTAGAAAATTTAAAATGG + Intergenic
1017285923 6:152676357-152676379 AAAAATCAAAAAGTGGGCAAAGG + Intergenic
1017711695 6:157174809-157174831 AAAAAAAAAAAAAATGACAAAGG - Intronic
1017843001 6:158237346-158237368 AAAAAGAAGAAAGGTGGAAAAGG - Intronic
1018218554 6:161555133-161555155 ACAAATAAGAAAATTAAAAAGGG - Intronic
1018275206 6:162123012-162123034 AAAAAAAAAAAAGTTGAGACTGG + Intronic
1018293005 6:162312294-162312316 AAAAATCAGAAAGGAAACAAAGG - Intronic
1018506546 6:164476218-164476240 GAAAATAGGAAAGAGGACAAAGG + Intergenic
1018565710 6:165149900-165149922 AGAAATAAGAAAGATTATAAGGG - Intergenic
1019783297 7:2957627-2957649 AAAAAAAAAAAAGTTGAACATGG - Intronic
1019807871 7:3141892-3141914 AAAAATAAAAAACTTAACCAAGG + Intronic
1020031896 7:4939214-4939236 AAAAAAAACAAAGTTGAGGAGGG + Intronic
1020161281 7:5773864-5773886 AAAAATAAGAAATTTGGCTTGGG - Intronic
1020251641 7:6473551-6473573 AAATATAAGAAAGACAACAAAGG + Intronic
1020356906 7:7287546-7287568 AAAAAAAAAAAAATTGAAAACGG + Intergenic
1020362069 7:7337692-7337714 ACAAAAATGAAAATTGACAATGG - Intergenic
1020661950 7:10994015-10994037 AAAAAAAAAAAAGTTGTTAAGGG + Intronic
1020739533 7:11996625-11996647 AAAAAACAAAAAGTTGGCAAAGG - Intergenic
1020882560 7:13780183-13780205 AAAAATATGAAAGATTAAAAAGG + Intergenic
1020922009 7:14277928-14277950 AAAAAGATGAAAGATAACAAAGG - Intronic
1020976301 7:15011630-15011652 AAAAAAAAAAAAGCTGAGAAAGG - Intergenic
1021173356 7:17420923-17420945 AAAAATAAGAGTGAAGACAAGGG - Intergenic
1021180130 7:17496438-17496460 ATAAATTAAAAAGTTGACAGAGG + Intergenic
1021428054 7:20525668-20525690 AAAACTAAGATGGTTGCCAATGG - Intergenic
1021677370 7:23095091-23095113 AAAAATAATAAATATGAAAATGG - Intergenic
1021805768 7:24353378-24353400 TAAAATAAGAACCTTGATAAAGG + Intergenic
1022062275 7:26809420-26809442 AAAAAAAAAAAAGTGGGCAAAGG + Intronic
1022121609 7:27313754-27313776 AAAAATAAAAAAGTAGAGAAGGG - Intergenic
1022223961 7:28343859-28343881 AAAAATACAAAAGATAACAAAGG - Intronic
1022399239 7:30021204-30021226 ATAAATAAGAATGTTAAAAATGG - Intronic
1022599184 7:31740269-31740291 AAAAATAACAATATTGGCAAAGG + Intergenic
1022820463 7:33954890-33954912 AAAAATAAAAAAATTGATAAAGG - Intronic
1022882988 7:34609257-34609279 AAAAATAATAAAGATAAAAAGGG + Intergenic
1023228190 7:37994691-37994713 AAAAAAAAAAAAGTCTACAATGG + Intronic
1023345109 7:39263984-39264006 GAAAATTAGCAAGTTGACATTGG - Intronic
1023727484 7:43159170-43159192 AAAAAAAAGAAAATGAACAAAGG - Intronic
1023769518 7:43542824-43542846 AAAAAGAAGAAAGAGGACACGGG - Intronic
1023947639 7:44816050-44816072 AAAAGAAAGAAAGTAGATAAAGG + Intronic
1024025780 7:45408696-45408718 AAAAATGACAAAAATGACAAGGG + Intergenic
1024072746 7:45800239-45800261 AAAAAAAAGAAAGATGCCCAGGG + Intergenic
1024128992 7:46330940-46330962 AAAAAAAAAAAAGTGGGCAAAGG - Intergenic
1024269292 7:47630059-47630081 AAAAATACGAAAGTTAGCCATGG - Intergenic
1024398608 7:48897301-48897323 AAAAATCAGAAATTTTACTAAGG + Intergenic
1024414078 7:49081956-49081978 AGAAATCAGAAAGTAGAAAATGG + Intergenic
1024585381 7:50837263-50837285 AAAAATAATAAAGCAGAAAATGG - Intergenic
1024591902 7:50893603-50893625 AAAAATAAGGAAATTTACAGGGG - Intergenic
1024650592 7:51399941-51399963 AAAAAAAAGAAAGATGCCCAAGG - Intergenic
1024743374 7:52379339-52379361 TAAATTAAGAAAATGGACAAAGG + Intergenic
1024794578 7:53005667-53005689 AACAATAAGAAAGTTAATATTGG + Intergenic
1024841234 7:53590341-53590363 AAAAAAAAAAAAATTGTCAATGG - Intergenic
1024850649 7:53712327-53712349 AAAAATAAGTAAATGGATAAAGG - Intergenic
1025054711 7:55755525-55755547 AAAAAAAAGAAAGATGCCCAGGG - Intergenic
1025132781 7:56385750-56385772 AAAAAAAAGAAAGATGCCCAGGG - Intergenic
1025286755 7:57668693-57668715 AAAAATAAAAAGGTGGACCATGG + Intergenic
1025520715 7:61725719-61725741 AAAAATAAAAAAGTGGGCGAAGG + Intergenic
1025607328 7:63048655-63048677 CAAAGGAAGAAAGTTGAGAATGG - Intergenic
1026005895 7:66600132-66600154 AAAAAAAAAAAAGATGGCAAAGG + Intergenic
1026115717 7:67494100-67494122 AAAAAAAAAAAAGTTGTCAGAGG - Intergenic
1026138936 7:67687993-67688015 AAAAATAATAATGTTTAAAATGG - Intergenic
1026258317 7:68732179-68732201 AAAAAAAAGAAACGTGAGAATGG - Intergenic
1026424893 7:70280993-70281015 AAAAATAAGAACGTGGATATGGG - Intronic
1026838800 7:73656465-73656487 AAAAAAAAAAAAGTTGAAAAAGG + Intergenic
1026976270 7:74500718-74500740 AAAAATAAAAAATTTAAAAAAGG - Intronic
1027201695 7:76068054-76068076 AAAATTTAGAAAAGTGACAAGGG - Intergenic
1027469825 7:78559380-78559402 AGAAATAAGAAAAATGAAAAGGG + Intronic
1027606592 7:80307128-80307150 AAAAAATAGAAAGGGGACAAAGG + Intergenic
1027688968 7:81317788-81317810 TGAAAGAAGGAAGTTGACAAAGG + Intergenic
1027767275 7:82360955-82360977 AAAAATAAAAAAGTTGAAGATGG - Intronic
1027812767 7:82926034-82926056 AAAAATAAGAAAGATAACAGAGG + Intronic
1027983922 7:85261004-85261026 AAAAATAAGAAAGAAAAGAAAGG + Intergenic
1028032725 7:85936718-85936740 CAGAATCTGAAAGTTGACAAAGG - Intergenic
1028083842 7:86612821-86612843 ATAAATAAGAAAACTGACCAAGG + Intergenic
1028095639 7:86756930-86756952 CAAAATAATAAACTTGAAAATGG - Intronic
1028202923 7:87983507-87983529 AAAAATAAGAAAGTTCAATAAGG - Intronic
1028262471 7:88683419-88683441 AAAAATTAGAACATTTACAATGG - Intergenic
1028615186 7:92757978-92758000 AAAAATTAAAAAGTGGGCAAAGG - Intronic
1028657245 7:93222741-93222763 AAAATTAAGAGAGTCGAGAAAGG - Intronic
1028764880 7:94543101-94543123 AAATAAAAGAGACTTGACAAAGG + Intronic
1029523337 7:101078616-101078638 AAAAATAAAGAAATTGACATTGG + Intergenic
1029639197 7:101808032-101808054 AAAAAAAAAAAAGATGACATAGG + Intergenic
1030108212 7:106004899-106004921 AAGAGTAAGAAAGTGAACAAGGG - Intronic
1030257027 7:107521459-107521481 AAAAATCACAAAGTGGGCAAAGG + Intronic
1030349912 7:108472954-108472976 AAAAAAAGGAAAGTTGGAAAGGG - Intronic
1030639920 7:111992916-111992938 AAAAAAAAGAAAATTTAAAAAGG + Intronic
1030649831 7:112105613-112105635 AAAAAGAAGAAAGAGGAAAAAGG - Intronic
1030781614 7:113608158-113608180 AAAAAAAAGTAAAATGACAAGGG - Intergenic
1030790938 7:113727813-113727835 AAAAATAAAAAATATGACCAGGG - Intergenic
1030823735 7:114128408-114128430 AAAAAAAAGAAATTTAAAAAGGG - Intronic
1030826343 7:114163977-114163999 AAACTTAATAAAGTTGACTACGG + Intronic
1031109136 7:117584519-117584541 ACAAATAGGCAAGTAGACAATGG - Intronic
1031239736 7:119221387-119221409 AAAAAAAAGAATGTTGAATATGG - Intergenic
1031308599 7:120164812-120164834 AAAAAAAAGAAAAATGCCAAGGG - Intergenic
1031431743 7:121679316-121679338 AAATATAAGAAAGTTACCGATGG + Intergenic
1031529591 7:122860159-122860181 AAAAATAAGAGACTAGCCAAAGG + Intronic
1031856772 7:126932300-126932322 AAAAGTAAGGAAGTTAAGAAAGG + Intronic
1031869436 7:127076072-127076094 AAGAAGAAGAAACTTGAGAAAGG + Intronic
1031944633 7:127826194-127826216 AAATAAAATAAAGTTGACAGTGG + Intronic
1032001769 7:128270642-128270664 AAAATTAAAAAAGAAGACAAGGG + Intergenic
1032244603 7:130199201-130199223 AAAAATTAAAAAGGTGACAAAGG - Intronic
1032950487 7:136903870-136903892 AAAAATAAAACATTTGATAAAGG - Intronic
1032965107 7:137087490-137087512 AAAAGAAAGAAAATTGACAGAGG - Intergenic
1032980856 7:137280901-137280923 AAAAATAAGAATGAAGACCAAGG + Intronic
1032982118 7:137296390-137296412 ATAAATAGAAAGGTTGACAAAGG + Intronic
1033079428 7:138280871-138280893 CAAAACCAGAAAGTTGACATTGG - Intergenic
1033100743 7:138469322-138469344 AAAAAAAAAAAAATTGAGAAAGG - Intronic
1033181688 7:139185303-139185325 AAAAATCAGGAAATTGACACTGG - Intronic
1033827027 7:145204126-145204148 GAAAATAAGAAAGAGGAGAAGGG + Intergenic
1033918273 7:146355065-146355087 AAAAATAAGTAAGGTAAAAATGG + Intronic
1033929060 7:146501519-146501541 ACAAATAAAAAAGCTTACAAAGG - Intronic
1033975314 7:147093900-147093922 AAAAATAGGAAAGAAGAAAAAGG + Intronic
1033990241 7:147274490-147274512 AAAAATTAAAAAGTGGGCAAAGG - Intronic
1034033522 7:147794891-147794913 AGAAATAAAAAAGATGATAAGGG - Intronic
1034173153 7:149078685-149078707 AAAAAAAAAAAAGTTAACTATGG + Intronic
1034216680 7:149412820-149412842 AAAAAAAAAAAAGTGGGCAAAGG + Intergenic
1034381567 7:150699705-150699727 AAAAAAAAAAAAGTTAAAAAAGG + Intergenic
1034607900 7:152334460-152334482 GAAAGAAAGAAAGTAGACAAAGG + Intronic
1034654632 7:152719784-152719806 AAAAAAAAAAAAATAGACAAAGG - Intergenic
1034712010 7:153201080-153201102 AAAAAAAAAAAAATGGACAAGGG + Intergenic
1034726626 7:153342067-153342089 AAAAAAAAGGAAAGTGACAAAGG - Intergenic
1035959211 8:4118410-4118432 AAAAATCAAAAAGTATACAAAGG + Intronic
1035991823 8:4499746-4499768 AAAAATAAGAAAGTTAGTAAAGG + Intronic
1036047564 8:5160703-5160725 AAAAATAAGAGACTTGAGGAAGG - Intergenic
1036105785 8:5837110-5837132 AAAAATTGAAAATTTGACAATGG + Intergenic
1036171128 8:6486056-6486078 AAACATAAGAAATTTGAGAGAGG + Intronic
1036512742 8:9415649-9415671 AAATATAAGAAAGTTCAGAGAGG + Intergenic
1036941154 8:13053957-13053979 AAAAAAAAAAAAGTGTACAAGGG - Intergenic
1037067558 8:14601113-14601135 AAAAATAATCAAGTTGTAAAGGG - Intronic
1037158239 8:15732845-15732867 AGAAATAAAAATGTTGAGAATGG - Intronic
1037332211 8:17754438-17754460 AAATGTAAGAAAGTGGAGAAGGG - Exonic
1037378578 8:18260243-18260265 AAAAATAGGAAAGTTAGAAATGG - Intergenic
1037458436 8:19085251-19085273 AACAAAAACAAAGTTGAGAAGGG - Intergenic
1037523004 8:19698181-19698203 AAAAATAAGAAATTTGTCCAAGG + Intronic
1037543325 8:19893232-19893254 AAAAATCAAAAAGTGGGCAAAGG + Intergenic
1037868954 8:22473458-22473480 AAAAAAAAAAAAGTGGATAAGGG - Intronic
1038114339 8:24536010-24536032 AAATATTTGAAAGTTGCCAAGGG + Intergenic
1038119749 8:24599712-24599734 CAAAATCAGGAAGTTGACACTGG + Intergenic
1038321874 8:26534545-26534567 AAAAATAAGTAAGTTGACCAAGG - Intronic
1038789089 8:30651212-30651234 AAAAATTAAAAAGTTCACACCGG + Intronic
1038837873 8:31148535-31148557 AAATATATGGAAGTTGAAAATGG - Intronic
1038972414 8:32650670-32650692 AAAAAAAAAAAAGCTTACAAAGG + Intronic
1039086194 8:33782771-33782793 AAAAATAGGAATGTTGATATTGG - Intergenic
1039319802 8:36415988-36416010 ACAAATGAGATAATTGACAAAGG + Intergenic
1039636548 8:39173495-39173517 AAAAATTAAAAAGTGGACAAAGG - Intronic
1039864077 8:41485857-41485879 AAAAAAAACAGAGTTGAAAATGG + Intergenic
1039875509 8:41581615-41581637 AAAAAAAAAAAAGTCAACAAAGG - Intronic
1039998253 8:42553986-42554008 AAAAAAAAAAAAGTTAATAATGG + Exonic
1040036091 8:42871565-42871587 AAAAAAAAAAAAGTAGAGAAGGG - Intronic
1040042459 8:42930479-42930501 AATAAAATGAAAGTAGACAATGG - Intronic
1040398948 8:47028557-47028579 AAAAATTACAAAATTGAGAAGGG + Intergenic
1040442241 8:47455734-47455756 AAATCTAAAAAAGTTTACAAGGG + Intronic
1040467496 8:47708693-47708715 AAAAATAAGAATGTTTGCCAGGG - Intronic
1040676802 8:49759926-49759948 AAAAATAAGAAAGAATAAAAAGG + Intergenic
1040914826 8:52558362-52558384 AAAAAAAAAAAAGTTCAGAATGG + Intronic
1041061232 8:54036684-54036706 AAAAAAAAAAAAGATGAGAAAGG - Intergenic
1041180673 8:55244886-55244908 AAAAAAAAAAATGTTGGCAAAGG - Intronic
1041364013 8:57082625-57082647 AAAAAAAAAAAAGTGGGCAAAGG + Intergenic
1041614544 8:59890859-59890881 AAAACCCAGAAAGTTGACATCGG - Intergenic
1041661435 8:60405257-60405279 ACAAATCAGAAAGTTGCCAATGG + Intergenic
1041698199 8:60759791-60759813 AAAAATAAGGTTGTTGAGAACGG + Intronic
1041793845 8:61725617-61725639 AAAAATATTAAAGTTTACAATGG + Intergenic
1041932929 8:63307202-63307224 AAAAAAAAAAAAATTGGCAATGG + Intergenic
1041933182 8:63309310-63309332 AAAAAGAGGAAAGCAGACAATGG - Intergenic
1042130181 8:65580180-65580202 AAAAAAAAGAAAAATGACATTGG - Intergenic
1042373138 8:68016150-68016172 AAAAATTAGAAAGTGTACAAAGG + Intronic
1042566814 8:70119863-70119885 AAAAAAAAAAAAGTGGACAAAGG - Intronic
1042613244 8:70620802-70620824 AAAAGAAACAAAGGTGACAAAGG + Intronic
1042764922 8:72310535-72310557 AAAAATCAAAAAGTGGGCAAAGG - Intergenic
1042871369 8:73402854-73402876 AAAAAAAAAAAAGTGGGCAAAGG + Intergenic
1042937045 8:74070080-74070102 AAAAGAAAGAAAATTGGCAAAGG - Intergenic
1043011973 8:74892546-74892568 AAATATATGGAATTTGACAATGG - Intergenic
1043083485 8:75796835-75796857 AAAAAAAAAAACTTTGACAAAGG - Intergenic
1043101087 8:76046727-76046749 AAAAATAAGGAAGTTAAAATTGG + Intergenic
1043155093 8:76768935-76768957 AAAGATAAGAAAGTTGAGCTAGG + Intronic
1043172772 8:76986306-76986328 AAAAAGAATAAAGTTTAAAAGGG + Intronic
1043263811 8:78236841-78236863 ACAAATAAGAAATTAAACAATGG + Intergenic
1043693810 8:83192733-83192755 AAAAATAAGAAAGATACTAAGGG + Intergenic
1043817774 8:84824269-84824291 AAAAATAAGTCAGTAAACAAAGG + Intronic
1043852504 8:85230811-85230833 AAAACTCAGAAAGTTGGCAAAGG + Intronic
1044077284 8:87838090-87838112 AAAAATAAGAAAGTATGCTATGG + Intergenic
1044311997 8:90704526-90704548 AAAAAAAAAAAAGTGGGCAAAGG - Intronic
1044435147 8:92153103-92153125 AAAAAGAAGAAAGAGGACATAGG - Intergenic
1044750219 8:95408599-95408621 AAAAACAAGAAAGATGACCATGG + Intergenic
1045068990 8:98480269-98480291 AAAAATAAAAAAGTTGTGAAAGG + Intronic
1045202776 8:100002570-100002592 AAATATATGAATGATGACAAAGG + Intronic
1045420416 8:102009028-102009050 AAAAATAAAAAAGTGGAGAAGGG + Intronic
1045611878 8:103853250-103853272 AAAAATTAAAAAGTTGGCAAAGG - Intronic
1045760206 8:105596729-105596751 AAAAAAAAAAAAGCAGACAAAGG - Intronic
1046052208 8:109037433-109037455 AAAAATGAGAATATTGATAATGG - Intergenic
1046059878 8:109125809-109125831 AAAAACAAAAAACCTGACAAAGG + Intergenic
1046154695 8:110272708-110272730 AAAGAAAAGTAAGTTTACAAAGG - Intergenic
1046427893 8:114079375-114079397 AAAAATAAAAAAGATAATAAAGG + Intergenic
1046456646 8:114473348-114473370 AAAAAAAAAAGAGTTAACAATGG + Intergenic
1046471964 8:114687543-114687565 AAAAATAATAAAAGTGACTAGGG + Intergenic
1046520806 8:115323157-115323179 AAAAATAAGAAAGTTTATAAAGG - Intergenic
1046545318 8:115642051-115642073 AAAAATTAGAAAATTAGCAAAGG + Intronic
1046684083 8:117205445-117205467 AAAAATAACAAAGAGGCCAATGG + Intergenic
1046732427 8:117739836-117739858 AAAAATAAAAAAGTTCACTGGGG - Intergenic
1046756838 8:117980935-117980957 AGTAATAAGAAAGCAGACAACGG - Intronic
1046842819 8:118879528-118879550 AAAAATAATAAAATTCAGAAGGG - Intergenic
1047044757 8:121039829-121039851 GAAAAGAAGAAAGCTGAAAATGG + Intergenic
1047634603 8:126746830-126746852 AAAAACATGAAAGATAACAAGGG + Intergenic
1047681993 8:127263804-127263826 AAAAAAAAGAAAGATACCAATGG - Intergenic
1047685865 8:127304207-127304229 AATAATAATAAAGTTGGGAATGG - Intergenic
1047763256 8:127969780-127969802 AGAAATAAGAAACTTGCCTAAGG + Intergenic
1047819676 8:128504875-128504897 AATAATAAAAGAGTGGACAAGGG - Intergenic
1047881978 8:129204894-129204916 AAAAAAAATAAAGTTAACTATGG - Intergenic
1047917599 8:129599489-129599511 AAAAAAAAGAGAGTGGGCAAAGG - Intergenic
1048582120 8:135738151-135738173 AAAAAAAAAAAAGTGGGCAAAGG - Intergenic
1049106702 8:140618327-140618349 AAAAAAAAAAAAGTTGGCCAAGG + Intronic
1049811887 8:144579218-144579240 AAAAAAAAGAAAGTGAAAAAAGG + Intronic
1049946588 9:602855-602877 AAAAATATGAAAAATTACAAAGG - Intronic
1050055861 9:1653582-1653604 TAAAATAAGAAAGGTAATAATGG + Intergenic
1050178306 9:2892723-2892745 AAACCTAAGAGAATTGACAAAGG + Intergenic
1050679897 9:8098749-8098771 AAGAAAAAGAAAGTGGGCAAGGG - Intergenic
1050794884 9:9525804-9525826 AAAAAAAAAAAAGTTTACAAAGG - Intronic
1050954886 9:11643285-11643307 CAACACAAGAAAGGTGACAATGG - Intergenic
1050984143 9:12060454-12060476 AATAATAAGACAACTGACAAAGG - Intergenic
1051215703 9:14795035-14795057 AAAAATAATAAAGTGGAGATTGG + Intronic
1051427429 9:16947127-16947149 AAAAATGAGAAAGTTAAATAAGG + Intergenic
1051520620 9:17983020-17983042 AAAAAAAAAATAGTTGAAAAGGG - Intergenic
1051698184 9:19790768-19790790 TAAACTAGGAAAGTAGACAAAGG - Intergenic
1052083169 9:24231867-24231889 AAAAAAAGGAAAGTTGATCAAGG - Intergenic
1052974681 9:34401962-34401984 AAAAAAAAAAAAGATGAGAAGGG - Intronic
1053457716 9:38243603-38243625 AAAAAAAAAAAAATTTACAATGG + Intergenic
1053550626 9:39075838-39075860 AAAAACAAGCAAGTTTACTAAGG - Intronic
1053584272 9:39440133-39440155 AAAAATATGAGATCTGACAAAGG + Intergenic
1053794266 9:41710689-41710711 AAAAATAAAAAGGTGGACCATGG + Intergenic
1053814735 9:41895937-41895959 AAAAACAAGCAAGTTTACTAAGG - Intronic
1054105852 9:60998879-60998901 AAAAATATGAGATCTGACAAAGG + Intergenic
1054164731 9:61713332-61713354 AAAAATATGAAGGAGGACAAAGG - Intergenic
1054182674 9:61922733-61922755 AAAAATAAAAAGGTGGACCATGG + Intergenic
1054470684 9:65535245-65535267 AAAAATAAAAAGGTGGACCATGG - Intergenic
1054615861 9:67291504-67291526 AAAAACAAGCAAGTTTACTAAGG + Intergenic
1054655833 9:67665746-67665768 AAAAATAAAAAGGTGGACCATGG - Intergenic
1054988426 9:71290884-71290906 AAAGAGAAAAAAGTTGAAAAAGG + Intronic
1055064573 9:72105614-72105636 AAAAAAAAAAAAGATTACAATGG + Intergenic
1055227659 9:74019258-74019280 AAAAATAAAAAAGAGGAGAAGGG + Intergenic
1055335581 9:75229930-75229952 AAAAAAAAAAAAGCTGGCAAAGG + Intergenic
1055372122 9:75611447-75611469 AAAAATTGGAGAGTTGACACAGG - Intergenic
1055716020 9:79118995-79119017 GAAAATAAAAATGTTGACCATGG - Intergenic
1055769702 9:79704105-79704127 AAAAGAAAGAAAGTTGGGAAAGG - Intronic
1056027632 9:82515839-82515861 ACAAATAAGAAAGCTGAGACTGG + Intergenic
1056087787 9:83169847-83169869 AATAAAAAGAAATCTGACAATGG - Intergenic
1056255259 9:84792774-84792796 AAGATTAAGAAAGTTGCCCAAGG + Intronic
1056328502 9:85502433-85502455 TAAATTAAGAACCTTGACAAAGG + Intergenic
1056628226 9:88271815-88271837 AAAAAAAAGAAAACAGACAAAGG + Intergenic
1056829540 9:89904001-89904023 GAAAATAATAAACTTGGCAATGG + Intergenic
1056856315 9:90132540-90132562 AAAAATAAGTCAGTAGTCAATGG + Intergenic
1056995025 9:91448105-91448127 AAAAAAAAGACATTTGACAAGGG - Intergenic
1057127443 9:92629714-92629736 AAAAAAAAAAAAGTAGGCAAAGG + Intronic
1057688817 9:97264107-97264129 AAAAAAAAAAAGGTTGACGATGG - Intergenic
1057937200 9:99250256-99250278 GAAAAAAAGAAAATTGAAAAAGG - Intergenic
1058016260 9:100035714-100035736 AAAAAACAAAAAGTGGACAAAGG + Intronic
1058103961 9:100949234-100949256 AAATATAATAAAATTAACAATGG + Intergenic
1058111139 9:101031578-101031600 AAAGATAAGAAAGTAAAAAATGG + Intronic
1058235842 9:102488462-102488484 AAAAAAAAGAAAATTGTAAATGG + Intergenic
1058423913 9:104860065-104860087 AAAAAAAAGAATACTGACAACGG + Intronic
1058604512 9:106706518-106706540 AAAAAAAAAAAAGTTGTGAAGGG - Intergenic
1058726061 9:107805280-107805302 AACAATAAGATAGTTGACAATGG - Intergenic
1058832823 9:108834182-108834204 AAAAATAAGAATGTTAATATTGG - Intergenic
1058867621 9:109176121-109176143 AAAAAAAAAAATGTTTACAAGGG - Intronic
1059044587 9:110852228-110852250 ACAAATAAGAATGTTTACTATGG + Intergenic
1059215560 9:112558259-112558281 AAAAATAAGAATAATGAGAAGGG + Intronic
1059218277 9:112587691-112587713 AAAATAAAGAAAATTGAAAAAGG - Intronic
1059320593 9:113465386-113465408 ATAAATCAGAAAGTTAACAGTGG - Intronic
1059369947 9:113821658-113821680 GAAAATAATAAAGATCACAATGG + Intergenic
1059688827 9:116663900-116663922 AGAAATAAGGAAGGTCACAATGG - Intronic
1059719833 9:116948948-116948970 AAAAATAAAAAATTAGCCAATGG - Intronic
1059800356 9:117744188-117744210 AAAAAGAAAAAAGTTGACCAAGG - Intergenic
1059850494 9:118333013-118333035 AATAATAAGAAAGTGTAAAATGG - Intergenic
1060326796 9:122624279-122624301 AAAAAGAACATAGTTGTCAATGG + Intergenic
1060428954 9:123531754-123531776 AGAAATAAGAAACTTAAAAATGG + Intronic
1060489744 9:124074015-124074037 GAAAGGAACAAAGTTGACAAAGG - Intergenic
1060499665 9:124143555-124143577 AAAAAAAGGAAAATTTACAAAGG + Intergenic
1060891712 9:127193372-127193394 GAGAATAAGAAAGTTGGCTAAGG + Intronic
1062298202 9:135846699-135846721 AAAAATCAAAAAGTGGGCAAAGG + Intronic
1062371690 9:136242554-136242576 AAACATGAGAATGTTGACAACGG + Intronic
1062575735 9:137206515-137206537 AAAAATAAGAAAGGTTAAAACGG - Intronic
1203620571 Un_KI270749v1:124505-124527 AGCAAAAAGAAAGCTGACAATGG + Intergenic
1185782234 X:2858832-2858854 AACAACAAAAAAGTTGGCAAGGG + Intronic
1186058783 X:5681198-5681220 CAAAATGAGAAAGTTGACATGGG + Intergenic
1186086550 X:5996591-5996613 AAAAAAAAAAAAGGTGAAAAGGG - Intronic
1186305646 X:8254335-8254357 AAAATTTAAAAAGTTGACAGTGG + Intergenic
1186583325 X:10844765-10844787 AGAAATGAGAAACTTGACATAGG + Intergenic
1186744067 X:12547793-12547815 AAAATTAAGTAAGTTGGCAAAGG + Intronic
1186950545 X:14619665-14619687 AAAAATTAGAAAGTTGAATCAGG - Intronic
1186996320 X:15127113-15127135 AAAAAGATGAAAGTTAACAAGGG - Intergenic
1187197404 X:17100729-17100751 AAAAATAAAAAACGTGGCAAAGG + Intronic
1187326931 X:18299519-18299541 AAAAAAAAAAAAGTGGACAAAGG + Intronic
1187545295 X:20245770-20245792 AAAAATAATATACTTAACAATGG - Intronic
1187743228 X:22379288-22379310 AAAAAAGAGTAAGTTGACAGTGG - Intergenic
1187942472 X:24395293-24395315 AAAAAAAAAAAGGTTTACAAAGG - Intergenic
1187992733 X:24893381-24893403 AAAAAAAAGTAAATTGAAAAAGG - Intronic
1187999856 X:24970618-24970640 AAAAATTAAAAAGTGGGCAAAGG + Intronic
1188036863 X:25328491-25328513 TAAAATAAGAAAGATGCCAAAGG - Intergenic
1188062109 X:25613715-25613737 AAAAATAATTAAGTTCACCATGG - Intergenic
1188091518 X:25970244-25970266 AAAAAAAAAAAAGCTGAAAATGG - Intergenic
1188221078 X:27542523-27542545 AAAAAAAAAAAAGTAGGCAAAGG - Intergenic
1188328663 X:28840268-28840290 CAAAATCAGAAAATTGACATTGG + Intronic
1188418695 X:29970704-29970726 AAGAATAATGAGGTTGACAATGG - Intergenic
1188557902 X:31432416-31432438 AAAAGTGAGAAAGTTTAGAAAGG + Intronic
1188615140 X:32149063-32149085 CAAAATATGAAAGTAGAAAAAGG + Intronic
1189533666 X:41913363-41913385 AAAAATAATAATAATGACAATGG + Intronic
1189550556 X:42088166-42088188 AAAAATAGCAAACTTGATAAGGG - Intergenic
1189635663 X:43005731-43005753 AAAAAGAAGGAAGGTGAGAAAGG - Intergenic
1189754623 X:44258445-44258467 AAAAATCAAAAAGTGGACAAAGG + Intronic
1189985858 X:46552754-46552776 AAAAAAAAGAAAGATGAAAGGGG + Intergenic
1190022111 X:46888608-46888630 AAAATTAAGCAAGTTTATAAGGG - Intronic
1190426860 X:50341385-50341407 AAAAATAAATAACTTTACAAAGG + Intronic
1190437901 X:50445111-50445133 AAAAAAAAAAAAGTGGGCAAAGG - Intronic
1190701608 X:52993394-52993416 AAAAAAAAGAAAGTTAAGACAGG - Intronic
1190838985 X:54128466-54128488 AAAAAAAAAAAAGTAGGCAAAGG - Intronic
1191112895 X:56821662-56821684 AAAAATAATAGAGTGGAAAAAGG + Intergenic
1191205754 X:57832594-57832616 AAAAATCAGAAAGTGGGCAAAGG + Intergenic
1191593892 X:62921189-62921211 AAAAAAACTAAAGTGGACAAAGG + Intergenic
1191635937 X:63376789-63376811 AAAAAAAAAAAAGTGGGCAAAGG + Intergenic
1191874373 X:65780214-65780236 AAAAACAAGAAAGAAGAAAAGGG + Intergenic
1191909973 X:66139597-66139619 AAATATCAAAAAGTTGAAAATGG - Intergenic
1191927691 X:66331414-66331436 AAAAATGAGAGAGGTGACACAGG - Intergenic
1191970302 X:66806831-66806853 AAAAATAAGAAATTTTGGAAAGG - Intergenic
1192250580 X:69410127-69410149 AAAAATAACAGAATTGACATAGG + Intergenic
1192787701 X:74351169-74351191 AAAAAAAAGAAAGTTGTAATGGG + Intergenic
1192821674 X:74653103-74653125 AAAAAAAAAAAAGTGGGCAAAGG - Intergenic
1192961224 X:76133096-76133118 AAAAATTAAAAAGTGGGCAAAGG + Intergenic
1193075935 X:77355663-77355685 AAAAATAAAAAAGCAAACAAAGG - Intergenic
1193082707 X:77421674-77421696 AAAATCCAGAAAGTTGAAAATGG - Intergenic
1193316231 X:80068265-80068287 AAAAATTAAAAAGTGGGCAAAGG - Intergenic
1193448716 X:81640040-81640062 AAAAATTAAAAAGTGGGCAAAGG - Intergenic
1193568770 X:83114779-83114801 ACAAAGAAGAAAGTTGGCAAAGG - Intergenic
1193720832 X:84985759-84985781 AAAAATAAAAAAATTAAAAAGGG - Intergenic
1193782660 X:85722939-85722961 AAAAAAAAAAAAGTGGGCAAAGG - Intergenic
1193849361 X:86517407-86517429 AAAAAAAAAAAAGTGGGCAAAGG - Intronic
1194099076 X:89679482-89679504 AAAAATCAAAAAGTGGGCAAAGG + Intergenic
1194117263 X:89918549-89918571 AAAATAAAGAATGTTGTCAAGGG - Intergenic
1194166012 X:90517431-90517453 TAAAATAACAATGGTGACAATGG - Intergenic
1194196187 X:90895528-90895550 AAAAATGAGAAAGGTGGGAAAGG - Intergenic
1194275242 X:91871741-91871763 AAAAAAGAGAAAGTTGACGTTGG - Intronic
1194347258 X:92781500-92781522 AAAAATAAGCACTTAGACAAAGG + Intergenic
1194441440 X:93939258-93939280 AAAAAAAAAAAAGTGGCCAAAGG + Intergenic
1194514763 X:94838915-94838937 AAAAATAAGAACATTAAAAAAGG - Intergenic
1194708616 X:97205484-97205506 AAAAATCAAAAAGTAGGCAAAGG + Intronic
1195024047 X:100857701-100857723 AAAAAAAAAAAAGTGGGCAAAGG - Intronic
1195429805 X:104776067-104776089 ATAAATTAGTAAGTTGTCAAGGG - Intronic
1195475641 X:105281989-105282011 AAAAAATAGAAAGTTAACTAGGG + Intronic
1195503372 X:105628945-105628967 AAAAAAAAAAAAGTTGAGCAGGG + Intronic
1195640474 X:107169314-107169336 AAAAAGAAAAAAGTAGACAAAGG + Intronic
1195642685 X:107194060-107194082 ATAAATAAGAAAGATGGAAAAGG + Intronic
1195779517 X:108446245-108446267 AAAACTAAGAATGTTAACATGGG - Intronic
1195833192 X:109083326-109083348 ATAAAAAAGAAAGTGGGCAAAGG - Intergenic
1196034540 X:111129881-111129903 AAGAAGAGGAAAATTGACAAAGG + Intronic
1196077844 X:111596715-111596737 AAACAGAAGACAGTGGACAAGGG - Intergenic
1196330417 X:114466528-114466550 AAAATTAAGAAAGACCACAAGGG + Intergenic
1196373918 X:115010415-115010437 AAAGATAAGAAATTTAATAAAGG - Intronic
1196592286 X:117500407-117500429 AAACATTAAAAAGTGGACAAAGG + Intergenic
1196833649 X:119795480-119795502 AAAAAAAAAAAAATTGAGAAAGG + Intergenic
1196841725 X:119865483-119865505 AAAAATAAAAAACTTAGCAAGGG - Intergenic
1196928191 X:120655048-120655070 AAAAACAAAAAGGTTGAAAAAGG - Intergenic
1197171143 X:123435825-123435847 AAAAATAAGAAAGTCATCAGTGG - Intronic
1197266735 X:124382199-124382221 AAAAATAATAAATATTACAAGGG - Intronic
1197297011 X:124731079-124731101 AAAAATAAGTAAGTTTAAGAGGG + Intronic
1197319759 X:125013120-125013142 AAAAATAAGTAACTTCACAAAGG - Intergenic
1197442613 X:126510358-126510380 AAGAAAAAGAAATTTGAAAAAGG + Intergenic
1197443662 X:126521950-126521972 AAGAAGAAGAAAGTAAACAAAGG + Intergenic
1197645646 X:129013622-129013644 AAAAAGAAGGAAGTTGATAGAGG - Intergenic
1197823182 X:130562278-130562300 GAAACTAAGAAAGTTGCCCATGG + Intergenic
1198544733 X:137679367-137679389 AGAAACAAGTAAGTTGATAAAGG + Intergenic
1198653563 X:138889922-138889944 AAAAAAAAAAAAGTTCAAAAGGG - Intronic
1198973713 X:142310930-142310952 AAAATAAAGAAAATTTACAAAGG + Intergenic
1199065327 X:143409823-143409845 AACACTATGAAAATTGACAAAGG - Intergenic
1199245288 X:145597673-145597695 AAAAATTAAAAAGTGGGCAAAGG + Intergenic
1199299579 X:146197240-146197262 AAAATACAGTAAGTTGACAACGG - Intergenic
1199997340 X:153033686-153033708 AAAAAAAAAAAAAATGACAATGG - Intergenic
1200362804 X:155628490-155628512 AAAAATAAAAAAGTGGTCAAAGG + Intronic
1200452091 Y:3340860-3340882 AAAAATCAAAAAGTGGGCAAAGG + Intergenic
1200512281 Y:4095202-4095224 TAAAATAACAATGGTGACAATGG - Intergenic
1200542031 Y:4469720-4469742 AAAAATGAGAAAGGTGGGAAAGG - Intergenic
1200655586 Y:5898138-5898160 AAAAATAAGCACTTAGACAAAGG + Intergenic
1200860906 Y:7991550-7991572 GAAAATAAGAAAGTTCATACTGG - Intergenic
1200911052 Y:8531810-8531832 AAAAACAAGAATCCTGACAAAGG - Intergenic
1201521660 Y:14882194-14882216 AAAAATCAAAAAGTGGACAAAGG - Intergenic
1201618407 Y:15927393-15927415 AAGAAGAAAAAGGTTGACAATGG - Intergenic
1201675733 Y:16582201-16582223 AAAAATGAGAAAGATGAGAGGGG - Intergenic
1202041520 Y:20690303-20690325 AAAAAAAAAAAAGTGGGCAAAGG - Intergenic
1202042955 Y:20704519-20704541 ACAAATAAGAAAATGGAAAATGG + Intergenic
1202375508 Y:24231979-24232001 AAAACCAAGAAAGATGACATGGG + Intergenic
1202495272 Y:25438140-25438162 AAAACCAAGAAAGATGACATGGG - Intergenic
1202578235 Y:26350208-26350230 AAAAAAAAAAAAGTTGGCAGAGG + Intergenic