ID: 1122954523

View in Genome Browser
Species Human (GRCh38)
Location 14:105064357-105064379
Sequence CCAATTTGATAGTGTTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 81}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122954513_1122954523 27 Left 1122954513 14:105064307-105064329 CCTGCTCCACCACACCCATCCAA 0: 1
1: 0
2: 3
3: 213
4: 1208
Right 1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 81
1122954517_1122954523 12 Left 1122954517 14:105064322-105064344 CCATCCAAAGCCCATTGTCAACT 0: 1
1: 0
2: 1
3: 14
4: 197
Right 1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 81
1122954519_1122954523 2 Left 1122954519 14:105064332-105064354 CCCATTGTCAACTTTCTTATTTT 0: 1
1: 0
2: 3
3: 80
4: 990
Right 1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 81
1122954515_1122954523 18 Left 1122954515 14:105064316-105064338 CCACACCCATCCAAAGCCCATTG 0: 1
1: 0
2: 1
3: 14
4: 239
Right 1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 81
1122954512_1122954523 28 Left 1122954512 14:105064306-105064328 CCCTGCTCCACCACACCCATCCA 0: 1
1: 0
2: 5
3: 126
4: 896
Right 1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 81
1122954520_1122954523 1 Left 1122954520 14:105064333-105064355 CCATTGTCAACTTTCTTATTTTT 0: 1
1: 0
2: 14
3: 171
4: 1642
Right 1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 81
1122954514_1122954523 21 Left 1122954514 14:105064313-105064335 CCACCACACCCATCCAAAGCCCA 0: 1
1: 0
2: 11
3: 113
4: 1113
Right 1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 81
1122954516_1122954523 13 Left 1122954516 14:105064321-105064343 CCCATCCAAAGCCCATTGTCAAC 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 81
1122954518_1122954523 8 Left 1122954518 14:105064326-105064348 CCAAAGCCCATTGTCAACTTTCT 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122954523 Original CRISPR CCAATTTGATAGTGTTGCCC AGG Intronic
906000344 1:42419363-42419385 CGACTTTCTTAGTGTTGCCCTGG - Exonic
907098011 1:51799570-51799592 CCTACTTGACAGTTTTGCCCTGG - Intronic
908142946 1:61206436-61206458 CCAATTTCACAGTGTTGACTAGG + Intronic
909034069 1:70577161-70577183 CTTATTTGATAATGTTTCCCAGG - Intergenic
909442055 1:75707793-75707815 CAAATTTGATATTTTTCCCCTGG - Intergenic
911392629 1:97266232-97266254 CCAATTGGATACTGCTGCCTAGG - Intronic
911574680 1:99561453-99561475 CCCATTTCATAGTGTTGCTGAGG - Intergenic
916998896 1:170333626-170333648 CTAGTTTGTGAGTGTTGCCCTGG + Intergenic
917479594 1:175400563-175400585 ACAATTGAATAGTGTTGCCAAGG - Intronic
924748272 1:246859361-246859383 CCCATTTACTAGTGTTCCCCTGG + Intronic
924825367 1:247532651-247532673 ACAATTTCACTGTGTTGCCCGGG + Intronic
1065622537 10:27598430-27598452 CCAATTTGATAGTGTCTCATAGG + Intergenic
1078925460 11:15870747-15870769 CCAATTTGCTTCTGTGGCCCTGG - Intergenic
1079876452 11:25863604-25863626 CCAATTTGATATTGTTTCAAAGG - Intergenic
1082565619 11:54674923-54674945 CCAATTTGGTTCTGTTGCTCAGG - Intergenic
1086072233 11:82812087-82812109 CCCATTTGATAGTCTTGGCATGG - Intergenic
1086333662 11:85778339-85778361 ACTATTTGATAGTGTTACCCAGG + Intronic
1086671889 11:89557894-89557916 CCAACTTGATAGTGGTGTCAGGG + Intergenic
1087215842 11:95492860-95492882 CTTATTTGATAGTGTTGTTCAGG + Intergenic
1091367250 11:135032631-135032653 CAAATTTGACCGTGTTACCCTGG + Intergenic
1095754053 12:45743384-45743406 CAAATTTTACTGTGTTGCCCAGG + Intronic
1099691625 12:85961074-85961096 CCAATTTGTAATTCTTGCCCTGG - Exonic
1105637793 13:22232155-22232177 GCTATTTGACAGTGTTGCACAGG - Intergenic
1107939329 13:45370522-45370544 CCAGTCTGATTCTGTTGCCCAGG + Intergenic
1108086202 13:46796353-46796375 TCAATTTGATAGGGTTGCTCTGG + Intronic
1109062897 13:57641516-57641538 CCAATTTTATAGTCTATCCCCGG - Intronic
1118564242 14:67121971-67121993 CCAATTTGATAATAATGCTCTGG - Intronic
1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG + Intronic
1126286666 15:47020244-47020266 CATATTTGATAGTGTTTCACAGG - Intergenic
1127267599 15:57374393-57374415 ACAATTTCATTCTGTTGCCCAGG + Intergenic
1137269793 16:46895722-46895744 GCAACTTGAAAGTGTTGCCCAGG + Intronic
1137976527 16:53036892-53036914 CCAAGTTGAAAGTGTTTCCCGGG + Intergenic
1139184694 16:64791869-64791891 TCAATTCCATAGTGTTTCCCTGG + Intergenic
1140872197 16:79117200-79117222 ACAATTTCACCGTGTTGCCCAGG + Intronic
1143027188 17:3947837-3947859 CCGATGTGATATTGGTGCCCTGG + Exonic
1153007142 18:507052-507074 ACATTTTGCTACTGTTGCCCAGG - Intergenic
1154134817 18:11767077-11767099 CCAGTTTGATATTTCTGCCCAGG + Intronic
1156935003 18:42693123-42693145 CCAATTTGAAAAGGTTGCCAAGG - Intergenic
1157152630 18:45233502-45233524 CCTATTTCATGGTCTTGCCCGGG + Intronic
1161762788 19:6186886-6186908 CCAATTTCACTGTGTTGCCCAGG + Intronic
1165042122 19:33076053-33076075 GCAATTTTGCAGTGTTGCCCAGG - Intergenic
1165119951 19:33552592-33552614 ACAATTTGATTGGGTTCCCCAGG + Intergenic
1165135666 19:33666891-33666913 CCAGTTTCATTATGTTGCCCAGG + Intronic
926116035 2:10214064-10214086 CCATTTTGTTCTTGTTGCCCAGG - Intergenic
929803555 2:45124907-45124929 CCAGTTTGATAGTCTTGTCCAGG - Intergenic
930534874 2:52632783-52632805 CCAATTTTATAAGGCTGCCCAGG - Intergenic
934782861 2:96983614-96983636 ACAGTTTCATTGTGTTGCCCAGG + Intronic
936858971 2:116993363-116993385 ACAGTTGGATAGTGTTACCCTGG + Intergenic
937101389 2:119273252-119273274 CCATTTTGCTCTTGTTGCCCAGG - Intergenic
937811017 2:126199214-126199236 CCAATTTGTGAGTGTTGTCATGG - Intergenic
942091371 2:172494753-172494775 CTAATTTGACAGTGTTTTCCTGG - Intronic
942631087 2:177950260-177950282 TCAATTTGCTAGAGTTCCCCAGG + Intronic
1169698231 20:8415841-8415863 CCAGATTCATGGTGTTGCCCTGG - Intronic
1170369397 20:15632111-15632133 CAAATTTCATTTTGTTGCCCAGG - Intronic
1171790471 20:29518508-29518530 ACAATTTGATAGTGTTGAGATGG - Intergenic
1177378355 21:20303822-20303844 AGAATTTGATAATGTTACCCAGG + Intergenic
1181575981 22:23795213-23795235 ACGATTTGACTGTGTTGCCCAGG + Intronic
951533245 3:23718103-23718125 TCAATTTGCTAGTATTGGCCAGG + Intergenic
952690135 3:36195931-36195953 CCACTTTGATATACTTGCCCAGG - Intergenic
953380075 3:42463351-42463373 CCATATTGATAGTCATGCCCGGG + Intergenic
956109876 3:65859926-65859948 CAATTTTGCTATTGTTGCCCAGG + Intronic
962892575 3:139685461-139685483 CCATTTTCACAGTGGTGCCCTGG + Intergenic
968519634 4:1029651-1029673 CTAACTTGAAAGTGCTGCCCAGG + Intergenic
969047507 4:4347207-4347229 GCAATTGGACAGTGTTTCCCAGG + Intergenic
971362500 4:25950890-25950912 CCACTTTCATGGTGTTGCCCTGG - Intergenic
971585477 4:28400646-28400668 GCAGTTTGATAGTGAAGCCCTGG + Intronic
973603381 4:52563279-52563301 CCAATTTGAAAGTATTGGCCAGG + Intergenic
986595966 5:9422286-9422308 CCAATTTAAATGCGTTGCCCAGG - Intronic
988598256 5:32615459-32615481 CAACTTTGATAGTTTTGCCAAGG + Intergenic
988933822 5:36063229-36063251 TCAATATGAAAGTGTTGCTCAGG - Intronic
990119922 5:52438540-52438562 TCAATTTGCTAGAGTTCCCCAGG - Intergenic
992092960 5:73335458-73335480 CGAATTTTATCGTGTTGGCCAGG + Intergenic
1000817014 5:165936101-165936123 CCCATTTGCTAGCATTGCCCAGG + Intergenic
1004712561 6:18186170-18186192 ACAATTTGATCGTCTTGGCCTGG + Intronic
1019529960 7:1498504-1498526 CCAACTTGATGGTGGTGCCCAGG + Exonic
1021371506 7:19854293-19854315 TAAATTTGAGGGTGTTGCCCTGG - Intergenic
1024298931 7:47870805-47870827 CTAATTTCATCATGTTGCCCAGG - Intronic
1026343961 7:69457946-69457968 CCACTCTGATTGTGCTGCCCTGG - Intergenic
1037167629 8:15849879-15849901 CCACTTTGAGAGTGATGCTCCGG - Intergenic
1045272260 8:100671926-100671948 CCAATCAGATAGTTTTGGCCAGG - Intergenic
1047595481 8:126373725-126373747 CCTATTTTATTGTGTTGCTCAGG - Intergenic
1051679788 9:19595495-19595517 ACAATTTGACAGTTTTGCTCAGG + Intronic
1053318794 9:37077077-37077099 TCAACTTGAAAGTGTTGGCCAGG + Intergenic
1057060064 9:91995839-91995861 CCTGTTTGATCGTTTTGCCCTGG - Intergenic
1058430909 9:104918388-104918410 CCACTTTGATAGTTTTGTCCTGG - Intronic
1059444340 9:114328967-114328989 CCATTTTGCTCTTGTTGCCCAGG - Intergenic
1059454542 9:114391342-114391364 CCAATTTTATAGTGAGGCCCTGG + Intronic
1186460136 X:9741693-9741715 CAAATTTCACTGTGTTGCCCAGG - Intronic
1188287766 X:28349117-28349139 CCAATCAGATACTTTTGCCCTGG + Intergenic
1188375087 X:29418545-29418567 CCAATTAGATATTGTTGCTATGG + Intronic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1194614376 X:96083452-96083474 CCAATTTGTTAGTTTTGCAAAGG - Intergenic
1197863406 X:130993967-130993989 CCAATTTCATAGAGCTGCCATGG - Intergenic